ID: 1096167591

View in Genome Browser
Species Human (GRCh38)
Location 12:49437112-49437134
Sequence CGGTGTGGCTGCCGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2772
Summary {0: 1, 1: 52, 2: 385, 3: 966, 4: 1368}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096167577_1096167591 23 Left 1096167577 12:49437066-49437088 CCCAGACGGAGTGGCTGCCGGGC 0: 19
1: 404
2: 2824
3: 3670
4: 3662
Right 1096167591 12:49437112-49437134 CGGTGTGGCTGCCGGGTGGAGGG 0: 1
1: 52
2: 385
3: 966
4: 1368
1096167578_1096167591 22 Left 1096167578 12:49437067-49437089 CCAGACGGAGTGGCTGCCGGGCG 0: 19
1: 834
2: 1319
3: 2223
4: 2976
Right 1096167591 12:49437112-49437134 CGGTGTGGCTGCCGGGTGGAGGG 0: 1
1: 52
2: 385
3: 966
4: 1368
1096167583_1096167591 6 Left 1096167583 12:49437083-49437105 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1096167591 12:49437112-49437134 CGGTGTGGCTGCCGGGTGGAGGG 0: 1
1: 52
2: 385
3: 966
4: 1368
1096167586_1096167591 -9 Left 1096167586 12:49437098-49437120 CCTCACTTTTCAGACGGTGTGGC 0: 1
1: 20
2: 218
3: 3738
4: 4128
Right 1096167591 12:49437112-49437134 CGGTGTGGCTGCCGGGTGGAGGG 0: 1
1: 52
2: 385
3: 966
4: 1368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096167591 Original CRISPR CGGTGTGGCTGCCGGGTGGA GGG Intronic
Too many off-targets to display for this crispr