ID: 1096181711

View in Genome Browser
Species Human (GRCh38)
Location 12:49554763-49554785
Sequence AGGGTAAGGCTGCCTCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096181711_1096181719 28 Left 1096181711 12:49554763-49554785 CCTGTCTGAGGCAGCCTTACCCT 0: 1
1: 0
2: 1
3: 8
4: 169
Right 1096181719 12:49554814-49554836 GAATGCATCAGTGCTGGCACAGG 0: 1
1: 0
2: 1
3: 11
4: 149
1096181711_1096181720 29 Left 1096181711 12:49554763-49554785 CCTGTCTGAGGCAGCCTTACCCT 0: 1
1: 0
2: 1
3: 8
4: 169
Right 1096181720 12:49554815-49554837 AATGCATCAGTGCTGGCACAGGG 0: 1
1: 0
2: 1
3: 15
4: 239
1096181711_1096181718 22 Left 1096181711 12:49554763-49554785 CCTGTCTGAGGCAGCCTTACCCT 0: 1
1: 0
2: 1
3: 8
4: 169
Right 1096181718 12:49554808-49554830 GTAGATGAATGCATCAGTGCTGG 0: 1
1: 0
2: 2
3: 9
4: 121
1096181711_1096181716 0 Left 1096181711 12:49554763-49554785 CCTGTCTGAGGCAGCCTTACCCT 0: 1
1: 0
2: 1
3: 8
4: 169
Right 1096181716 12:49554786-49554808 GTCCAGAGGAATCTTAGTGAAGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096181711 Original CRISPR AGGGTAAGGCTGCCTCAGAC AGG (reversed) Intronic
901853494 1:12030156-12030178 AGGGCGGGGCTGGCTCAGACTGG + Intronic
903357549 1:22757297-22757319 AGGATAAGGCAGGCACAGACAGG + Intronic
904001923 1:27343481-27343503 AGGAGGAGGTTGCCTCAGACAGG + Intronic
905027400 1:34860149-34860171 AGGGGAAGGGAGGCTCAGACAGG - Intergenic
905417991 1:37817917-37817939 AGGTTAAGGCTTCCTCTCACAGG + Intronic
907114371 1:51956031-51956053 ATTGTCAGGCTGCCTCTGACAGG - Intronic
908482279 1:64553722-64553744 AGGATAAGGCTACCTCTGAGAGG - Intronic
908617274 1:65936249-65936271 ACTGTAAGACAGCCTCAGACAGG - Intronic
909245013 1:73270135-73270157 AGGGCAGAGCTGCCTGAGACTGG + Intergenic
909443137 1:75720123-75720145 AGGGAAAGGGTGACTCAGAAGGG - Intergenic
912078943 1:105911831-105911853 TGGGTAAGGATTCCTCAGATTGG - Intergenic
913239669 1:116819249-116819271 AGGGACAGGCTGCCCCAGGCTGG + Intergenic
913585239 1:120268296-120268318 ATGATGAGGCTGCCTAAGACGGG + Intergenic
913622946 1:120630066-120630088 ATGATGAGGCTGCCTAAGACGGG - Intergenic
914567241 1:148880157-148880179 ATGATGAGGCTGCCTAAGACGGG + Intronic
914605582 1:149250085-149250107 ATGATGAGGCTGCCTAAGACGGG - Intergenic
915263687 1:154698649-154698671 AGAGAAAGGCTGACTCATACAGG + Exonic
915355627 1:155253994-155254016 AGGGTGAGGCAGCCTGAGTCAGG + Intronic
917471171 1:175327192-175327214 AGTGGAAGGCAGCCTCAGAGTGG - Intronic
919945672 1:202317795-202317817 AGGGTCAGCCTCCCTTAGACTGG + Intronic
1063338057 10:5235438-5235460 AGGGTCAGACTGCCTCAAATGGG + Intergenic
1069550797 10:69362691-69362713 AAGGGAAGGCTGCCTCAGGAAGG - Intronic
1071079990 10:81799297-81799319 AGGCTGAGGCTGCCAGAGACTGG + Intergenic
1073461645 10:103668969-103668991 AGGGTCAGGCTGCCTTGTACAGG - Intronic
1074157526 10:110811854-110811876 TGGGTAAGGCTGCCTAACCCTGG - Intronic
1075762329 10:124866172-124866194 AGGGTCAGGCTTCCTCACACCGG + Intergenic
1077268129 11:1662062-1662084 GGGGTAAGGCAGCCACAGCCAGG - Intergenic
1081910325 11:46696115-46696137 AGGGCAAGGCTGTCTGGGACAGG - Exonic
1081953468 11:47067508-47067530 AGGGTAGGGCTTCATCAGATAGG + Intronic
1083738422 11:64694795-64694817 AGAGCAAGGCTGCTTCTGACCGG - Intronic
1083836499 11:65272355-65272377 AGGGTCAGGCAACCTCAGCCTGG - Intronic
1084036670 11:66515584-66515606 AGGGGAAGGCAGCCTCTCACCGG - Exonic
1084417269 11:69040189-69040211 AGGGTGAGGCTGACCCAGGCCGG - Intergenic
1089112124 11:116065320-116065342 AGGGGAAGGCTGACACAGAGTGG - Intergenic
1093771958 12:23028605-23028627 AGGCTTAGGCTGCCTCAGCTTGG - Intergenic
1095649321 12:44588323-44588345 TGGCTCAGGCTGCCTCAGAGAGG - Intronic
1095989957 12:48027734-48027756 AGGGTACCCCTGCCTCAGGCTGG + Intergenic
1096181711 12:49554763-49554785 AGGGTAAGGCTGCCTCAGACAGG - Intronic
1096385350 12:51191572-51191594 TGAGTAAGGCTGCCCTAGACAGG - Intronic
1102444154 12:112988742-112988764 AGGGTAGGGCATCCTCAGAAAGG - Intronic
1102477130 12:113195945-113195967 AGGGTAAGGGGGCCTCAGGGAGG - Intronic
1104137246 12:125952373-125952395 AGGGCCAGGCTGCCTCACTCGGG - Intergenic
1105968029 13:25402585-25402607 AGGGTATAGCTGAGTCAGACTGG + Intronic
1106243464 13:27927880-27927902 AGGCACAGGCTGCCTGAGACTGG + Intergenic
1107028079 13:35823997-35824019 AAGGTAAGGCTGCTACACACAGG + Intronic
1109470093 13:62792486-62792508 AGGGTCATGATCCCTCAGACAGG - Intergenic
1114203618 14:20547043-20547065 AGGGTAAGGCTGAGTCAGCCAGG + Intergenic
1117035392 14:51722844-51722866 AGGGACAGGCTACCTCAGTCAGG - Intronic
1119555297 14:75548104-75548126 TGGGTAAGGCTGTGTCAGGCAGG - Intergenic
1120493806 14:85208816-85208838 ACTGTAAAGCAGCCTCAGACAGG + Intergenic
1123050403 14:105538644-105538666 AAGGTGGGGCTGCCTCAGCCTGG + Intergenic
1123707093 15:22958599-22958621 AGGGTCAGGCTGCCTCTGGGAGG + Intronic
1124270131 15:28272873-28272895 AGGTGAGGGCTGCCGCAGACGGG - Exonic
1125381903 15:39095029-39095051 AGGGTAAGGCGAGCTCAGAGTGG + Intergenic
1127810666 15:62562459-62562481 AGAGGGAGGCTGCATCAGACAGG - Intronic
1130263882 15:82381149-82381171 AGGGTAAGGAGGCCTCAGTAAGG + Intergenic
1130277150 15:82486442-82486464 AGGGTAAGGAGGCCTCAGTAAGG - Intergenic
1130469512 15:84213792-84213814 AGGGTAAGGAGGCCTCAGTAAGG - Intergenic
1130477002 15:84328356-84328378 AGGGTAAGGAGGCCTCAGTAAGG - Intergenic
1130494763 15:84459774-84459796 AGGGTAAGGAGGCCTCAGTAAGG + Intergenic
1130591806 15:85218421-85218443 AGGGTAAGGAGGCCTCAGTAAGG - Intergenic
1132316979 15:100897517-100897539 AGACTGAGGCTGCCGCAGACAGG - Intronic
1132488794 16:213229-213251 AGGCTGAGGCTGACTCAGGCTGG + Intronic
1133148390 16:3807866-3807888 TGGGTCAGGCTGCCTCACAAAGG + Intronic
1134095257 16:11414630-11414652 AGGGCAAGGCTGCCACAGCGTGG + Intronic
1135094030 16:19548012-19548034 AGGGTAAGAATGCCACACACGGG + Exonic
1137701989 16:50503907-50503929 AGGGAAAGGCTGCCCCTGATGGG - Intergenic
1137711730 16:50571485-50571507 TGGGGAAGGCTGCTTCCGACAGG - Intronic
1139435782 16:66935709-66935731 AGGGTGAGGCTCCCTCGGAGGGG + Exonic
1139658798 16:68405997-68406019 GGGCTAAGGGTGCCTCAGAGGGG - Intronic
1140750143 16:78015982-78016004 AGGTTACAGCTGCCTCTGACTGG - Intergenic
1142510045 17:387251-387273 AGGATGAGGCCGCCTCACACTGG - Intergenic
1143117925 17:4591118-4591140 AGGATAAGGATGCCTCACACAGG - Intronic
1143383102 17:6508561-6508583 AGCGAAAGGCTGCCACAGTCAGG + Intronic
1144665331 17:17098521-17098543 AGGGTAGGGCTGCCTTTGTCGGG + Intronic
1144690569 17:17260022-17260044 AGTGAAAGGCAGCCTCAGAGAGG - Intronic
1146078049 17:29751078-29751100 ACTGTAAAGCTGCCTCAGGCAGG - Intronic
1146256512 17:31393954-31393976 AGGGTGGGGCTGCCTCTGAATGG + Intronic
1146693630 17:34893049-34893071 GGGGTAAGGCTGCCCCCAACAGG + Intergenic
1147715995 17:42509025-42509047 AGGAAGAGGCTGGCTCAGACAGG - Intronic
1148814580 17:50318394-50318416 AGGGTAATGCAGCTTCAGAGAGG + Intergenic
1150630181 17:66875000-66875022 AGGGCAAGGCTGCTGCCGACTGG - Intronic
1150836883 17:68572329-68572351 ATGGTAAATCTGCCTCTGACAGG + Intronic
1151480763 17:74369001-74369023 GTGGTAAGGCTGCCACAGACAGG - Intronic
1151893295 17:76963804-76963826 AGGGTAAGGCTGACATAGCCAGG - Intergenic
1152110185 17:78353456-78353478 GGGGGAAGGAGGCCTCAGACAGG - Intergenic
1152133328 17:78490352-78490374 AGGGTCAGGCTGCCTCTAAGGGG - Intronic
1152307349 17:79529122-79529144 AGGGGAATGCAGCTTCAGACTGG - Intergenic
1152506982 17:80755851-80755873 AGGCTAAGTCTGCATCAGCCAGG - Intronic
1153449793 18:5214343-5214365 TGGGTAAGTCTGCCTCATTCTGG + Intergenic
1155301786 18:24436102-24436124 AGGTTAAGGCTGTTTCAGTCAGG + Intronic
1157825988 18:50813043-50813065 AGGGTCAGGTTGCATCAGAGAGG - Intronic
1158194244 18:54866667-54866689 AGGGCAGGGGTCCCTCAGACAGG + Intronic
1160238014 18:77101138-77101160 AGGCAAAGACTGCCTAAGACAGG + Intronic
1166938707 19:46350309-46350331 AGGATGAGGCTGTCTCAGCCAGG + Intronic
1168475691 19:56673533-56673555 AGGGAAAGGGTGGCCCAGACTGG + Intergenic
927148032 2:20179757-20179779 AGGGCAGGGCTGCCTCTGCCAGG - Intergenic
927202778 2:20588864-20588886 AGGCTGAGCCTGCCTCAGCCTGG - Intronic
927890446 2:26744865-26744887 AGAGTACCGCTGCCTCACACGGG + Intergenic
928120415 2:28580037-28580059 AGGGCAAGGCTGCTGGAGACTGG - Intronic
932112408 2:69013235-69013257 AGGGGAGGGCTGCCTCGGTCCGG - Exonic
934702214 2:96451527-96451549 ACGGCAAGGATGCCTGAGACTGG - Intergenic
934945341 2:98537319-98537341 AGGGTAAAGCTGACTGAGGCTGG + Intronic
940504756 2:154539113-154539135 AGGGAAAGGGTGACTCAGAAAGG - Intergenic
946895434 2:224319097-224319119 AGTGCAAGGCTGCCTGGGACAGG - Intergenic
948853198 2:240718306-240718328 AGGGGAAGGCTGACCCAGCCAGG + Intronic
1171965310 20:31525324-31525346 AAGGTAAGACTGGCTCAGAGAGG - Intronic
1172624584 20:36339973-36339995 AGGCTAAGGCAGCCGCAGAGCGG + Intronic
1174195198 20:48767854-48767876 TGGGTGAGGCTGCTTCAGCCAGG - Intronic
1176052024 20:63124873-63124895 AGGGAGAGGAGGCCTCAGACAGG + Intergenic
1178633212 21:34280474-34280496 GGGGTAAGGCTGCCTGGGGCTGG + Intergenic
1180883393 22:19222618-19222640 AGGGGAAGACTGCCACTGACTGG + Intronic
1184089738 22:42286082-42286104 AGGGTGAGGCAGGCTCAGAGGGG - Intronic
1184091499 22:42295282-42295304 AGGGTAGGGCTGGCTCACAGAGG - Intronic
1184259502 22:43306562-43306584 AGGGGAAGGTGGCCTCATACAGG + Intronic
949849547 3:8409171-8409193 ACTGTAAAGCTGCCTCAGGCAGG + Intergenic
953500100 3:43424902-43424924 AGGGAGAGGCAGGCTCAGACAGG + Intronic
954772730 3:52987188-52987210 ACTGTAAGCCAGCCTCAGACAGG - Intronic
960630995 3:119730143-119730165 AGGGAACAGCTGCCACAGACAGG - Intronic
961588105 3:127951495-127951517 AGTGTGAGGCTGTCTCTGACTGG + Intronic
963792843 3:149601876-149601898 AGGGAGTGGCTGCCTCAGAACGG + Intronic
964994174 3:162854049-162854071 ACTGTAAGTCTTCCTCAGACTGG + Intergenic
968370305 3:198219696-198219718 AGCGTGACGCTGCCTCACACTGG + Intergenic
968811192 4:2800378-2800400 AGGGGCAGGCTGCATCAGACAGG - Intronic
971032928 4:22660521-22660543 AGAGTAAGGGTGCCAGAGACTGG + Intergenic
972431292 4:38984867-38984889 AGGGAAAGGATGGCTAAGACAGG + Intronic
973600271 4:52535770-52535792 AGAGTAAGACAGCCTGAGACTGG - Intergenic
973748164 4:53984839-53984861 AGGGTAAGGGTTCCAAAGACAGG - Intronic
974473441 4:62349068-62349090 AGGGTATGGGTGCCACTGACTGG - Intergenic
975002856 4:69246890-69246912 ATGATAAGTCTTCCTCAGACAGG - Intergenic
979454396 4:120910395-120910417 AGGGGAAGGCTTCCTAAGAGTGG - Intronic
980433191 4:132730804-132730826 AGTGTAAAGCAGCCTCAGGCAGG - Intergenic
986583023 5:9284971-9284993 CTGGGAAGTCTGCCTCAGACTGG - Intronic
987012408 5:13781131-13781153 AGTGTTGGGCTGCATCAGACGGG + Intronic
987126184 5:14814995-14815017 AGGCTCAGGATTCCTCAGACTGG - Intronic
994819962 5:104636894-104636916 ATTGTAAGGCAGCCTCAGGCAGG + Intergenic
995830335 5:116348277-116348299 AGGGGAAGGCTGCCTCAGCCTGG + Intronic
996436645 5:123440709-123440731 ACTGTAAAGCAGCCTCAGACAGG - Intergenic
998413063 5:141925525-141925547 TGGGTAAGGCTTCCCCAGCCTGG + Exonic
1000045872 5:157521639-157521661 TGGGTACTGCTGCGTCAGACTGG - Intronic
1001512988 5:172336716-172336738 AGGGCAGGGCTGCCTCGGTCGGG + Exonic
1003251153 6:4430141-4430163 AGGGTCAGTCTGCCTCATGCAGG + Intergenic
1005391610 6:25339671-25339693 AGGGTCAGGTTGCCTCTGGCTGG + Intronic
1007777779 6:44233379-44233401 AGGGCAAGGCTACCTCAGAATGG - Intronic
1010429484 6:75762640-75762662 AGGGTGAGTCTGGCTCAGAAGGG - Intronic
1011740049 6:90350413-90350435 AGGGTGAGGCCACTTCAGACTGG - Intergenic
1012991515 6:105930966-105930988 AGGGTAAGGCTAGCACAGAACGG + Intergenic
1018927845 6:168219168-168219190 ATGTTAATGCTGCCTCAGATAGG - Intergenic
1019603516 7:1897160-1897182 GGGCTAAGGCTGAATCAGACAGG + Intronic
1023843141 7:44107783-44107805 AGGGGGAGGCTGGCTCAGAGTGG - Intronic
1030007340 7:105132382-105132404 AGGGGAAGACTGCCTAAGGCGGG - Intronic
1032265793 7:130369029-130369051 AGGGAAAGGTTGGCCCAGACAGG + Intergenic
1032631340 7:133655764-133655786 ACAGTAAAGCTGCCTCAGGCAGG - Intronic
1033254536 7:139788767-139788789 AGGGTTGGCCTGCCCCAGACTGG + Intronic
1034457066 7:151176320-151176342 AGTGAGAGGCAGCCTCAGACAGG + Intronic
1035608444 8:944876-944898 AGGGTTTGGCTGCCACTGACTGG - Intergenic
1037573740 8:20180973-20180995 AGGGGAAGACTGCCCCAGTCCGG - Exonic
1039363799 8:36909285-36909307 AGGATAAGGATGCCACAGTCTGG - Intronic
1039974079 8:42345095-42345117 GGGTCAAGGCTGCTTCAGACAGG - Intronic
1044496248 8:92888030-92888052 AGGGCATGGCAGCATCAGACAGG + Intronic
1044747664 8:95386376-95386398 GGGGTCAGGCTGCCTCAGCGAGG - Intergenic
1045328297 8:101133672-101133694 AGAGTAGGTCTGTCTCAGACAGG - Intergenic
1046418382 8:113945005-113945027 GTGTTTAGGCTGCCTCAGACAGG + Intergenic
1048060290 8:130912442-130912464 AATGTAAGGCTGCCTCAGGCAGG - Intronic
1055994424 9:82141837-82141859 AGTGGAAGGCTGCTTCACACAGG - Intergenic
1056740982 9:89255248-89255270 AGGGTCAAGCTGCCTTAGGCAGG - Intergenic
1058225297 9:102353693-102353715 AGGGTAAGCCTGCCTAATCCTGG + Intergenic
1060050653 9:120376078-120376100 AGGGTGGGGCAGCCTCAGAAGGG - Intergenic
1060667270 9:125439380-125439402 AGGGAAAGGCAGGCTCAGAGAGG - Intronic
1060766507 9:126298165-126298187 AGGGTAAGGCAGCCCCAGGTGGG + Intergenic
1062015902 9:134291297-134291319 AGGGGATCGCAGCCTCAGACAGG + Intergenic
1185794678 X:2954891-2954913 AGGGTAAGCCGGCTTAAGACTGG + Intronic
1187209895 X:17219099-17219121 ACTGTAAGGCAGCCTCAGGCAGG + Intergenic
1189304146 X:39974143-39974165 TGGGTCAGGAGGCCTCAGACTGG - Intergenic
1191626975 X:63280126-63280148 AGGGTAAAGCTGCCTAAGTTAGG - Intergenic
1192050204 X:67717762-67717784 AGGGCAAAGCCGCCTCATACTGG - Intronic
1192522787 X:71816235-71816257 AGGGTAATGCTGCCTCACATTGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1195750680 X:108159840-108159862 AGGAGAGGGCTGCCTCAGTCTGG - Intronic