ID: 1096167578

View in Genome Browser
Species Human (GRCh38)
Location 12:49437067-49437089
Sequence CGCCCGGCAGCCACTCCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7371
Summary {0: 19, 1: 834, 2: 1319, 3: 2223, 4: 2976}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096167578_1096167588 15 Left 1096167578 12:49437067-49437089 CCAGACGGAGTGGCTGCCGGGCG 0: 19
1: 834
2: 1319
3: 2223
4: 2976
Right 1096167588 12:49437105-49437127 TTTCAGACGGTGTGGCTGCCGGG 0: 1
1: 21
2: 72
3: 1250
4: 4079
1096167578_1096167587 14 Left 1096167578 12:49437067-49437089 CCAGACGGAGTGGCTGCCGGGCG 0: 19
1: 834
2: 1319
3: 2223
4: 2976
Right 1096167587 12:49437104-49437126 TTTTCAGACGGTGTGGCTGCCGG 0: 1
1: 17
2: 61
3: 1039
4: 2644
1096167578_1096167589 18 Left 1096167578 12:49437067-49437089 CCAGACGGAGTGGCTGCCGGGCG 0: 19
1: 834
2: 1319
3: 2223
4: 2976
Right 1096167589 12:49437108-49437130 CAGACGGTGTGGCTGCCGGGTGG 0: 20
1: 396
2: 1649
3: 1477
4: 922
1096167578_1096167591 22 Left 1096167578 12:49437067-49437089 CCAGACGGAGTGGCTGCCGGGCG 0: 19
1: 834
2: 1319
3: 2223
4: 2976
Right 1096167591 12:49437112-49437134 CGGTGTGGCTGCCGGGTGGAGGG 0: 1
1: 52
2: 385
3: 966
4: 1368
1096167578_1096167592 23 Left 1096167578 12:49437067-49437089 CCAGACGGAGTGGCTGCCGGGCG 0: 19
1: 834
2: 1319
3: 2223
4: 2976
Right 1096167592 12:49437113-49437135 GGTGTGGCTGCCGGGTGGAGGGG 0: 1
1: 72
2: 659
3: 1071
4: 1535
1096167578_1096167584 2 Left 1096167578 12:49437067-49437089 CCAGACGGAGTGGCTGCCGGGCG 0: 19
1: 834
2: 1319
3: 2223
4: 2976
Right 1096167584 12:49437092-49437114 GGGGCTCCTCACTTTTCAGACGG 0: 12
1: 1689
2: 2081
3: 4857
4: 6052
1096167578_1096167590 21 Left 1096167578 12:49437067-49437089 CCAGACGGAGTGGCTGCCGGGCG 0: 19
1: 834
2: 1319
3: 2223
4: 2976
Right 1096167590 12:49437111-49437133 ACGGTGTGGCTGCCGGGTGGAGG 0: 1
1: 51
2: 395
3: 1052
4: 2774
1096167578_1096167585 7 Left 1096167578 12:49437067-49437089 CCAGACGGAGTGGCTGCCGGGCG 0: 19
1: 834
2: 1319
3: 2223
4: 2976
Right 1096167585 12:49437097-49437119 TCCTCACTTTTCAGACGGTGTGG 0: 1
1: 45
2: 2275
3: 3642
4: 3972

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096167578 Original CRISPR CGCCCGGCAGCCACTCCGTC TGG (reversed) Intronic
Too many off-targets to display for this crispr