ID: 1096167583

View in Genome Browser
Species Human (GRCh38)
Location 12:49437083-49437105
Sequence AAGTGAGGAGCCCCTCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25781
Summary {0: 1291, 1: 4807, 2: 5115, 3: 7429, 4: 7139}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096167583_1096167588 -1 Left 1096167583 12:49437083-49437105 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1096167588 12:49437105-49437127 TTTCAGACGGTGTGGCTGCCGGG 0: 1
1: 21
2: 72
3: 1250
4: 4079
1096167583_1096167587 -2 Left 1096167583 12:49437083-49437105 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1096167587 12:49437104-49437126 TTTTCAGACGGTGTGGCTGCCGG 0: 1
1: 17
2: 61
3: 1039
4: 2644
1096167583_1096167596 28 Left 1096167583 12:49437083-49437105 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1096167596 12:49437134-49437156 GGCTCCTCACTTCTCAGACGGGG 0: 1649
1: 1802
2: 3083
3: 7973
4: 5376
1096167583_1096167592 7 Left 1096167583 12:49437083-49437105 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1096167592 12:49437113-49437135 GGTGTGGCTGCCGGGTGGAGGGG 0: 1
1: 72
2: 659
3: 1071
4: 1535
1096167583_1096167594 26 Left 1096167583 12:49437083-49437105 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1096167594 12:49437132-49437154 GGGGCTCCTCACTTCTCAGACGG 0: 1678
1: 2039
2: 4785
3: 5902
4: 5145
1096167583_1096167595 27 Left 1096167583 12:49437083-49437105 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1096167595 12:49437133-49437155 GGGCTCCTCACTTCTCAGACGGG 0: 1555
1: 1910
2: 1784
3: 7700
4: 7503
1096167583_1096167589 2 Left 1096167583 12:49437083-49437105 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1096167589 12:49437108-49437130 CAGACGGTGTGGCTGCCGGGTGG 0: 20
1: 396
2: 1649
3: 1477
4: 922
1096167583_1096167590 5 Left 1096167583 12:49437083-49437105 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1096167590 12:49437111-49437133 ACGGTGTGGCTGCCGGGTGGAGG 0: 1
1: 51
2: 395
3: 1052
4: 2774
1096167583_1096167591 6 Left 1096167583 12:49437083-49437105 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1096167591 12:49437112-49437134 CGGTGTGGCTGCCGGGTGGAGGG 0: 1
1: 52
2: 385
3: 966
4: 1368
1096167583_1096167585 -9 Left 1096167583 12:49437083-49437105 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1096167585 12:49437097-49437119 TCCTCACTTTTCAGACGGTGTGG 0: 1
1: 45
2: 2275
3: 3642
4: 3972

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096167583 Original CRISPR AAGTGAGGAGCCCCTCCGCC CGG (reversed) Intronic
Too many off-targets to display for this crispr