ID: 1096167586

View in Genome Browser
Species Human (GRCh38)
Location 12:49437098-49437120
Sequence GCCACACCGTCTGAAAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8105
Summary {0: 1, 1: 20, 2: 218, 3: 3738, 4: 4128}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096167586_1096167591 -9 Left 1096167586 12:49437098-49437120 CCTCACTTTTCAGACGGTGTGGC 0: 1
1: 20
2: 218
3: 3738
4: 4128
Right 1096167591 12:49437112-49437134 CGGTGTGGCTGCCGGGTGGAGGG 0: 1
1: 52
2: 385
3: 966
4: 1368
1096167586_1096167595 12 Left 1096167586 12:49437098-49437120 CCTCACTTTTCAGACGGTGTGGC 0: 1
1: 20
2: 218
3: 3738
4: 4128
Right 1096167595 12:49437133-49437155 GGGCTCCTCACTTCTCAGACGGG 0: 1555
1: 1910
2: 1784
3: 7700
4: 7503
1096167586_1096167599 24 Left 1096167586 12:49437098-49437120 CCTCACTTTTCAGACGGTGTGGC 0: 1
1: 20
2: 218
3: 3738
4: 4128
Right 1096167599 12:49437145-49437167 TCTCAGACGGGGCGGTTGCCAGG 0: 395
1: 833
2: 887
3: 3057
4: 9197
1096167586_1096167596 13 Left 1096167586 12:49437098-49437120 CCTCACTTTTCAGACGGTGTGGC 0: 1
1: 20
2: 218
3: 3738
4: 4128
Right 1096167596 12:49437134-49437156 GGCTCCTCACTTCTCAGACGGGG 0: 1649
1: 1802
2: 3083
3: 7973
4: 5376
1096167586_1096167597 16 Left 1096167586 12:49437098-49437120 CCTCACTTTTCAGACGGTGTGGC 0: 1
1: 20
2: 218
3: 3738
4: 4128
Right 1096167597 12:49437137-49437159 TCCTCACTTCTCAGACGGGGCGG 0: 2126
1: 3475
2: 3747
3: 6550
4: 5316
1096167586_1096167600 30 Left 1096167586 12:49437098-49437120 CCTCACTTTTCAGACGGTGTGGC 0: 1
1: 20
2: 218
3: 3738
4: 4128
Right 1096167600 12:49437151-49437173 ACGGGGCGGTTGCCAGGCAGAGG 0: 282
1: 453
2: 421
3: 2114
4: 3702
1096167586_1096167592 -8 Left 1096167586 12:49437098-49437120 CCTCACTTTTCAGACGGTGTGGC 0: 1
1: 20
2: 218
3: 3738
4: 4128
Right 1096167592 12:49437113-49437135 GGTGTGGCTGCCGGGTGGAGGGG 0: 1
1: 72
2: 659
3: 1071
4: 1535
1096167586_1096167594 11 Left 1096167586 12:49437098-49437120 CCTCACTTTTCAGACGGTGTGGC 0: 1
1: 20
2: 218
3: 3738
4: 4128
Right 1096167594 12:49437132-49437154 GGGGCTCCTCACTTCTCAGACGG 0: 1678
1: 2039
2: 4785
3: 5902
4: 5145
1096167586_1096167590 -10 Left 1096167586 12:49437098-49437120 CCTCACTTTTCAGACGGTGTGGC 0: 1
1: 20
2: 218
3: 3738
4: 4128
Right 1096167590 12:49437111-49437133 ACGGTGTGGCTGCCGGGTGGAGG 0: 1
1: 51
2: 395
3: 1052
4: 2774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096167586 Original CRISPR GCCACACCGTCTGAAAAGTG AGG (reversed) Intronic
Too many off-targets to display for this crispr