ID: 1096165509

View in Genome Browser
Species Human (GRCh38)
Location 12:49420152-49420174
Sequence AACACGTAGATGGGTAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096165509 Original CRISPR AACACGTAGATGGGTAGAAA AGG Intronic
904384405 1:30132078-30132100 AACAATTAGAAGGGGAGAAAGGG - Intergenic
907801153 1:57767032-57767054 AACACATTGATGGGCTGAAAAGG - Intronic
911121036 1:94296702-94296724 AACACAGAGCTGGGTAGAGAAGG + Intergenic
915822589 1:159041179-159041201 CACATGTAAATGGTTAGAAATGG + Intronic
918033446 1:180840855-180840877 ACCAGGTAGATAGGTAGACAGGG + Intronic
1063486737 10:6427164-6427186 AACAGGTGGATGTGTAAAAATGG - Exonic
1063650397 10:7930276-7930298 AAGAGGTGGGTGGGTAGAAAGGG + Intronic
1066009486 10:31181335-31181357 AACCTGTAGAGGGGAAGAAAAGG + Intergenic
1066455018 10:35565196-35565218 AACATGTAGATGGGTTGGCAGGG + Intronic
1066586928 10:36945748-36945770 AACATGGAGGTGGGTAGAGATGG - Intergenic
1068059523 10:52049941-52049963 AACAAGTAGAAGCCTAGAAAAGG + Intronic
1071182379 10:83002032-83002054 AACAAGTATTTGGGTAGGAATGG + Intergenic
1071824331 10:89309684-89309706 AACAGCAAGAAGGGTAGAAAAGG + Intronic
1078966979 11:16356930-16356952 AATAAGTAGATGGGGTGAAAGGG + Intronic
1079730389 11:23933594-23933616 GACACATAGTTGGGAAGAAAAGG - Intergenic
1080226126 11:29962695-29962717 AACACTTAGATGGTTGTAAAGGG + Intergenic
1080248077 11:30201969-30201991 AACTAGTTGATGGGTATAAAGGG + Intergenic
1081456960 11:43233162-43233184 AAAACATAGATGGGAAGCAAAGG - Intergenic
1085901338 11:80703371-80703393 AACATGGAGGTGGGTAGAGATGG + Intergenic
1087898842 11:103617582-103617604 AACATGAATATGGGTAGACAAGG + Intergenic
1088093137 11:106066258-106066280 AACAAATAAATGGCTAGAAACGG - Intronic
1090664009 11:128902805-128902827 AACATGTCCATGGGCAGAAAAGG + Intronic
1090810934 11:130242141-130242163 AACAAATAGAAGGGGAGAAATGG - Intronic
1094017581 12:25881350-25881372 AAAAAGTATATAGGTAGAAATGG + Intergenic
1094199610 12:27782094-27782116 AACACGTGGATGGGAAGAAAGGG - Intronic
1096165509 12:49420152-49420174 AACACGTAGATGGGTAGAAAAGG + Intronic
1097628778 12:62034114-62034136 AACACGTAAATGGATATAATGGG + Intronic
1098574650 12:72027519-72027541 GACACGTAGTTAGGTAGAGATGG + Intronic
1098900733 12:76109530-76109552 AACACTTTGGTGGGTAGAATTGG + Intergenic
1100861979 12:98816033-98816055 AAGACGAAGATGGGTAGGAGAGG - Intronic
1102930982 12:116862006-116862028 AACAGGGAGATGGGAAGAAGTGG + Intronic
1104286324 12:127428076-127428098 AACACGAAGAGGGGCTGAAACGG - Intergenic
1106776086 13:33011167-33011189 AGCAGGGAGATGGGTAGAAGAGG + Intergenic
1110372441 13:74755017-74755039 AACACGTATGTGCGTAGAAGAGG + Intergenic
1110797764 13:79659644-79659666 AACATGTAGATGGGAAGGGAAGG - Intergenic
1112678194 13:101729435-101729457 AACACGTAAATGGGAAGCAATGG + Intronic
1119102234 14:71890556-71890578 AGCAGGTAAATGGTTAGAAAGGG - Intergenic
1119368180 14:74113430-74113452 AACACAAAGATGGGTAGAAATGG + Intronic
1119595643 14:75930932-75930954 AACAGCTAGAGCGGTAGAAAGGG - Intronic
1119672811 14:76532368-76532390 AACAGGGAGATGGCTAGAGAGGG - Intergenic
1124922467 15:34039664-34039686 AACTGGGAGATGGCTAGAAAGGG + Intronic
1126376458 15:48001731-48001753 AAGAAGGAGGTGGGTAGAAAGGG + Intergenic
1126829846 15:52590342-52590364 AACACTTAGCTGTTTAGAAACGG - Intronic
1127278837 15:57471543-57471565 AAGACTTAGTTGGGTAGAGAAGG + Intronic
1127316490 15:57799329-57799351 AACAGGTGGATGGAGAGAAAGGG - Intergenic
1129291361 15:74570389-74570411 AACACTCAGTTGGGTGGAAAGGG - Intronic
1130644520 15:85712314-85712336 CACACGTAGATGACTAGAAGAGG + Intronic
1130687787 15:86054137-86054159 AACACGTAGGTAGGTATCAATGG - Intergenic
1133633988 16:7648939-7648961 AAAACGTACAAGGGTAGAAGTGG + Intronic
1141048851 16:80742652-80742674 GATAGGTGGATGGGTAGAAAGGG + Intronic
1141850742 16:86644110-86644132 ACCTTGGAGATGGGTAGAAAGGG + Intergenic
1149295564 17:55259347-55259369 GACAGGTAGATCGGTAGAAGAGG - Intergenic
1155232354 18:23785642-23785664 AACAGGGAGATGGCTGGAAATGG - Intronic
1159832726 18:73297470-73297492 AACTCTTAGAAGGTTAGAAATGG + Intergenic
1159991807 18:74917535-74917557 AAGACGTATATGGGGACAAAGGG - Intronic
1160048067 18:75406200-75406222 AACACTCAGAGGGGTAGGAAAGG + Intergenic
1160137432 18:76284414-76284436 AACAAGTACATGGATAGACAGGG + Intergenic
1164922028 19:32095441-32095463 ATCACCTAGCTGGGTACAAAAGG + Intergenic
1166277334 19:41763123-41763145 CACACGTGGAAGGGTTGAAAAGG - Intronic
1167829145 19:52004251-52004273 AAAAGGTAGATGGGTACACATGG - Intronic
928380591 2:30814358-30814380 AACACGAAGGTAGGTAGGAAAGG + Intronic
928702146 2:33909868-33909890 AAAACGTAAATGGCAAGAAAGGG + Intergenic
931302943 2:60998825-60998847 AGCACTTGGATGGGTAGAAATGG + Intronic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
931908348 2:66867676-66867698 AAGAGGAACATGGGTAGAAATGG + Intergenic
933253941 2:80059618-80059640 CACACGCTGATGGGGAGAAATGG - Intronic
933946655 2:87292154-87292176 AACACGGAGTTGGGAAGAGATGG + Intergenic
937655153 2:124366625-124366647 AACACCTGGAGGGGTAGAATTGG - Intronic
938792680 2:134690936-134690958 ACCAGGTAGATGGGTAGTCAGGG - Intronic
940975344 2:159936942-159936964 AATAAGTAGATGGGAATAAAAGG + Intronic
942512440 2:176717125-176717147 AAAACCTAGAGGGGAAGAAAGGG + Intergenic
942897936 2:181080709-181080731 AACACGTTGTTGGGTAAATAAGG + Intergenic
943187635 2:184632992-184633014 AAGCCGAAGCTGGGTAGAAAAGG - Intronic
944985556 2:205171630-205171652 AACACAGAGGTGTGTAGAAAAGG - Intronic
946704937 2:222449161-222449183 AACGACCAGATGGGTAGAAAGGG - Intronic
947048157 2:226012060-226012082 AAAACGTACATGCCTAGAAATGG + Intergenic
1171259563 20:23720095-23720117 AACAGATAGATGGATAGATAGGG - Intergenic
1171953275 20:31440352-31440374 AACAGGTAGATGAGCTGAAATGG - Intergenic
1173284756 20:41660203-41660225 AACATTTAGATGGGGAGATAAGG - Intergenic
1173875746 20:46370231-46370253 AACAAGTGGATGGGCAGAACTGG + Intronic
1176897687 21:14401807-14401829 AAGAGGTAGATGGGTAGGTATGG + Intergenic
1178392844 21:32213590-32213612 CACACGTTGAAAGGTAGAAAAGG - Intergenic
1179936458 21:44608339-44608361 AACACAGAGATGGGAAGAGAGGG - Intronic
951943100 3:28103921-28103943 AACAAGCAGATGGGTGGACAGGG - Intergenic
952868854 3:37879317-37879339 GACAGGCAGATAGGTAGAAAAGG - Intronic
957658437 3:83113528-83113550 AACAAGTAGATGGGTAAAACAGG + Intergenic
957706476 3:83792755-83792777 AACTCGGAGATGGTTAGAGATGG + Intergenic
965602250 3:170467028-170467050 AACACACAAGTGGGTAGAAATGG - Exonic
966752807 3:183338689-183338711 AACAGGTAGAGAGGGAGAAAAGG - Intronic
972087978 4:35243123-35243145 AACACTTAGGTGAGTTGAAAAGG + Intergenic
974095179 4:57355674-57355696 AACACTTAGACTAGTAGAAAAGG + Intergenic
975299218 4:72770040-72770062 AACACGTAGTTGGCTCGTAATGG + Intergenic
978396328 4:108284472-108284494 AACACGTAGATTAAAAGAAATGG + Intergenic
981890119 4:149726504-149726526 AACACTTAGAGGGCAAGAAAAGG - Intergenic
987721744 5:21643657-21643679 TATAAGTAGATGGGGAGAAATGG - Intergenic
988886670 5:35565239-35565261 AAAACGCAGAAGGGTAAAAAGGG - Intergenic
990235383 5:53761798-53761820 AGCACAGAGATGGGTAGAAAGGG + Intergenic
991563736 5:67982968-67982990 AAAACATATATGGGTAAAAAGGG - Intergenic
992862534 5:80926796-80926818 AACAAGTAGATGGAAAAAAAAGG + Intergenic
993392066 5:87331082-87331104 AGTAGGGAGATGGGTAGAAATGG + Intronic
993717788 5:91292560-91292582 AACACTTAGAAGAGAAGAAAGGG - Intergenic
996295015 5:121902718-121902740 AATACATAGATAGGTAGATAGGG + Intergenic
997148152 5:131460522-131460544 AACACTTGGAAGGCTAGAAATGG - Intronic
1002027529 5:176405673-176405695 AACAAGTAGCTGGGTACACAGGG + Intronic
1005978497 6:30818059-30818081 TACAAGGAGGTGGGTAGAAAAGG - Intergenic
1007650531 6:43417705-43417727 AACACCTAGGTGGGAAGAAGAGG - Intergenic
1008625129 6:53308179-53308201 AAGACCTAGATGGGAAGTAAAGG + Intronic
1010165480 6:72910358-72910380 AACACAGTGAGGGGTAGAAAAGG + Intronic
1011285842 6:85721749-85721771 AACAGGTTGGTGGGTAAAAATGG + Intergenic
1015869483 6:137761359-137761381 TGCAGGTAGAAGGGTAGAAATGG - Intergenic
1020355187 7:7267956-7267978 AATAGGTATATGGGGAGAAATGG + Intergenic
1023263053 7:38377708-38377730 CAGACGTGGATAGGTAGAAATGG - Intergenic
1028580565 7:92405148-92405170 AACACGTAGATCAATAGAATAGG + Intergenic
1030180928 7:106708448-106708470 ATCTCGTAGACGGGTAGTAAAGG - Intergenic
1031225591 7:119033888-119033910 ATTGTGTAGATGGGTAGAAAAGG - Intergenic
1033869814 7:145738209-145738231 AACTACTAGATGGGGAGAAAAGG + Intergenic
1033945841 7:146716559-146716581 CAAACATAGATGGGTACAAAGGG - Intronic
1036000702 8:4600305-4600327 AATATAGAGATGGGTAGAAATGG + Intronic
1036039417 8:5058559-5058581 AAAACATAGAAGGGTAAAAAGGG - Intergenic
1044065874 8:87699654-87699676 AACATGTCGGTGGGTGGAAAAGG - Intergenic
1048095469 8:131287504-131287526 AAAAAGTAGATGGGAAAAAATGG + Intergenic
1052431391 9:28371231-28371253 AAAACGTCAATGGGTTGAAATGG - Intronic
1060341892 9:122784820-122784842 AACAGGTAGTTGAGTAGAACTGG + Intergenic
1061116201 9:128614069-128614091 CACAGGTAGGTAGGTAGAAAAGG + Intronic
1186407856 X:9319421-9319443 AATACGTAAATGAATAGAAATGG + Intergenic
1192247261 X:69384104-69384126 AGCTGGGAGATGGGTAGAAATGG - Intergenic