ID: 1096173055

View in Genome Browser
Species Human (GRCh38)
Location 12:49489448-49489470
Sequence ATTTATCTGGAAAAGATGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 643
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 579}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096173055_1096173059 26 Left 1096173055 12:49489448-49489470 CCTGTCATCTTTTCCAGATAAAT 0: 1
1: 0
2: 3
3: 60
4: 579
Right 1096173059 12:49489497-49489519 GAGCAACAATGAAATTATCCTGG 0: 1
1: 0
2: 2
3: 5
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096173055 Original CRISPR ATTTATCTGGAAAAGATGAC AGG (reversed) Exonic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902460122 1:16568521-16568543 ATTTATCTAGAAAACATACCAGG + Intronic
903379805 1:22888774-22888796 ATTTATTTGGAATAGAAAACAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904746329 1:32713435-32713457 GTTTTTCTGGAGAAGATGGCTGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905736135 1:40327532-40327554 ATTTCTCTGGAATAAATGCCTGG + Intergenic
906461515 1:46038047-46038069 TTGTATTTTGAAAAGATGACTGG + Intergenic
906563937 1:46783270-46783292 ATTTATCTGAAAAAGAGTTCAGG - Intronic
907179305 1:52555126-52555148 ATGAATCTGGAAAAGAAAACTGG + Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907702832 1:56806039-56806061 ATGAGTCTGGAAAAGATGAGAGG - Intronic
908389713 1:63673515-63673537 AATTATCTGGACATGATGGCGGG - Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
909918818 1:81354925-81354947 ATATGTCTGGAAAAGATGAAGGG - Intronic
910176747 1:84439016-84439038 ATTTTTCTGGAAAGTAGGACTGG + Intergenic
910317600 1:85904696-85904718 ATATAGCTGAAAAAGATAACAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910598332 1:89004369-89004391 ATTTATCTGAAAAAGAATTCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910659155 1:89652249-89652271 ATCTATGTGGGAAAGATGAAAGG + Intronic
910669008 1:89754250-89754272 ATTAGCCTGGAAAAGAGGACAGG - Intronic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911167388 1:94736021-94736043 ATTTCTCTGGAAAAGCTAAGAGG + Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911865595 1:103017507-103017529 AAATATCTGGAAAATATGACTGG + Intronic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912127963 1:106563881-106563903 ATATTTCTGGAATATATGACTGG + Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912913195 1:113784127-113784149 ATTTAACTTGAAAAGATTAAAGG + Intronic
913605291 1:120460060-120460082 ATTTATCTAGAAAACATACCAGG - Intergenic
913642160 1:120822797-120822819 ATTTATCTAGAAAACATACCAGG - Intronic
913972938 1:143429870-143429892 ATTTATCTGAAAAAGAATTCAGG - Intergenic
914067322 1:144255477-144255499 ATTTATCTGAAAAAGAATTCAGG - Intergenic
914111831 1:144710877-144710899 ATTTATCTGAAAAAGAATTCAGG + Intergenic
914189266 1:145394426-145394448 ATTTATCTAGAAAACATACCAGG + Intronic
914211120 1:145580138-145580160 ATTTATCTAGAAAACATACCAGG + Intergenic
914276318 1:146127567-146127589 ATTTATCTAGAAAACATACCAGG + Intronic
914366499 1:146983621-146983643 ATTTATCTAGAAAACATACCAGG - Intronic
914485946 1:148109826-148109848 ATTTATCTAGAAAACATACCAGG + Intronic
914537362 1:148578522-148578544 ATTTATCTAGAAAACATACCAGG + Intronic
914586280 1:149064974-149064996 ATTTATCTAGAAAACATACCAGG + Intronic
914628563 1:149486823-149486845 ATTTATCTAGAAAACATACCAGG - Intergenic
914903755 1:151727558-151727580 ATTTCTCTGGAAAACATTAAGGG - Exonic
914927280 1:151899097-151899119 ATTTATCTGAAAAAGAATTCAGG + Intronic
915428901 1:155850353-155850375 TTTTATCTGGAAATGTAGACAGG - Intronic
916907096 1:169297727-169297749 ATTTGTCTTTAAAAGATCACTGG + Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917234028 1:172871282-172871304 ATTTATATTGAAAAGATCAGAGG + Intergenic
917710874 1:177682860-177682882 ATTGCTCTGGAAAAGAAGATTGG - Intergenic
918106194 1:181417256-181417278 TTTTATCTGGAAAATATGTTTGG - Intronic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919164821 1:193878989-193879011 AAGTATCAGGAAAAGATGATTGG - Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919702084 1:200641278-200641300 GTTTTACTGGAAAATATGACAGG + Intronic
922673270 1:227531675-227531697 ATTTATCTGAAAAAGAATTCAGG - Intergenic
922697343 1:227737349-227737371 ATTTCTCTGGGAGAGATGAGCGG - Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
924429984 1:243988547-243988569 AATTATCTGGATAAAATGATAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1062804837 10:410481-410503 ATTTTCCTGGAAAAGATCACTGG + Intronic
1063017272 10:2091234-2091256 AATTATCTGGGAACGATGGCGGG + Intergenic
1063478236 10:6347404-6347426 TTTTATCTGAGAGAGATGACAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065306419 10:24373378-24373400 AGGTATCTGGAAAAGACGTCTGG - Intronic
1065519727 10:26559981-26560003 ATTTATGTGGCAAAAATTACTGG - Intronic
1066255187 10:33671768-33671790 ATATATATGGGAAAGATGACTGG + Intergenic
1066314636 10:34232286-34232308 ATCTATTTGGTAAAGATGACTGG + Intronic
1066747203 10:38612432-38612454 ATTTATCTGAAAAAGAATTCAGG + Intergenic
1066957621 10:42188051-42188073 AGTTAACTGGAGAAGATGACCGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068615583 10:59111710-59111732 ATTTCTCTGGGATAGATAACAGG + Intergenic
1068689119 10:59897993-59898015 ATTGATCTGGAACAGATGCATGG + Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069206935 10:65701345-65701367 ATTTATCTTGAAACCATGAATGG - Intergenic
1069516888 10:69084902-69084924 AATTATCTGGACATGATGGCGGG - Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069995333 10:72338467-72338489 TTTTATCTGGGAAAGCTGGCAGG - Intronic
1070757196 10:79000756-79000778 ATGTATCTAGAAAACAAGACTGG - Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072490676 10:95903226-95903248 CTTTATGGGGAAAAGTTGACAGG + Intronic
1072978393 10:100079004-100079026 ATTGAGGAGGAAAAGATGACGGG - Intronic
1073621970 10:105059284-105059306 ATGTATTTTGAAAAGATGCCTGG - Intronic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1074576400 10:114673784-114673806 AATTATTTGGACACGATGACGGG + Intronic
1075038570 10:119089450-119089472 ATTAACATGGGAAAGATGACAGG - Intergenic
1075408805 10:122212281-122212303 CTTTGTCTACAAAAGATGACTGG - Intronic
1075541463 10:123317785-123317807 GTTCATCTGGAGCAGATGACAGG - Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077203344 11:1325627-1325649 AGATAGCTGGAAAAGATGACTGG + Intergenic
1078163028 11:8858311-8858333 ATTTATTTGGGAAAGCAGACAGG + Intronic
1079278101 11:19060524-19060546 ATTCATTAGGAAAAGAAGACAGG - Intronic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081092782 11:38893756-38893778 GTTTATCAGGAGAAGGTGACTGG + Intergenic
1081109456 11:39116721-39116743 ATATATTTGTAAAAGATGACTGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081886515 11:46502028-46502050 AATTATCTGGAAAATAAGAGAGG + Intronic
1082271255 11:50171335-50171357 CTTCATCTGGAAAGGAAGACAGG + Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082734071 11:56837279-56837301 AAATATCTGGAAAAAATGATTGG + Intergenic
1083029194 11:59576439-59576461 ATTGATTTGGAAAAAATGATTGG + Exonic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1084487728 11:69460466-69460488 ATTTATCTTGAAGAGATGTGTGG + Intergenic
1085649781 11:78257240-78257262 GAGTTTCTGGAAAAGATGACTGG + Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1086492182 11:87366546-87366568 ATTCATCTGGAAGGGATCACAGG + Intergenic
1086521054 11:87668116-87668138 ATTTATCTTGAAAACATAAATGG - Intergenic
1087288099 11:96288391-96288413 AATTAGCTGGACATGATGACAGG + Intronic
1088034796 11:105298413-105298435 ATCTCTCTGCAGAAGATGACAGG + Intergenic
1088064298 11:105697058-105697080 ATATATCAGGAAAAGTTGGCTGG - Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091081309 11:132671257-132671279 ACTATTCTGGAAAAGATGATTGG - Intronic
1091897334 12:4116101-4116123 ATTTATCTCTATAAGATGCCAGG - Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092280551 12:7094961-7094983 ATTTATCTCTAAAAAATGGCAGG - Exonic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093048926 12:14484995-14485017 AGTTACCTGCAAAAGATGGCAGG + Intronic
1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093720678 12:22438103-22438125 ATTTATCTTGAAAAGAATTCAGG + Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095112018 12:38306134-38306156 ATATATTTAGAACAGATGACTGG + Intergenic
1095599347 12:43997500-43997522 ATTTCTTTGCTAAAGATGACTGG + Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096173055 12:49489448-49489470 ATTTATCTGGAAAAGATGACAGG - Exonic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097814383 12:64056162-64056184 ATTTAGGAGGTAAAGATGACAGG - Intronic
1098687093 12:73435388-73435410 AGTTATTTTGAAAAGATGAGTGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099647552 12:85378738-85378760 AATTATATGGAAAAGCTGGCAGG + Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100203485 12:92324731-92324753 ATTTATCTGAAAAAGAATGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100832296 12:98527850-98527872 ATTCATATGGAAATGATTACTGG + Intronic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102290256 12:111693387-111693409 AATTATCTGGGCATGATGACAGG + Intronic
1102767296 12:115444626-115444648 ATTCATCTGGAAATGCTCACTGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103460974 12:121104975-121104997 ATTTCTCTGGAAGAGATCATGGG - Intergenic
1104332121 12:127856723-127856745 TTTTATCTGGAAACTCTGACAGG + Intergenic
1105268536 13:18847043-18847065 ATTTCTCTGCAAAAGAGGAATGG + Intergenic
1106305117 13:28502841-28502863 ATTTATTTGAAAATGATGGCTGG + Intergenic
1106590017 13:31090868-31090890 ATCTATATGGTAATGATGACTGG + Intergenic
1107122017 13:36806392-36806414 ATTTATCTTGAAAGGAAGAAGGG - Intergenic
1107675046 13:42786940-42786962 ATTTATCTGGAAACGACTTCTGG - Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108469669 13:50755674-50755696 ATTTACCTGGAAAAGAATTCAGG - Intronic
1108681128 13:52781351-52781373 AATTATCTGTAAAAGATGTGTGG + Intergenic
1108863696 13:54895688-54895710 ATTTTTAAAGAAAAGATGACAGG - Intergenic
1109367800 13:61379803-61379825 ATTTATCAGGAAAATATAATAGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112247859 13:97750636-97750658 AAGTCCCTGGAAAAGATGACGGG - Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1114030679 14:18577367-18577389 ATTTATCTGAAAAAGAATTCAGG - Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115104753 14:29746839-29746861 ATTGATTTGGAGAATATGACTGG + Intronic
1115928121 14:38460367-38460389 ATTTGCATGGAAAAGATCACTGG - Intergenic
1115997027 14:39204846-39204868 ATTTACCTGAAAAAGAATACAGG + Intergenic
1116084166 14:40214170-40214192 ATCTACCTTGAAAATATGACTGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116686435 14:48045059-48045081 ATTGATTTGGAAGAGAAGACAGG + Intergenic
1117001597 14:51376285-51376307 AGTTATCTGCAGAAGATCACAGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120250743 14:82059676-82059698 AATTATCTGCAAATGATGGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1121516473 14:94555691-94555713 ATTTATCTGAAAAAGAATTCAGG - Intergenic
1123453499 15:20391532-20391554 ATTTATCTGTAAATGATAAATGG - Intergenic
1124606321 15:31172525-31172547 TTTTATATGGAAAACATGCCTGG + Intergenic
1125286806 15:38102238-38102260 ATTTATCTGGAAAATCTGACTGG - Intergenic
1125732049 15:41898076-41898098 ATTCATCAAGAAAAGTTGACTGG - Exonic
1126636111 15:50781369-50781391 ATGTCTCTGGAGAAGATTACAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1130427856 15:83819543-83819565 AATTATCTGGAAAAAATACCTGG + Intronic
1131300578 15:91196345-91196367 AGTTACATGGAAAAGGTGACAGG + Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1134876008 16:17699343-17699365 ATTTATCTGGGACAAATGCCCGG + Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136735864 16:32467213-32467235 ATTTATCTGAAAAAGAATTCAGG - Intergenic
1138472328 16:57247640-57247662 ATTTATCTGGAAAATAAGAATGG - Intronic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139563193 16:67756768-67756790 ATTTGTTGGGAAGAGATGACTGG - Intronic
1139818397 16:69697067-69697089 AATTATCTGTAAAAAATGAAGGG + Exonic
1140493198 16:75358640-75358662 TTTTACCTGAAAAAAATGACTGG + Intronic
1140892486 16:79297087-79297109 TATTATCTGGAAAAGGTGACTGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1203017211 16_KI270728v1_random:362361-362383 ATTTATCTGAAAAAGAATTCAGG + Intergenic
1203035546 16_KI270728v1_random:635519-635541 ATTTATCTGAAAAAGAATTCAGG + Intergenic
1143710092 17:8728423-8728445 ATTTAACTGGTAAAGTTGCCAGG + Intergenic
1146236516 17:31170015-31170037 ATATATCTGAAAAAAATCACTGG + Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1148444831 17:47731182-47731204 ATTAATGTGGAAAAGAGGAGGGG + Intergenic
1148918571 17:51006757-51006779 AGTCATGTGGAAAAGCTGACTGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1152671403 17:81609629-81609651 TTTAATCTTGAAAAGATAACTGG - Intronic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155354575 18:24939957-24939979 ATTTATCTGGAAAAGAATGAGGG - Intergenic
1155798437 18:30070013-30070035 ATTTATGTGTAAAATAGGACAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156198268 18:34800885-34800907 ATTTATATGGAAAAGTTGCAGGG - Intronic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157534171 18:48446480-48446502 ATTAATTTGAAAAAGGTGACTGG - Intergenic
1158199316 18:54922528-54922550 AGTTACTAGGAAAAGATGACTGG + Intronic
1158253381 18:55516140-55516162 CTGTAGATGGAAAAGATGACTGG + Intronic
1158556425 18:58478476-58478498 GATTTTCTGAAAAAGATGACAGG + Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159727944 18:71986338-71986360 TTTTACCTGGAAAACAAGACTGG + Intergenic
1160039122 18:75329564-75329586 ATTTATCTGGAAAAAATGCCTGG - Intergenic
1160970082 19:1764083-1764105 ATGGATTTGAAAAAGATGACAGG - Intronic
1162928372 19:13942250-13942272 ATTCATCTAGAAGAGATCACTGG - Intronic
1165301087 19:34969674-34969696 TTTTATCTGGAAAAGAAAAGAGG + Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
1202676553 1_KI270711v1_random:12249-12271 ATTTATCTAGAAAATATACCAGG + Intergenic
925210433 2:2041078-2041100 ATTTTTCTGGATAAAATGTCAGG - Intronic
926481795 2:13407690-13407712 ATTTATCTGTAAATGATAAATGG + Intergenic
926541523 2:14185845-14185867 ATTTAGCTGCAAAAGAGGCCAGG - Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
929630745 2:43459255-43459277 ATTTATTTGGGAAAGAGGAGTGG - Intronic
930816558 2:55604533-55604555 ATATATCTGGAAAAGACTTCAGG + Intronic
930869203 2:56152914-56152936 ATTTATCTTGTAAATATCACTGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931047732 2:58375244-58375266 ATTTATCTAGAAGAGAAGAGGGG - Intergenic
932516942 2:72360783-72360805 ATTTATCAAGAAAATATGATGGG - Intronic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933347985 2:81114274-81114296 ATTTATCTGGAAAGCAGGAGTGG + Intergenic
934177634 2:89590826-89590848 ATTTATCTGAAAAAGAATTCAGG - Intergenic
934187031 2:89756324-89756346 ATTTATCTGAAAAAGAATTCAGG - Intergenic
934287933 2:91665127-91665149 ATTTATCTGAAAAAGAATTCAGG - Intergenic
934305739 2:91820565-91820587 AGTTAACTGGAGAAGATGACCGG - Intergenic
934309604 2:91851601-91851623 ATTTATCTGAAAAAGAATTCAGG + Intergenic
934327517 2:92032177-92032199 AGTTAACTGGAGAAGATGACCGG + Intergenic
934465906 2:94262756-94262778 AGTTAACTGGAGAAGATGACCGG + Intergenic
934497759 2:94824324-94824346 ATTTCTCTGCAAAAGAGGAATGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
936121637 2:109751214-109751236 ATTTATGTGAAACAAATGACTGG + Intergenic
936223060 2:110620260-110620282 ATTTATGTGAAACAAATGACTGG - Intergenic
936641221 2:114314661-114314683 AGTTATCTGGACAAGATGGGAGG - Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
938039262 2:128062332-128062354 ATTTTTCTGAGAAGGATGACTGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939557224 2:143690476-143690498 CTTTACCTGGAAATGATAACGGG + Intronic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940709280 2:157143309-157143331 ATTTACCTGGAAAAGAATTCAGG - Intergenic
940802326 2:158146116-158146138 ATTTATCTGAAAAAGAATTCAGG + Intergenic
940858459 2:158748489-158748511 ACATATGTGGAAAAGAGGACAGG + Intergenic
941330671 2:164174594-164174616 ACTTATCTGACAAAGATGGCAGG + Intergenic
941389321 2:164891714-164891736 ATTTTTATGGAAACGATGAAAGG + Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942254647 2:174084648-174084670 ATTTTTCTGCAAAAGGTAACTGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943278111 2:185894861-185894883 AATTATCTTGTAAAAATGACTGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943955230 2:194180401-194180423 TTTTATTTGGAAAAGAACACGGG - Intergenic
944330158 2:198456196-198456218 ATTTTTCTGTAAAAAATGATGGG + Intronic
944631469 2:201630275-201630297 ATTTCTTAGGAAAAGATGTCAGG + Intronic
945425119 2:209691563-209691585 AGTTATCTGGAAAAGATTTGGGG - Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945682762 2:212933993-212934015 ATTTTTCTGAAAAAAATGTCAGG + Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1168911359 20:1449808-1449830 ATTTTTGTGGAGAAGATGGCTGG - Intronic
1168987278 20:2060603-2060625 ATCTATATGGAAAAAATGAATGG + Intergenic
1169901298 20:10554830-10554852 ATGTATCTGGCAAAAAGGACTGG - Intronic
1170136456 20:13079732-13079754 ATTCACCTGGAAAAGATGGGAGG - Intronic
1171242246 20:23581339-23581361 ATTTATCTGAAAAAGAATTCTGG - Intergenic
1172591655 20:36122202-36122224 ACTTATCTGAGAAACATGACAGG - Intronic
1172967818 20:38851029-38851051 ATTAATCTGGAAAAGGTCTCCGG - Intronic
1173589750 20:44215424-44215446 ATTTATTTTAGAAAGATGACTGG + Intergenic
1174101369 20:48128625-48128647 AAGTATCTGGCAAAGGTGACTGG + Intergenic
1174428003 20:50447053-50447075 AGATATCTGGGAAAGCTGACTGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176853816 21:13946338-13946360 ATTTCTCTGCAAAAGAGGAATGG + Intergenic
1177813427 21:25949677-25949699 ATATATCTGGAAGAGTTCACAGG + Intronic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180279825 22:10683393-10683415 AGTTAACTGGAGAACATGACCGG + Intergenic
1180454793 22:15504423-15504445 ATTTATCTGAAAAAGAATTCAGG - Intergenic
1180514579 22:16129726-16129748 AATTATCTGGACATGATGGCAGG + Intergenic
1180536699 22:16398740-16398762 ATTTATCTGAAAAAGAATTCAGG + Intergenic
1180587041 22:16901929-16901951 AGTTAACTGGAGAAGATGACCGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1182004830 22:26951151-26951173 AATTATCTGGATAAGATGGTGGG + Intergenic
1183184576 22:36284749-36284771 ATGTAACTGGAAAAGAGGTCTGG + Intronic
1183892146 22:40938423-40938445 ATTTCTCTGGAATACATGCCAGG + Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1185353824 22:50353998-50354020 TTTTATTTAGAAAAGCTGACTGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949429358 3:3957555-3957577 ATTAATCTTGAAAGGATGAAAGG - Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
950759776 3:15211205-15211227 AATTATCAAGAAAAGATTACAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951380495 3:21978069-21978091 CTCTATCTGGAAGAGAAGACTGG - Intronic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951967231 3:28399938-28399960 ATTTACCTGAAAAAGAATACAGG + Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952478416 3:33734684-33734706 ATCTATCTGGGAAAGATCATCGG - Intergenic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
953295315 3:41709970-41709992 ATTTTTGTGGAAGAGATCACAGG + Intronic
953324093 3:41998094-41998116 ATTTATCTGGAAGTGATCCCAGG + Intergenic
953790478 3:45943560-45943582 CTTTATATTGAAAAGAAGACAGG + Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
955932178 3:64068084-64068106 TCATATCTGGAAAAGAAGACTGG + Intergenic
956237693 3:67092920-67092942 ATTTTTCTGGAAAAGACAAGAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957016287 3:75068791-75068813 ATTTACCTGGAAAAGAATTCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957436519 3:80184193-80184215 ATTTATTTGGAAAAGAACATAGG - Intergenic
957741092 3:84269733-84269755 CTTTATTTGGAACAGATGATGGG - Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957765446 3:84619220-84619242 ATTCATATAGAAAAGATAACTGG + Intergenic
958002399 3:87767061-87767083 CTTTATTTGGAAAAGAGTACGGG + Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
958621396 3:96567046-96567068 ATTACTATGGTAAAGATGACTGG - Intergenic
959122411 3:102248306-102248328 ATTTATATGAGACAGATGACAGG - Intronic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960870543 3:122245270-122245292 AAATATTTGGAAAAGATGAATGG - Intronic
963439916 3:145326222-145326244 ATTTTTCTCTAACAGATGACTGG + Intergenic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
963647882 3:147940159-147940181 ATTCATCTGGAAGAGACAACTGG + Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965178223 3:165364314-165364336 GTTTATTTTTAAAAGATGACAGG - Intergenic
965604903 3:170488455-170488477 ACTTATCTAGAAAATATTACTGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966452028 3:180073800-180073822 ATGTGTCTGGAAAAGTTGTCTGG - Intergenic
966623848 3:181995323-181995345 ATTTACCTGAAAAAGAAGTCAGG + Intergenic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
966721719 3:183069694-183069716 ATTTATTTGGGAACCATGACTGG - Intronic
967344191 3:188435552-188435574 ATTTATCCTGAAAAGAAAACAGG - Intronic
967440558 3:189502945-189502967 ATTTAACTGGAAAAGAAAAGAGG - Intergenic
971128435 4:23779505-23779527 ATTTTTCTTGAAACGATGAATGG - Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972111762 4:35570434-35570456 ATTGATATTGAAAAGATGAAAGG - Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973784258 4:54320534-54320556 TTTTATCTGCAAAGGATGCCGGG + Intergenic
974693048 4:65325923-65325945 ATTTATCTTGTAAAAATGAAGGG - Intronic
974882554 4:67777858-67777880 AGTTATCTGAAAAAGAGGTCTGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975626109 4:76348748-76348770 AATTATCTGGAAAATAGGCCAGG + Intronic
976016999 4:80568040-80568062 AATTTTGAGGAAAAGATGACTGG + Intronic
976480961 4:85544808-85544830 AATTATCTGAGAAAGATGAAAGG - Intronic
976966246 4:91044711-91044733 GTTTATCTGAAAAATCTGACAGG - Intronic
977019886 4:91746184-91746206 ATTTAACTGAAAAAGAAGTCAGG - Intergenic
977032551 4:91904662-91904684 ATTGCTCTGGAAAAGATGTAGGG + Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977636889 4:99309104-99309126 ATTTATTTCTAATAGATGACTGG + Intronic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
977969361 4:103195827-103195849 ATTTCTCTTGTAAAGATGAAAGG - Intronic
978341593 4:107725579-107725601 AGTTATCTGGAGAATATGTCAGG + Intergenic
978552317 4:109940370-109940392 ATTTATGTGGTAAAGATAACAGG + Intronic
978605814 4:110477594-110477616 CTTCATCTGGAAAGGAAGACAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
978999314 4:115198718-115198740 ATTTACCTGAAAAAGAATACAGG - Intergenic
979704948 4:123709888-123709910 ATTTACCTGAAAAAGAAGTCAGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
979844136 4:125486836-125486858 ATTTGTGTGTAAAAGATGAGAGG + Intronic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980608426 4:135123741-135123763 TTTTACCTGGATAAGAAGACAGG + Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981873532 4:149515163-149515185 AGTTATCTCCAAAAGATGGCAGG - Intergenic
981979360 4:150772634-150772656 ATTTGTCTGGGAAGGATGTCAGG + Intronic
981993205 4:150949087-150949109 ATTTATTTGGGAAAAATGGCAGG - Intronic
982103343 4:151990199-151990221 AATTATCTCGGAAAGATGAATGG + Intergenic
982189823 4:152842901-152842923 ATTTATCTGAAAAAGAATTCAGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982992656 4:162298239-162298261 AGTGATATGGAAAAGATGAATGG - Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983366055 4:166790914-166790936 ATTTATGAAGAAAAGATGTCTGG - Intronic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983605179 4:169574947-169574969 AGTTTTCTGGAAGAGATTACAGG + Intronic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984394852 4:179183874-179183896 ATTTAGCTGGGAGAGATGGCAGG + Intergenic
984414770 4:179444220-179444242 GTTTATTTGAACAAGATGACTGG + Intergenic
985181953 4:187274157-187274179 TTTGATCTAGAAAAGATCACAGG + Intergenic
985883082 5:2655437-2655459 ATTTATAGGGACAAGATTACTGG + Intergenic
985934811 5:3089176-3089198 ATTAGTCTGGAAAAGATTTCAGG + Intergenic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
988902339 5:35746327-35746349 ATTTATCTGAAAAAGAATTCAGG + Intronic
988952603 5:36278889-36278911 ATTTTTTTGGAAAAGGTCACCGG + Intronic
988977253 5:36527453-36527475 ATTTGTCTTTAAAAGATGAAGGG + Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992253811 5:74901691-74901713 TATTATATGGAAAAGATGATGGG - Intergenic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993698390 5:91089726-91089748 AACTATCTGTAAAAGATAACTGG + Intronic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994051198 5:95364986-95365008 ATTTATCTGAAAAAGAATTCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
996488667 5:124066629-124066651 ATTTATCTGCAAAAGGTAGCAGG + Intergenic
996802893 5:127422859-127422881 ATTTTTTTTGAAAAGTTGACTGG - Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
998246685 5:140513465-140513487 CTTGATCTGGAAAAGGTGAGTGG + Exonic
998765469 5:145482092-145482114 AGTTATGTGATAAAGATGACAGG - Intronic
999160720 5:149495329-149495351 ATTTGTCTGGAAATGCTGCCGGG - Intronic
999422964 5:151460677-151460699 ATTTATATAGAAAACATGCCAGG + Intronic
999566722 5:152871870-152871892 ATTTATATGGATAAAATCACAGG - Intergenic
999990577 5:157046366-157046388 AGTTAGCTGGGAAAGATGACAGG + Intronic
1000462032 5:161535015-161535037 ATTTATCAGGAAATGTTGCCTGG - Intronic
1000898206 5:166881878-166881900 ATTTCTCAGGAAAAGCAGACAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001775790 5:174328190-174328212 ATTTCTTTGGAAACGGTGACTGG - Intergenic
1002577493 5:180182989-180183011 TGTTATCTGGCAAAGATGAAGGG + Intronic
1002873034 6:1184719-1184741 ATTAATCTAGAAAAGAAGAAAGG + Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003514415 6:6806160-6806182 ATTTATTAGGAAAAGGTTACAGG - Intergenic
1003822711 6:9917837-9917859 ATCTTTCTGGAAGAGATGAGAGG - Intronic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007306741 6:40912657-40912679 ATCTACCTGCAAAAGATGCCTGG + Intergenic
1007937079 6:45741917-45741939 ATGAATCTGGAAAAGAGGAGAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009606281 6:65872231-65872253 ATTTTTATGGAAAAGAGGAGAGG - Intergenic
1009788379 6:68367413-68367435 ATTTATGTGGAGAAGGAGACGGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1009905182 6:69861754-69861776 GTTTGTCTGGAAAAAATGATGGG - Intergenic
1010009455 6:71033446-71033468 ATTCATCTGGAGAACATGCCTGG + Intergenic
1011009063 6:82683294-82683316 GTTTATCTGGATAAGTTGAGGGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011647150 6:89470766-89470788 ATTTATCCTAAAAAGATAACAGG - Intronic
1011928326 6:92676051-92676073 CTTTTTCTGGAAATGATGAATGG - Intergenic
1012107150 6:95177398-95177420 GTTTATTTTGAAAAGATGAAAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013494553 6:110685307-110685329 ATTTATCAGGCAAAGAAGATAGG - Intronic
1013720938 6:113027698-113027720 ATTTACCTGAAAAAGAAGTCAGG - Intergenic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014424159 6:121283349-121283371 ATTTTTCTGAAAAACATGAACGG + Intronic
1014462572 6:121714770-121714792 CATTATCTGGAAAGGGTGACTGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015012308 6:128364880-128364902 ATTTAGATAGACAAGATGACAGG - Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015866096 6:137728211-137728233 AATTATATGGAAAGGATGTCAGG + Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016148338 6:140704017-140704039 AATTAGCTGGACATGATGACAGG + Intergenic
1016641180 6:146351365-146351387 ATATATTTGGAAAACATCACTGG - Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1022787899 7:33657270-33657292 AGCTTTCTGGAAAATATGACAGG + Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024058916 7:45683832-45683854 AGTTACCTGCAAAAGATGGCAGG + Intronic
1024866099 7:53906315-53906337 AGTTATCTGAAAAAGGTGGCAGG - Intergenic
1024896636 7:54268564-54268586 ATCTAACTGGAAATAATGACGGG - Intergenic
1026465152 7:70647374-70647396 ATGTGCCTGGACAAGATGACCGG + Intronic
1027767954 7:82369069-82369091 ATTTAACCTTAAAAGATGACTGG - Intronic
1027856984 7:83524286-83524308 ATTTATCTGCTGAAGAAGACTGG - Intronic
1028059969 7:86300047-86300069 ATTAATCTGGAAAAGGTCTCTGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1028948955 7:96612272-96612294 ATTCATCTGTAAAAAATGTCTGG + Intronic
1029943247 7:104503322-104503344 ATGTGTCTGTAAAAAATGACAGG + Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030539257 7:110809045-110809067 TTTTATTTGGGAAAGATGACAGG - Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031400680 7:121323234-121323256 CTTTATTTGGAAAAAATTACTGG + Intergenic
1031897656 7:127369977-127369999 ATTTATCTGGAAAATATCTTTGG + Intronic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032291597 7:130593296-130593318 AAATATCTGGAAAATAAGACTGG + Intronic
1032624244 7:133572378-133572400 CATGAACTGGAAAAGATGACTGG + Intronic
1033801754 7:144909681-144909703 ATTTATCTGGAATAAAGGAAAGG - Intergenic
1034211092 7:149363857-149363879 ACTTATCTGGCAAAGATGAAAGG + Intergenic
1035954927 8:4066446-4066468 ATTTATTTGGAAAATATTATCGG - Intronic
1036166962 8:6444376-6444398 ATTCATCTGGAAAACATTAACGG - Exonic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1039222997 8:35356078-35356100 ATTTATAAAGAAAAGATAACCGG - Intronic
1039356108 8:36817576-36817598 ATTTATCTCTAAATGCTGACAGG + Intronic
1040586260 8:48745293-48745315 ACTGATCTGTAAAAAATGACAGG - Intergenic
1041826529 8:62101266-62101288 ATTTAACTGAAAGAGAAGACTGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042050662 8:64701836-64701858 ATTTATCTAGTCAAGATAACTGG - Intronic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1043401390 8:79888572-79888594 ATTTATATGGAAAATATTAATGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046065441 8:109191085-109191107 ATTTCTCTGGAATGGATGATTGG - Intergenic
1046721495 8:117624544-117624566 ATTTTTCTGCAAAAGATTACTGG - Intergenic
1048754386 8:137720047-137720069 CTTTATCTGTAAAATATGATTGG - Intergenic
1048834988 8:138510388-138510410 ATTTATAGGGTAAAGATGACAGG - Intergenic
1049944793 9:583276-583298 TTTTATCTGTAAAAGAGGAATGG + Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050965694 9:11798753-11798775 CTTTATCTGAAAAAGGTGAGAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051939027 9:22482284-22482306 ATTGATCTTTAAAAGTTGACAGG - Intergenic
1052128804 9:24814793-24814815 AGTTACTTGGAAAAGATGATTGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1053659387 9:40256149-40256171 ATTTCTCTGCAAAAGAGGAATGG - Intronic
1053695960 9:40639533-40639555 AGTTAACTGGAGAAGATGACCGG + Intergenic
1053909759 9:42885512-42885534 ATTTCTCTGCAAAAGAGGAATGG - Intergenic
1054307207 9:63438751-63438773 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054371514 9:64402450-64402472 ATTTCTCTGCAAAAGAGGAATGG - Intronic
1054405940 9:64762743-64762765 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054439566 9:65248230-65248252 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054490841 9:65773709-65773731 AGTTAACTGGAGAAGATGACCGG - Intergenic
1054525211 9:66120068-66120090 ATTTCTCTGCAAAAGAGGAATGG + Intronic
1054679135 9:67892165-67892187 ATTTCTCTGCAAAAGAGGAATGG - Intronic
1055786510 9:79874741-79874763 ATTTATGGAGAAAAGGTGACTGG + Intergenic
1055808920 9:80128397-80128419 ATTTATGGAGAAAAGGTGACTGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056425472 9:86471256-86471278 TTTTAGATGGAAAAGAAGACTGG + Intergenic
1057119383 9:92558122-92558144 ATTTATCTGAAAAAGAATTCAGG - Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058623093 9:106904899-106904921 ATTTATCTGAAAAAGAATTCAGG - Intronic
1059927082 9:119220368-119220390 GAATATCTGGAAAAGATAACTGG + Intronic
1060240039 9:121895187-121895209 TTTCATCTTGAAAAGATGTCTGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1202778407 9_KI270717v1_random:13146-13168 AGTTAACTGGAGAAGATGACCGG + Intergenic
1185599691 X:1330308-1330330 ATTTAGCTGGACATGATGGCAGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186695481 X:12026258-12026280 ATTGATAAGGAAAAGAAGACAGG - Intergenic
1187375788 X:18752692-18752714 TTTTATCAGGAAAAGTTGTCGGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1187681528 X:21771716-21771738 ATTTATCTGAAAAAGAATTCAGG + Intergenic
1189413714 X:40795231-40795253 ATTTACCTGGAAAAGAATTCAGG + Intergenic
1189484310 X:41417494-41417516 ATTTATCTGGAAATGTTACCCGG + Intergenic
1190895362 X:54613416-54613438 ATTTATCTGAAAAAGAGTTCAGG - Intergenic
1191630040 X:63312619-63312641 AGTTATCTGAAGAAGTTGACAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192285287 X:69728573-69728595 ATTCAACTGGAAAAGTTGGCAGG + Intronic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192366882 X:70481001-70481023 ATTTATCTAGAGAAGGTTACGGG - Intronic
1192878196 X:75254192-75254214 ATTTGTCTGAAAAAGATTTCAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192998645 X:76539679-76539701 ATTTAACTGAAAGAGAAGACTGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193937740 X:87642557-87642579 ATTTATCTGAAAAAGAATTCAGG + Intronic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194521079 X:94919407-94919429 AGTTATCTGCAAAAGATGACAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1194882462 X:99271332-99271354 ATTTATCTGAAAAAGAATTCAGG - Intergenic
1195228465 X:102822239-102822261 AGTTATCTAGGAAAGATGGCAGG - Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198154313 X:133943693-133943715 ATGTATTTGGACAAGCTGACAGG + Intronic
1198231950 X:134698514-134698536 ATTTATCCTAATAAGATGACTGG - Intronic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200663540 Y:5991440-5991462 AGTTATCTTGAAAAGATCAGTGG - Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic
1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG + Intergenic
1201317255 Y:12659862-12659884 AATTAGCTGGGCAAGATGACGGG - Intergenic