ID: 1096159818

View in Genome Browser
Species Human (GRCh38)
Location 12:49367284-49367306
Sequence TGGCGCGCACGCGCCCGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096159814_1096159818 -1 Left 1096159814 12:49367262-49367284 CCCTGAGCTCTGGCTGGCTGGCT 0: 1
1: 0
2: 4
3: 42
4: 361
Right 1096159818 12:49367284-49367306 TGGCGCGCACGCGCCCGAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 27
1096159815_1096159818 -2 Left 1096159815 12:49367263-49367285 CCTGAGCTCTGGCTGGCTGGCTG 0: 1
1: 0
2: 8
3: 79
4: 544
Right 1096159818 12:49367284-49367306 TGGCGCGCACGCGCCCGAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 27
1096159810_1096159818 15 Left 1096159810 12:49367246-49367268 CCGGCGCGAGTACGCGCCCTGAG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 1096159818 12:49367284-49367306 TGGCGCGCACGCGCCCGAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 27
1096159809_1096159818 26 Left 1096159809 12:49367235-49367257 CCGGATTCGCGCCGGCGCGAGTA 0: 1
1: 0
2: 0
3: 0
4: 1
Right 1096159818 12:49367284-49367306 TGGCGCGCACGCGCCCGAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096159818 Original CRISPR TGGCGCGCACGCGCCCGAGA GGG Intronic