ID: 1096169852

View in Genome Browser
Species Human (GRCh38)
Location 12:49459130-49459152
Sequence ATTTAAGCAGAGAAGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 444}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096169847_1096169852 16 Left 1096169847 12:49459091-49459113 CCATAAAAGGGAAGAAAGTTTCG 0: 12
1: 41
2: 28
3: 77
4: 563
Right 1096169852 12:49459130-49459152 ATTTAAGCAGAGAAGGAGATGGG 0: 1
1: 0
2: 4
3: 47
4: 444
1096169846_1096169852 17 Left 1096169846 12:49459090-49459112 CCCATAAAAGGGAAGAAAGTTTC 0: 30
1: 38
2: 31
3: 58
4: 736
Right 1096169852 12:49459130-49459152 ATTTAAGCAGAGAAGGAGATGGG 0: 1
1: 0
2: 4
3: 47
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096169852 Original CRISPR ATTTAAGCAGAGAAGGAGAT GGG Intronic
901292662 1:8136348-8136370 ATTTCGGCAGAGATGGAGCTTGG - Intergenic
901835157 1:11919337-11919359 ATCTTAGCAGGGAAGGAGCTAGG + Intergenic
902627511 1:17685072-17685094 ATTTGAGCTGGGAAGGAGCTGGG + Intronic
903171505 1:21557345-21557367 ATTTCAGCAGATGAGGAGATGGG + Intronic
904216832 1:28927674-28927696 ATTTAAGAGGAGAAGGAGAAAGG - Intronic
906130173 1:43451172-43451194 TTTAATGCAGAGGAGGAGATGGG + Exonic
906841861 1:49147815-49147837 CTTCAAGCAGGGAAGGAGAGGGG + Intronic
906926406 1:50122321-50122343 ATTTTATCACAGCAGGAGATAGG + Intronic
907484119 1:54765153-54765175 ATTTAAGCAGGGCAGGGAATGGG + Intergenic
907560824 1:55385917-55385939 AATAAAGCATGGAAGGAGATAGG + Intergenic
907740999 1:57165661-57165683 ATTTATGCAGAGGAGGAAATAGG + Intronic
908338394 1:63150621-63150643 ATTTACCCAGAGAAGCAGAGGGG - Intergenic
908390050 1:63675923-63675945 ATTTCAGGAGAGAGGGAGAAGGG - Intergenic
908659786 1:66423847-66423869 TTTAAATCAGAGAAGGAGAAGGG + Intergenic
909016832 1:70389042-70389064 ATTAAAGCAGAGAGGGAGGAAGG - Intergenic
909050687 1:70764230-70764252 TGATAAGCAGAGAAGGAGAGGGG + Intergenic
909113930 1:71510590-71510612 ACTTAAGCAGAGAAGGGGATGGG + Intronic
909198479 1:72657989-72658011 CATTAAGCATAGAAGAAGATAGG - Intergenic
909251235 1:73359291-73359313 ACTTAAGCGGAGAAGGAGACAGG + Intergenic
909423958 1:75499681-75499703 AAATAAGAAGAGAAAGAGATAGG - Intronic
909658011 1:78052234-78052256 AATTAAGCAGAGAAGGGAACAGG - Intronic
909867501 1:80692708-80692730 AAATAAGGAGAGAAGGAAATAGG - Intergenic
909881772 1:80889059-80889081 TTTTAAGTAGAAAAGGAGTTGGG - Intergenic
910228115 1:84957199-84957221 AGTAAAGCAGGGAAGGAGATGGG - Intronic
910520203 1:88112438-88112460 ATTAAAGCAGGGATGGAAATTGG + Intergenic
911372998 1:97016629-97016651 AATAAAGAAGAGTAGGAGATAGG - Intergenic
911965150 1:104359508-104359530 TATTAAGAAAAGAAGGAGATTGG + Intergenic
912702917 1:111891604-111891626 GGTAAAGCAGAGAGGGAGATGGG - Intronic
915084513 1:153376011-153376033 CTTTATGCAGCTAAGGAGATAGG + Intergenic
915827849 1:159097649-159097671 ATTTAAACATAGAAGGGGAAGGG - Intronic
917264219 1:173202851-173202873 ATTTAAGCAGACAAGCGGATGGG - Intronic
917491031 1:175498660-175498682 AGTTAAGCAGAGAAGGAATATGG + Intronic
918319161 1:183348516-183348538 AAAAAATCAGAGAAGGAGATTGG + Intronic
918343916 1:183590148-183590170 ACTGAAGCAGAGAAGGTGAGTGG - Exonic
918544131 1:185663395-185663417 ATTTAGGCAGAAAAAAAGATTGG + Intergenic
919020391 1:192097967-192097989 ATTTAAGCAAAAATGGAGTTTGG + Intergenic
919963502 1:202496915-202496937 ATTTTAGTTGAGAAGGAGTTTGG + Intronic
920237967 1:204521908-204521930 AATAAAGCAGGGAAGGAGATAGG + Intronic
920557244 1:206913162-206913184 AAAGAAGCAGAGAAGGAGCTGGG + Intronic
920857348 1:209674132-209674154 CTTTAAGCAGAGAAAGGGAGGGG - Intergenic
921193142 1:212727126-212727148 AGTTTAGGAGAGAAGGGGATCGG - Intronic
921719815 1:218459163-218459185 AGATAACCAGAGAAGTAGATGGG + Intergenic
922136425 1:222831959-222831981 AATTAAGCAGAAAAGTAGAGTGG + Intergenic
922343944 1:224680556-224680578 ATTTGGGCAGAAAAGGTGATTGG - Intronic
924804849 1:247354028-247354050 ACTTAAGCAGGGAAGGAGACTGG + Intergenic
924805348 1:247357318-247357340 ACTTAAGCATAGAAGGAGGCGGG - Intergenic
1063398274 10:5714577-5714599 ACATAAGAAGAGAAGCAGATTGG + Intronic
1063414777 10:5864416-5864438 TTTAAATCAGAGAAGGAGAAGGG - Intronic
1063989841 10:11548567-11548589 ATTTATGAAGGGAAGGAGATAGG - Intronic
1064323667 10:14329382-14329404 ATTAAAGCACACAAGGACATGGG - Intronic
1064582467 10:16808304-16808326 ATTTTAGTAGAGATGGGGATGGG - Intronic
1064586212 10:16841980-16842002 AATCAAGCAGGAAAGGAGATGGG - Intronic
1064821453 10:19339282-19339304 ATTTAAGAAGGCAAGGAGAGAGG - Intronic
1065727498 10:28679863-28679885 CTTGAAGCAGAGAAGGAACTTGG + Intronic
1065841273 10:29703476-29703498 AGTGAAGCAGAGAAGGGGAGGGG + Intronic
1065982249 10:30911481-30911503 ATTAAAGCTGAGAAGGAGACGGG - Intronic
1067323911 10:45248294-45248316 AGTCAAGCAGGAAAGGAGATGGG - Intergenic
1067556234 10:47275043-47275065 ATTTAAAGAGAGAGAGAGATTGG + Intergenic
1069568879 10:69482231-69482253 AGCAAAGAAGAGAAGGAGATGGG + Intronic
1070011472 10:72479129-72479151 GTTTAAACAGAGGAGGATATTGG + Intronic
1070664403 10:78333111-78333133 AATGGAGCAGAGAAGGAGAAGGG + Intergenic
1072472752 10:95729183-95729205 ATTTAAGGACAGAAAGAGAAAGG - Intronic
1073265820 10:102227877-102227899 ACTAAAGCCGAGAATGAGATGGG - Intronic
1073855277 10:107666314-107666336 TTATAAGCAGAGAATGAGAGAGG - Intergenic
1074019871 10:109571293-109571315 ATCTAAGCAGGGAAGGTGATGGG + Intergenic
1074579586 10:114706161-114706183 ATATAATTAGAGAAGGAGAAGGG + Intergenic
1075172936 10:120132757-120132779 ATTAAATCAGAGAAGCAGTTTGG - Intergenic
1076130350 10:128009747-128009769 ATTTAAACAATGAAGGAGCTGGG - Intronic
1076323020 10:129597793-129597815 ACTTCTGTAGAGAAGGAGATAGG - Intronic
1079427544 11:20357780-20357802 ATTGAAGCAGAGGAGGAGTATGG - Intergenic
1079627010 11:22628018-22628040 ATTTAAACAGATAAGTAGAAAGG - Intronic
1080297062 11:30742356-30742378 ATTTTAGCAGAGAAGAAGGAAGG - Intergenic
1080621134 11:33988070-33988092 AGTTTTGCAGAGAAGGAGGTAGG - Intergenic
1081428095 11:42947308-42947330 AGCTAAGCAGAGATGGAGCTGGG - Intergenic
1081717419 11:45260301-45260323 ATTGCACAAGAGAAGGAGATAGG - Intronic
1081827561 11:46071928-46071950 ATATAAGCAGAGCAAAAGATCGG + Intronic
1082631404 11:55546286-55546308 AATTAAGCAAAGCAGGATATGGG + Intergenic
1083376281 11:62224829-62224851 CTTGAGGCAGAGAAGGGGATTGG - Intergenic
1083784339 11:64935168-64935190 ATTGAAGGCTAGAAGGAGATAGG + Exonic
1086055632 11:82642908-82642930 AGTTAAGCTATGAAGGAGATGGG + Intergenic
1086093678 11:83029370-83029392 ATTTAAGCAAAGAAAAAAATAGG - Intronic
1086140249 11:83490827-83490849 ATTAAAGGAGATAAGGAAATAGG + Intronic
1086402543 11:86472492-86472514 ATGTAGGCAGAGAAGAAGCTGGG + Intronic
1086549878 11:88043367-88043389 ATGGAGGCAGGGAAGGAGATAGG + Intergenic
1086581703 11:88407644-88407666 ACTTTGGCAGAGAAAGAGATGGG - Intergenic
1086897501 11:92330309-92330331 AATAAAGCAGAGAGGGGGATAGG - Intergenic
1087262798 11:96029652-96029674 ATAGGAGCAGAGAAGAAGATGGG - Intronic
1089319701 11:117617113-117617135 ATGTTTGCAGAGAAGAAGATGGG + Intronic
1089926660 11:122265588-122265610 ATTTAAACAGAAAAAGAGAGCGG - Intergenic
1090455276 11:126843679-126843701 AGTTAATCACAGAATGAGATAGG + Intronic
1090485900 11:127111849-127111871 ATTTCAGAAGAGAAATAGATAGG + Intergenic
1091886348 12:4019697-4019719 AGAAAAGCAGAGAAGGAGTTGGG - Intergenic
1092041905 12:5392807-5392829 ATTGGAGCAGAGAAGGGGAATGG - Intergenic
1092213867 12:6667005-6667027 TTGTAGGCAGAGAAGGAGAGAGG + Exonic
1093421433 12:18978873-18978895 ATGCAAGCACAAAAGGAGATAGG - Intergenic
1094074509 12:26458138-26458160 ACTTAACCAGAGATGGAGACAGG + Intronic
1094140890 12:27181184-27181206 ATTTAAGAAGAGCTGGAGATGGG + Intergenic
1095806409 12:46324989-46325011 GTTTCAGCAGAGAAGTAGGTGGG + Intergenic
1096169852 12:49459130-49459152 ATTTAAGCAGAGAAGGAGATGGG + Intronic
1097155521 12:57009285-57009307 ACTTAATTAGAGAAGGAGGTGGG - Intergenic
1098048465 12:66427173-66427195 ATTTAAGTAAAGAAGCAGAGGGG - Intronic
1098140551 12:67446107-67446129 ATTTAGCCAGACAAAGAGATGGG + Intergenic
1098789749 12:74806487-74806509 AGTTAAGCAGGGAAGGGGACCGG - Intergenic
1098978185 12:76926585-76926607 ATTTAAGGAGGGCTGGAGATTGG + Intergenic
1099100225 12:78430371-78430393 AATTAAGCAAAGGAGTAGATGGG + Intergenic
1099928296 12:89044257-89044279 ATATGAGGAGAGAAAGAGATGGG - Intergenic
1100277097 12:93081315-93081337 ACATAAGCAGCGAAGGAGAGGGG + Intergenic
1101005210 12:100395174-100395196 ATGTAAGCATGGTAGGAGATGGG - Intronic
1101267402 12:103103465-103103487 ATTGAATCAGAGAGGTAGATAGG + Intergenic
1101508776 12:105374064-105374086 ATTTCAGAAGAAAAAGAGATGGG + Intronic
1101912137 12:108867963-108867985 ATTTAAGCAGCCAAAGAGAGAGG + Intronic
1102760480 12:115380634-115380656 AGTGAAGTGGAGAAGGAGATCGG + Intergenic
1103133493 12:118488336-118488358 ATTTAAGCTGAGAAGAAACTGGG + Intergenic
1103177604 12:118878133-118878155 ATTGAGGCAGAGAAGCAGAGAGG + Intergenic
1103216365 12:119204548-119204570 CTATCAGCAGAAAAGGAGATGGG + Intronic
1105329071 13:19398065-19398087 ATTTAAGCATTAAAGGAAATGGG + Intergenic
1107121048 13:36796155-36796177 ACTTAAGCAGGGAAGGGGGTGGG + Intergenic
1107659840 13:42627367-42627389 ATTTAATAAGAGAAGGAGGGAGG + Intergenic
1108254949 13:48601027-48601049 AGTTTAGCAGAGAAGGGGAGAGG + Intergenic
1109147679 13:58801753-58801775 AATAAAGGAGAGAAAGAGATAGG + Intergenic
1109424289 13:62151032-62151054 TTTAAATCAGAGAAGGAGAAGGG - Intergenic
1109545422 13:63836950-63836972 AGTTAAGAAGACACGGAGATTGG + Intergenic
1110152750 13:72274732-72274754 AGTGAGGCAGAGAAGGAGAGAGG + Intergenic
1110327135 13:74229870-74229892 ATTTTAGAAGATAAGGAGTTAGG - Intergenic
1110418539 13:75278710-75278732 ATTTGAGCACAGAACAAGATGGG + Intergenic
1111342792 13:86909898-86909920 ATGTAAGCAGGGCAGGAGAGAGG - Intergenic
1111480203 13:88814407-88814429 CTTGAAGCAGAGAAGGGGGTGGG + Intergenic
1111679890 13:91429391-91429413 TTTAGAGGAGAGAAGGAGATAGG + Intronic
1113112690 13:106841115-106841137 ATTTCTGCAGAGTAGGAGAGGGG - Intergenic
1113347755 13:109497149-109497171 ATGAAAGCAGAGAAGGTGAGAGG + Intergenic
1113372417 13:109735263-109735285 GTTTTAGCAGAAAAGGACATTGG - Intergenic
1114509219 14:23242998-23243020 ATTTAAAAAGATAGGGAGATGGG + Intronic
1114721619 14:24888777-24888799 ATAAAAGCAGAGAAAGGGATTGG - Intronic
1115468106 14:33738301-33738323 CTTTAAGCAGTGAAGCAGAGGGG - Intronic
1115652824 14:35415367-35415389 AGTTAAGGAGTTAAGGAGATAGG + Intergenic
1116387742 14:44352751-44352773 ATATAGGTAGAGAAAGAGATGGG + Intergenic
1116573294 14:46545105-46545127 ATAAAAGCAGAGAAGGGGTTGGG - Intergenic
1117158324 14:52962622-52962644 CTTTAGGCAGAAAAGGAGGTTGG - Intergenic
1117243000 14:53854469-53854491 ATTCCAGCAGAGAAAGAGAGGGG + Intergenic
1118022498 14:61732595-61732617 TTTTAACCAGAGAATTAGATGGG - Intronic
1118967329 14:70600271-70600293 GTTTAGGCAGAGAAGGGAATGGG - Intronic
1119083622 14:71720235-71720257 ATGTAGCGAGAGAAGGAGATCGG - Intronic
1120534923 14:85682970-85682992 ATTTTAGCAGAAAAGCAGAATGG - Intergenic
1120544809 14:85798102-85798124 AATTAAGAAAACAAGGAGATGGG + Intergenic
1124903249 15:33844139-33844161 TTTTAAGTAGAAAGGGAGATAGG - Intronic
1125139227 15:36384828-36384850 ATTTAATCAGAGCAGGATATTGG + Intergenic
1125701503 15:41689422-41689444 TTTTAAGGAGAGAAGGAGAGAGG - Intronic
1127641101 15:60916661-60916683 ATTAAATCAGAAAAGGTGATAGG + Intronic
1131980824 15:97992965-97992987 ATGTAACCAGAGTGGGAGATAGG + Intergenic
1131987649 15:98061221-98061243 ACTTGAGCAAAGAAGGAGATTGG - Intergenic
1132073237 15:98798152-98798174 ATTAAAGTAGGGAAGGGGATGGG + Intronic
1132107613 15:99074611-99074633 ATCTAAGCAGTGAGGGAGCTGGG + Intergenic
1134389447 16:13805800-13805822 AATAAAGCAGAGAAAGAAATAGG - Intergenic
1134825736 16:17282631-17282653 CTTTAAGGAGAGAAGGAGCTGGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135343153 16:21665812-21665834 ATTCAAGCAGTCAAGGGGATGGG - Intergenic
1136411457 16:30079891-30079913 ATTGAAGCAGGGAAGGAGGCTGG - Intronic
1137723589 16:50642069-50642091 ATTTAAGCAAAGCAAGAAATGGG + Intergenic
1137868246 16:51923772-51923794 ATTCAAGCAGTCTAGGAGATAGG + Intergenic
1138730422 16:59187992-59188014 AATTAAGCAGAGACGATGATAGG + Intergenic
1138737301 16:59265351-59265373 ATTCAAGCAGAGACAGTGATTGG - Intergenic
1140684059 16:77416084-77416106 ATTACAGCAGAGAAGGGGGTTGG + Intronic
1142142008 16:88476622-88476644 ATTTCAGCAGAGGAGGTGAGGGG + Intronic
1142472000 17:169851-169873 ATTTACACAGAGAAGGAACTGGG + Intronic
1143302399 17:5920224-5920246 CTTTAAGCAGAGAATGAACTTGG - Intronic
1143543559 17:7583251-7583273 AGTGAAGCAGAGGAGGAGGTGGG - Intergenic
1144008022 17:11118862-11118884 AGTCAGGCAGAGAAGGAGAGAGG + Intergenic
1144663369 17:17085947-17085969 AATTCCGCAGAGAAGGAGGTTGG - Intronic
1145043725 17:19595956-19595978 GTTTAAGCAGAGAAGGTGCCAGG - Intergenic
1146691705 17:34881240-34881262 TTTTAAGAAATGAAGGAGATGGG - Intergenic
1146831930 17:36076882-36076904 AGTTAAAAAGAGAAGGAGAGAGG + Intergenic
1147485127 17:40805407-40805429 GTGGAAGCAGAGACGGAGATTGG + Intergenic
1149698076 17:58632762-58632784 ATTAAAGCAGGGAAGGGGAGAGG + Intronic
1149969803 17:61205646-61205668 AGTGAAGCAGAGCAGGAGAAAGG + Intronic
1151045846 17:70918649-70918671 ATTTAAACACAGATAGAGATGGG + Intergenic
1151089992 17:71427786-71427808 ACTTAAGCAGAGAAGAATGTAGG - Intergenic
1152054519 17:78013314-78013336 AATTAAACAGAGGAGGAGAGAGG + Intronic
1152417617 17:80172772-80172794 GATGAAACAGAGAAGGAGATGGG - Intronic
1153266011 18:3270157-3270179 ATTTCAGAAGGGAAGGAGAGAGG + Intronic
1154217833 18:12428522-12428544 AGTTAAGCATGGAAGGACATTGG - Intronic
1155920947 18:31602237-31602259 ATCATAGCAGAGAGGGAGATGGG - Intergenic
1156226744 18:35117145-35117167 AGTAAAGCAGAGGAGGAAATTGG + Intronic
1156336113 18:36173016-36173038 ATTTAAGAAGATAGGGAGTTTGG - Intronic
1157402047 18:47396705-47396727 CATTAAGCAGATAAGGACATAGG - Intergenic
1158826526 18:61226475-61226497 ATTTAAAGAGAGAATGAGAAAGG + Intergenic
1158950252 18:62487961-62487983 AGCTAAGCAGAGAAGCAGCTTGG + Intergenic
1159121833 18:64179958-64179980 AATGAAGCAGGGAAGGAGAGTGG + Intergenic
1159234341 18:65651580-65651602 ACTTAAGCGGGGAAGGGGATGGG + Intergenic
1161756001 19:6134852-6134874 ACTAAAGCAGAGAACGAGAAGGG + Intronic
1162259305 19:9519385-9519407 ATTTATGCAGAAAATAAGATTGG + Intergenic
1164453121 19:28383820-28383842 AGTTCAGCAGAGAAGCAGACAGG - Intergenic
1165054062 19:33162545-33162567 GCTTAAGCAGAGAAGGAGTGGGG - Intronic
1165542648 19:36504942-36504964 TTTTTAGCAGAGAAGAAGAATGG - Intergenic
1165690178 19:37856773-37856795 ATATGAGCAGAGATGCAGATAGG - Intergenic
1168597991 19:57694596-57694618 ACTTAAGCAGGGAAGGGGACCGG - Intronic
925666647 2:6264068-6264090 ATTTAAGCAAAGGAGAAGAGAGG + Intergenic
925914996 2:8598365-8598387 CGTTAAACAGAGCAGGAGATGGG + Intergenic
926887424 2:17611036-17611058 AGAGAAACAGAGAAGGAGATAGG + Intronic
928093092 2:28388246-28388268 ATTTGGCCAGAGAAGGAGGTAGG + Intergenic
928191941 2:29178752-29178774 ATATATGCAGAGAAAGAGATAGG - Intronic
928603652 2:32924738-32924760 ATTTAAAAAGAGAAAGAGAAAGG + Intergenic
928857782 2:35820304-35820326 ATTTAAGAAAAGAAAGAGATTGG - Intergenic
928903158 2:36343335-36343357 ATTTAAGAAGACAAGGAGATGGG + Intergenic
929644556 2:43613666-43613688 ATTTAAGCAGAGAAGTCCCTTGG - Intergenic
930156038 2:48108489-48108511 AATTAAGAAAAGAAGGAAATGGG + Intergenic
930374723 2:50550974-50550996 ATTTAAGCTGAGAAGAGGCTGGG - Intronic
931032894 2:58202540-58202562 ATTTAAGCTGGGAAGGAATTTGG - Intronic
931157586 2:59652953-59652975 ACTTAGGCAGAAAAGGAGAGTGG - Intergenic
931829286 2:66034321-66034343 TTTTTAGTAGAGATGGAGATGGG + Intergenic
932032447 2:68204093-68204115 ATTTAAGCAGAAGACTAGATTGG - Intronic
933367139 2:81367367-81367389 ATTTAAGCACAGAACTAGCTTGG + Intergenic
934866581 2:97819457-97819479 AGTAAAACAGAGAAGGAGGTTGG - Intronic
936872613 2:117150512-117150534 ATTTGATCATAGAAGGAGAGTGG + Intergenic
938115147 2:128597453-128597475 ATGGAAACTGAGAAGGAGATGGG + Intergenic
939013312 2:136872708-136872730 GTTTTAGAAGAAAAGGAGATTGG + Intronic
939078147 2:137627367-137627389 AATTAAACAGGGGAGGAGATGGG + Intronic
939882822 2:147649657-147649679 ATTTGAGCAGTGAAGGTGTTGGG + Intergenic
941275236 2:163482814-163482836 TTTTAAGCAGAGCTGGAGATGGG - Intergenic
942802703 2:179893740-179893762 ATTTATGCAGAGAAAGAGAAAGG - Intergenic
943616224 2:190095710-190095732 ATTCAATCAGAGAAGAAGAGTGG + Intronic
943698416 2:190961962-190961984 ATGTAAGTAGAGAGAGAGATTGG + Intronic
944085160 2:195837363-195837385 ATGTAATCAGTGAAAGAGATAGG - Intronic
944903993 2:204244380-204244402 ATTTGAGGAGTGAAGGAGATCGG + Intergenic
945547245 2:211170521-211170543 ATTTAAACAGACTATGAGATTGG - Intergenic
945623979 2:212176985-212177007 ATTAAAGTAGAGAAAGAGAGAGG + Intronic
945831334 2:214789954-214789976 ATCTAAGTAGAGTTGGAGATTGG - Intronic
946647962 2:221859737-221859759 ATTTATTCAGAAAAGGAAATTGG + Intergenic
946678207 2:222185156-222185178 CTTTTAGCAAAGAAGAAGATAGG + Intergenic
946775244 2:223132003-223132025 ATTTTAGCAGAAGAGGAAATGGG - Intronic
946829642 2:223715047-223715069 ATTTAAGTAAAAAAAGAGATAGG + Intergenic
947768198 2:232650946-232650968 ATGTTGGCAGAGAAGGAGCTGGG + Intronic
1168952257 20:1810479-1810501 GTTAAAGCAGGGAAGGAGACGGG - Intergenic
1170339731 20:15310753-15310775 AGTCAAGCAGAGAAGGGGCTTGG + Intronic
1170656600 20:18292612-18292634 AATAAAGCAGGGAAGGAGAAAGG - Intronic
1170712309 20:18802661-18802683 TTTAAAGCAGGGAAGGTGATGGG - Intergenic
1171850205 20:30302493-30302515 ATTCATGCAGAGCAGGATATCGG + Intergenic
1172051039 20:32118385-32118407 TTTTAAGAAGTGAAGGAAATGGG - Intronic
1173034432 20:39395303-39395325 TTTTAAGCAGAGGAGTAGTTTGG + Intergenic
1173308775 20:41877120-41877142 ATTTGAGGAGTGAAGGAGCTGGG - Intergenic
1173338948 20:42136923-42136945 ACCTAAGCAGAGAGGGAGCTGGG + Intronic
1173474691 20:43350686-43350708 TTTTTAGTAGAGATGGAGATGGG - Intergenic
1173801777 20:45898671-45898693 CTTTAAGCAGAGAAGGGGCCAGG - Exonic
1174087966 20:48023127-48023149 ATTTAGACAAAGCAGGAGATAGG + Intergenic
1174199657 20:48798409-48798431 CTTTAAGCAGAGCAGAAGAGTGG - Intronic
1175354609 20:58354520-58354542 ATTTAAATAGAGAAAGAAATGGG - Intronic
1175451747 20:59075369-59075391 ATTTAAGCAAGGAAGGTGAGTGG + Intergenic
1175545754 20:59776659-59776681 ATTTAAACACAGAAGAGGATGGG + Intronic
1175633458 20:60560970-60560992 ATTTCAAGAGAGGAGGAGATAGG + Intergenic
1175650325 20:60716010-60716032 ACTTAAGCGGGGAAGGAGACGGG + Intergenic
1177244493 21:18504963-18504985 AGTGAAGCAGAGAAGCAGCTTGG + Intergenic
1177675744 21:24296096-24296118 ATGGAAACAGAGCAGGAGATTGG - Intergenic
1177725458 21:24961061-24961083 ATACAAGCAGAGAGGGAGCTAGG - Intergenic
1178109886 21:29359555-29359577 TTTTAAGCAAAGAAAGAAATGGG + Intronic
1179126461 21:38595385-38595407 AATTAAGCAGAGAAGGTGCAGGG + Intronic
1179318881 21:40270952-40270974 TTTTCAACAGAAAAGGAGATGGG + Intronic
1179433041 21:41338151-41338173 AAATAAGCAAAGAAGGAGAGGGG - Intronic
1180696657 22:17755429-17755451 AATTAATCAGAAAAGGAGAGGGG + Intronic
1185161896 22:49235017-49235039 ATTTAATCAGAGAAGCATACAGG - Intergenic
1185165011 22:49256000-49256022 CTTTAATCAGAAAAGAAGATGGG + Intergenic
949092754 3:48995-49017 ATTGAAGAAGAGGAAGAGATGGG - Intergenic
949568009 3:5263144-5263166 ATTTCAGCAGGGAAGGAAAATGG + Intergenic
950341897 3:12254376-12254398 ATTTTAGCAGAGAATAAGAAAGG - Intergenic
950494680 3:13326658-13326680 ACTTAAGCAAAGAAGGACACTGG - Intronic
950659814 3:14460349-14460371 AGTCAAGCAGAGAAGGAGAATGG + Intronic
951017865 3:17749089-17749111 ATTTCAGAAGAGAAGCTGATTGG - Intronic
952202123 3:31141411-31141433 ATTTTAACAGAGAAGGAGGCAGG - Intergenic
952656280 3:35789769-35789791 ATTTAAGAAGAGAAAAAGAGTGG - Intronic
953422612 3:42766098-42766120 AACTATGCAGAGAAGGAGAGGGG + Intronic
953641183 3:44709816-44709838 ATGTTAGCAGACAAGGAGCTTGG - Intergenic
954091483 3:48287804-48287826 ACATAAGCACAGATGGAGATAGG + Intronic
954291291 3:49651387-49651409 ATTCAAGGCCAGAAGGAGATAGG + Intronic
954594787 3:51815154-51815176 TTTTGTGCACAGAAGGAGATGGG + Intergenic
956580256 3:70803842-70803864 ATTTAATTATAGAGGGAGATGGG - Intergenic
956685640 3:71825002-71825024 AGTCAAGCTGGGAAGGAGATAGG + Intergenic
956709040 3:72024105-72024127 ATAAAAGCAGAGAAGGGGTTGGG - Intergenic
956872960 3:73436061-73436083 ATTTGAGCGGAGATGGGGATGGG - Intronic
958033705 3:88146757-88146779 ATTAAATCAAAGAATGAGATGGG - Intronic
958549240 3:95593254-95593276 TTTAAATCAGAGAAGGAGAAGGG + Intergenic
959490618 3:106984492-106984514 ATGAAAGCAGAGTAGGAGGTTGG - Intergenic
959554847 3:107704957-107704979 TTTTAAGGTGAGAAGGAGAAAGG + Intronic
960023012 3:112976641-112976663 TTTTAAGTAGAGATGGAGTTTGG - Intergenic
960270116 3:115664553-115664575 ATTTAAGCAGTGAATGAGCCAGG + Intronic
960545390 3:118908354-118908376 ATATAATCAGGGAAGGAGACAGG + Intronic
960645214 3:119872936-119872958 AATTAAGCAGAGACAGAGATTGG - Intronic
960788818 3:121403711-121403733 ATTAGAGCAGAAAAGGAGATAGG + Intronic
961261632 3:125606592-125606614 TTTAAAGCAGAGAGGGAGAAAGG - Intergenic
963119671 3:141765395-141765417 AATCAAGCAGGGAAGGAGAAGGG - Intergenic
963301484 3:143602031-143602053 ATTTAAACAAAAAAGGACATGGG - Intronic
963353926 3:144186466-144186488 ATTTAACCTGAGAAGAAGGTGGG - Intergenic
963409248 3:144907627-144907649 TTTAAATCAGAGAAGGAGAAAGG + Intergenic
963431003 3:145202695-145202717 TTTTAAGCGGACAAGCAGATGGG - Intergenic
963432935 3:145232517-145232539 TTTTAAGTAGAGATGGAGATGGG - Intergenic
963518826 3:146339543-146339565 ACTTAAGCAGGGAAGGGGACTGG + Intergenic
964630048 3:158800793-158800815 ATTTAGAGAGAGAAGGAGGTAGG - Intronic
964829467 3:160867544-160867566 ATTTAAGCATATAAGGAAAAAGG - Intronic
965013707 3:163129353-163129375 ATTTATGGAGTAAAGGAGATAGG + Intergenic
965313315 3:167159039-167159061 ATGTATGCAGATATGGAGATGGG - Intergenic
965356768 3:167684821-167684843 TTTTAAGGAGATAAAGAGATTGG - Intronic
965550607 3:169961351-169961373 ATTAAAGCATATAAAGAGATAGG + Intergenic
965810352 3:172585372-172585394 ATGTTAGCAAAGAAGGAGAAAGG - Intergenic
965969153 3:174532413-174532435 ATTTGAGTAGAGAAGGAAAGGGG + Intronic
966373871 3:179275812-179275834 CTTTTAGTAGAGAAGGAGATTGG - Intergenic
966974108 3:185070018-185070040 TTTTAAACAGAGTAGGAGACAGG - Intergenic
968341737 3:197961025-197961047 ATTTAAGCAGAGAGAAAAATGGG - Intronic
969663618 4:8544641-8544663 ATTTAAGAATAGAAGGAGTGAGG + Intergenic
972800489 4:42470356-42470378 ATTTAAGCTAAGAAGTATATAGG + Intronic
973187298 4:47345315-47345337 TTTCAAGCAGTAAAGGAGATAGG + Intronic
973191337 4:47389242-47389264 TCTTAAGCAGGGAAGGGGATGGG - Intronic
973941016 4:55910555-55910577 AATTAACCAGGGAAGGAGAGAGG - Intergenic
974436389 4:61862456-61862478 AGTTCAGGAGAGAAGGAGATGGG + Intronic
974832698 4:67209284-67209306 AGTGAAGCTGAGAAGGATATAGG - Intergenic
975063594 4:70035924-70035946 ATTTAATCAGGGGAGGATATAGG + Intronic
975095382 4:70450843-70450865 ATTTAAGGAGAGAAAGGGAAGGG - Intronic
976557936 4:86470534-86470556 AATTAAGAAGATAAGGAAATAGG - Intronic
977136291 4:93309015-93309037 AATAAAGCAGAGAAGGGGAGAGG - Intronic
977154043 4:93551254-93551276 AATAAAGCATAGAAGGAGACAGG + Intronic
977345149 4:95808217-95808239 ATTTAAGTAGAAAAAGTGATAGG + Intergenic
978703688 4:111679384-111679406 ATCTAAACAGAGAATGAGAGAGG - Intergenic
979345406 4:119580766-119580788 ACTTAAGCAGAGAGGCAGAGTGG - Intronic
979663698 4:123287778-123287800 AATAAAGCAGGGAAGGAGAATGG + Intronic
979770577 4:124520351-124520373 ACTAAAGCAGAAAAGGAGAAGGG - Intergenic
979827734 4:125260020-125260042 CTTTAAGAAAAGAAGGAGAATGG - Intergenic
980535407 4:134114431-134114453 ACTTAAGTGGGGAAGGAGATGGG + Intergenic
981233573 4:142388341-142388363 ATCTAAGAAGAGAAGAACATAGG - Intronic
981908778 4:149954040-149954062 ATTCCAGCTGAGAAGGACATGGG + Intergenic
982317605 4:154047354-154047376 ATCTAGTGAGAGAAGGAGATGGG + Intergenic
982465161 4:155721477-155721499 ATTTAAGCAGAAAATGACAGAGG - Intronic
982590201 4:157299301-157299323 AGTTTAGGAGAGAAGGAGAGAGG + Intronic
982877260 4:160664587-160664609 TTTAAATCAGAGAAGGAGAAGGG - Intergenic
984399933 4:179249650-179249672 AATAAAGCAGAGAAGGGGATGGG + Intergenic
984658204 4:182342964-182342986 CTTTAATAAAAGAAGGAGATTGG - Intronic
985216891 4:187663109-187663131 ATTGAAGGACAGTAGGAGATTGG - Intergenic
985669354 5:1199170-1199192 ATAGAGGCAGAGAAGGAGAGAGG - Intergenic
986085412 5:4440073-4440095 ATTGAAAGAGAGAAGAAGATGGG + Intergenic
986936679 5:12896861-12896883 TTATAAGCAGAAAAGGAGATTGG + Intergenic
987082231 5:14436080-14436102 ATACAAGAAGAGACGGAGATGGG - Intronic
987362036 5:17116189-17116211 ATTGCAGCAAAGAAGGAGATGGG + Intronic
987742100 5:21922980-21923002 ATATATGGAGAGAAGGAGAGAGG + Intronic
987886131 5:23815443-23815465 ATTTAAACAGTCAAGGAAATTGG + Intergenic
989131652 5:38112971-38112993 ATTTAAGCAATGAAGTAGAAAGG - Intergenic
989257865 5:39385188-39385210 ATTTAATCAGAGAAATGGATTGG + Intronic
989620255 5:43377098-43377120 AATTAATCAGAGAAGAAGAGAGG - Intronic
989800905 5:45537742-45537764 AAGTAAGAAGAGAAGAAGATAGG - Intronic
989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG + Intronic
990085313 5:51969268-51969290 AATTAATCAGAGAAGAAGACGGG - Intergenic
990566661 5:57036564-57036586 AGAGAAGCAGAGAAGGAGAAAGG + Intergenic
990597853 5:57329362-57329384 TTATAAGAAGAGAAAGAGATGGG - Intergenic
990628697 5:57642850-57642872 ATTTAAAAAGAGAAAGAGAAAGG + Intergenic
990676817 5:58195902-58195924 ATTTAAGGTGAGGAGGAGAAAGG - Intergenic
990992359 5:61698533-61698555 ATTTGAGCAGAGAATGTGCTAGG - Intronic
991086487 5:62652627-62652649 ATTTAAGCATTAAAGGACATGGG - Intergenic
991512644 5:67396979-67397001 ACTTCAGCAGAGAAGGGGACGGG + Intergenic
992325682 5:75657072-75657094 ATTTAATAACAAAAGGAGATTGG - Intronic
992714044 5:79491629-79491651 AGTTAAGAAGAAAATGAGATCGG - Intronic
993062029 5:83050122-83050144 TTTTAAGCATAGAAGGAAAGTGG + Intergenic
993260232 5:85647956-85647978 ACTTAAGCGGGGAAGGCGATGGG - Intergenic
993510066 5:88759774-88759796 ATTTAACAAAAGAAGCAGATAGG + Intronic
993619941 5:90156315-90156337 ATTTGAGCTGAGAAGAAGAGTGG - Intergenic
995176262 5:109181357-109181379 TCTTGAGCAAAGAAGGAGATGGG + Intronic
995449772 5:112287767-112287789 ATTAAAGCAGAGAAAGCTATTGG + Intronic
995706398 5:114992623-114992645 ATTAAATCAGAGAGGGAGAAGGG - Intergenic
995930374 5:117434809-117434831 ACTTGAGCAGAAAAGCAGATAGG + Intergenic
996593436 5:125174729-125174751 ATGTAAGCAGTGAGGGACATAGG - Intergenic
996622101 5:125518682-125518704 ATTTATGTAGAGTATGAGATAGG + Intergenic
996653782 5:125914737-125914759 ACTTAAGCAGGGAAGGGGATGGG + Intergenic
997009204 5:129857134-129857156 ATCTAAGGGGAGAAGGAGCTGGG - Intergenic
997033594 5:130160451-130160473 ATTTAAAAAGGGAAGGAGATAGG - Intronic
997884732 5:137620025-137620047 ATTTCCTCAGAGAAGGAGAAAGG + Exonic
998522948 5:142817191-142817213 ACTCAGGCAGAGAAGCAGATGGG + Intronic
999818870 5:155204319-155204341 ACTTAAGCAGGGAAGGGGATGGG - Intergenic
1000156713 5:158559395-158559417 ATCACAGCAGAGAAAGAGATGGG - Intergenic
1000198657 5:158986134-158986156 AATTAAGCTGGGAAGGAGACAGG - Intronic
1000207273 5:159074398-159074420 ATAAAAGCAGTGAAGTAGATGGG + Intronic
1000778037 5:165443390-165443412 ATTTTAGCAAAGAAAGAGACTGG - Intergenic
1001899294 5:175411051-175411073 ATTAAAAGAGAGAAGGAGAATGG + Intergenic
1001901172 5:175431096-175431118 AATTCAACAGAGAAGGAGGTGGG - Intergenic
1001919017 5:175586107-175586129 TTTTAAGCAGAGGAGTATATAGG + Intergenic
1003602894 6:7534274-7534296 ATTTAAATAGAGCAGGAGCTGGG - Intergenic
1003828531 6:9978695-9978717 GTTTCAGCAGAGAATGAGACAGG - Intronic
1005169881 6:22971113-22971135 ATTAAAGAAAAGAAGGAGGTTGG + Intergenic
1005349382 6:24919143-24919165 ATGTGAGCAGAGAAGGAAAGAGG - Intronic
1005401771 6:25441527-25441549 ATTTTAGAAGGGAAGGAGAGAGG - Intronic
1005788110 6:29267874-29267896 ATCTAAGCAGAGAAAGATAGGGG + Intergenic
1005962142 6:30701891-30701913 ATTTCAGCAAAGAAAGAGAAAGG + Intronic
1006082647 6:31576327-31576349 AGATAAGGAGAGAAGAAGATAGG + Intronic
1006094766 6:31649043-31649065 CTTTAAGGAGAAAAGGAGGTAGG - Intronic
1006825838 6:36935314-36935336 ATTTAAAAAGAGAAAGAGAAAGG - Intergenic
1007040639 6:38718912-38718934 ATTTAAACAGAGAAGTAAAGAGG - Intronic
1008051957 6:46909332-46909354 ATTTAAAAAGAGAAGGAGATCGG - Intronic
1009788379 6:68367413-68367435 ATTTATGTGGAGAAGGAGACGGG - Intergenic
1010435166 6:75821055-75821077 TTTTAAGGAGAGAGGAAGATGGG + Intronic
1010743022 6:79529503-79529525 ATTTAAGAGAGGAAGGAGATGGG + Intronic
1010756443 6:79671054-79671076 ATTTAGAAAGAGAGGGAGATTGG + Intronic
1010906369 6:81495307-81495329 TTTTAAGAAAAGAAGGAGATTGG + Intronic
1011057246 6:83218445-83218467 ACTTAAGCAGAGAAGAGAATGGG + Intronic
1011411058 6:87066887-87066909 ACTTAAGCTGAGAGTGAGATTGG + Intergenic
1011454144 6:87528691-87528713 ATAGAAGCAGAGAAGTAGAATGG + Intronic
1013402497 6:109812499-109812521 ATGTAAGCAAAGAGGGAAATAGG + Intronic
1013573239 6:111451322-111451344 ATTTAAGCCCAGAAGAAGTTGGG - Intronic
1013721467 6:113034516-113034538 ATTCACGTGGAGAAGGAGATAGG - Intergenic
1013834937 6:114323523-114323545 ATTTAAAAAGAGGAAGAGATAGG - Intronic
1014093013 6:117426749-117426771 ATTTAAGAAAACAAGGAGGTTGG - Intronic
1015408210 6:132861463-132861485 ATTACAACAGAGAAGTAGATGGG + Intergenic
1015884516 6:137903065-137903087 TTTTAAGCAGACTAGGAGCTAGG - Intergenic
1016521075 6:144947546-144947568 AATAAAGCAGAGAAGGAAACAGG - Intergenic
1016786578 6:148017094-148017116 CATTAAGCAGCCAAGGAGATTGG - Intergenic
1017181583 6:151557919-151557941 TTTTCAGCAGAGATGGAGTTTGG - Intronic
1019425105 7:971379-971401 ATTTTAGCACAGAAGGAAAAAGG + Intronic
1020653254 7:10900385-10900407 AATTAAGTGGAGAAGGGGATAGG - Intergenic
1020879948 7:13748921-13748943 GTTTAAGCAGTGAAGTACATGGG + Intergenic
1021592623 7:22280333-22280355 AGTGAAGCAGAGGAGGAGGTAGG + Intronic
1021658500 7:22895282-22895304 AGTTAACTAGAGAAGCAGATGGG - Intergenic
1021974062 7:25994836-25994858 ATTTAACAAGAGAAGAAGAAAGG + Intergenic
1023159599 7:37284371-37284393 GTTGAAGCAGTGAATGAGATGGG + Intronic
1023238386 7:38115184-38115206 ATGTAAACAGTGAAGGAGAAGGG - Intergenic
1023658241 7:42447831-42447853 ATCGAAGCAGAGAAAGAGATTGG + Intergenic
1024615055 7:51105005-51105027 ACTTAAGCAGGGAAGGGGACGGG + Intronic
1026544411 7:71309334-71309356 AATTTAGCAGGGAATGAGATGGG - Intronic
1026937063 7:74263602-74263624 ATTCAGGCAGAGATGGAGACAGG - Intergenic
1026965104 7:74434528-74434550 GTTTGGGCAGAGAAGGTGATAGG + Intergenic
1028114321 7:86980734-86980756 GTTTAAGGAGAGGAGGAGATTGG - Intronic
1028163412 7:87510944-87510966 ATTTAAGGAAAGGAGGAGTTTGG + Intronic
1030420464 7:109301440-109301462 TTTAAATCAGAGAAGGAGAAGGG - Intergenic
1031212267 7:118845842-118845864 ATTTAAGGAGAGTAGGAAATGGG - Intergenic
1031849406 7:126845892-126845914 AGTGATGTAGAGAAGGAGATGGG + Intronic
1032059517 7:128712852-128712874 CTTTAAGCAGTGAAGAAAATAGG - Intronic
1032773442 7:135084496-135084518 ATAGAAGCAGAGAAGGATAGAGG - Intronic
1033881321 7:145887279-145887301 AGTGCAGCAGAGAAGGAGAGAGG - Intergenic
1034067995 7:148155189-148155211 ATTTAGGAAGAGACAGAGATGGG + Intronic
1036120581 8:6013108-6013130 TTCTAAGCAGAGAACGAGAATGG - Intergenic
1036631583 8:10519543-10519565 AATGAAGCAGAGAAGGGCATGGG - Intergenic
1037564967 8:20110300-20110322 ATTTACTCAGACAAGGAAATAGG + Intergenic
1038158080 8:25009668-25009690 CTGTGAGCAGAGAGGGAGATGGG - Intergenic
1038202125 8:25422692-25422714 ATTTAAGCAAAGTTGGAGACTGG - Intronic
1039156321 8:34562551-34562573 ATTTAAGAAAACAAGAAGATGGG - Intergenic
1039574863 8:38614969-38614991 AATAAAGCTGAGAAGGAGACAGG + Intergenic
1039999732 8:42565914-42565936 TTTAAATCAGAGAAGGAGAAGGG + Intergenic
1041603960 8:59758141-59758163 ATTCAGGCAGAGATTGAGATTGG - Intergenic
1042386330 8:68179396-68179418 CTTTAAACAGGGAAGGAAATTGG + Intronic
1042655976 8:71097015-71097037 ATATGAGGAGAGATGGAGATTGG - Intergenic
1043248853 8:78043173-78043195 TTTTAATCAGAGAAGGATAAAGG - Intergenic
1043692165 8:83168367-83168389 AGTTATGCAGGTAAGGAGATGGG - Intergenic
1043853907 8:85243873-85243895 ATTGAAACAGTGAAAGAGATTGG + Intronic
1044767880 8:95596665-95596687 CTTTAATCAGAGGAGGTGATTGG - Intergenic
1045325839 8:101117095-101117117 ATGGAAGCTGAGAAGGAGGTCGG - Intergenic
1046753932 8:117954261-117954283 ATTTAAACAGAGAAGCAGAGAGG + Intronic
1046808248 8:118504045-118504067 ATTTAAACAAAGCAGGAAATAGG - Intronic
1046924205 8:119768753-119768775 ATTGAAGCAGAGAGGGAGAGGGG - Intronic
1047037875 8:120959666-120959688 ACTTATGCAGAGAGGGAGTTTGG + Intergenic
1048169256 8:132089841-132089863 ATGTTAGCAGAGAAGGGGTTGGG - Intronic
1048376549 8:133827591-133827613 CTTAAAGCAGAGAAAGAGCTAGG + Intergenic
1050286124 9:4104228-4104250 ATTTAGGGAGGGAAGCAGATCGG - Intronic
1051999839 9:23265434-23265456 AATTAAGTAGAGAAAGAAATAGG + Intergenic
1052126932 9:24788427-24788449 ATTTAAGCAGGGATGGATATGGG - Intergenic
1052312340 9:27081034-27081056 ACTTAAGCTGGGAAGGCGATGGG + Intergenic
1053025994 9:34728816-34728838 AAATAAGCAGAGAAGGAAAATGG - Intronic
1053037500 9:34837856-34837878 AAATAAGCAGAGAAGGAAAATGG - Intergenic
1053325318 9:37140866-37140888 ATTTAAACATAGAAGGAGATAGG + Intronic
1054725523 9:68646327-68646349 ATTTAAGAAATGAAAGAGATAGG - Intergenic
1055036582 9:71824512-71824534 GTTGAAGCAGAGGAAGAGATTGG + Intergenic
1055837028 9:80455739-80455761 ACATAAGCAGAGATGGGGATAGG + Intergenic
1056745368 9:89296725-89296747 AGTTAAGCTGAGAAGGAACTGGG - Intergenic
1059573172 9:115462372-115462394 AATAAAGCAGAGAAGAAGAAAGG + Intergenic
1059713852 9:116894807-116894829 ATTTAATCAGGGGAGGAGATGGG + Intronic
1059885332 9:118739146-118739168 ATTTAAGAAAAGAAAGAAATAGG - Intergenic
1060008620 9:120023458-120023480 AGTTGAGCTGAGAAGGATATTGG - Intergenic
1060027495 9:120185376-120185398 ATTGAAGCAGAGAAGCAGAGGGG + Intergenic
1060777112 9:126382990-126383012 TTTGAAGCAGAGTAGGAGATAGG + Intronic
1060945985 9:127569405-127569427 ACCTAAGCAGAGAAAGAGACGGG + Intronic
1186341358 X:8649504-8649526 AATAAAGCAGAGGAGGAGATGGG - Intronic
1186759065 X:12703964-12703986 ATATGAGCAGACAGGGAGATTGG + Intronic
1186813571 X:13213681-13213703 GTTTGAGCAAAGAAGGAGAAGGG + Intergenic
1186960073 X:14727002-14727024 ATTTGAGCAGATAAGGAGAAAGG + Intronic
1187096309 X:16152161-16152183 ATTCAGGCAGAGAAAGAGAAAGG - Intronic
1187543368 X:20221995-20222017 ATTTAAACAGAGATGGACATGGG - Intronic
1187621057 X:21055355-21055377 ATTGCAGCAGAGGAGGGGATAGG - Intergenic
1187826936 X:23340928-23340950 AATTAAGGAGAGACTGAGATCGG + Intronic
1187998722 X:24957777-24957799 TTTTAAGCAGAGAAGGGGCATGG + Intronic
1189660726 X:43295382-43295404 ATAGAAGCACAGAAGGAGAATGG + Intergenic
1191636448 X:63382734-63382756 ATTTTAGTAGAGAAGATGATGGG + Intergenic
1192475609 X:71439203-71439225 ATTCAAGTAAAGAAGGAGAGAGG - Intronic
1192477375 X:71454584-71454606 AATTAAGCAGGGAAGGAAACAGG - Intronic
1192818219 X:74616081-74616103 AAGTAAGCAGGTAAGGAGATGGG - Intergenic
1194172490 X:90604449-90604471 ATTTAAGGAGCCTAGGAGATTGG - Intergenic
1194351123 X:92825663-92825685 AGAAAAGCAGAGAAGGAGTTGGG - Intergenic
1194574738 X:95597830-95597852 ATTTAGGAACAGAAAGAGATGGG + Intergenic
1194994503 X:100577043-100577065 ACTTAAGCAGGGAAGGGGACCGG - Intergenic
1196208552 X:112968746-112968768 ATTTAAGGGGAGAACAAGATGGG - Intergenic
1196724551 X:118884724-118884746 ACTTAAGCAGGGAAGGGGACTGG + Intergenic
1197222123 X:123924358-123924380 ATTTAAGTCGGGAAGGAGAAGGG + Intergenic
1198167713 X:134073591-134073613 AAATAAGCAAGGAAGGAGATGGG + Intergenic
1199018191 X:142844998-142845020 ATCAGAGCAGAGTAGGAGATGGG + Intergenic
1199730333 X:150625880-150625902 ATTTCAGGAGAGAAGCAGCTGGG + Intronic
1200518717 Y:4182188-4182210 ATTTAAGGAGCCTAGGAGATTGG - Intergenic
1200659449 Y:5942343-5942365 AGAAAAGCAGAGAAGGAGTTGGG - Intergenic
1200850564 Y:7878980-7879002 ATATAAGGAGAGAAGGACTTAGG - Intergenic