ID: 1096187518

View in Genome Browser
Species Human (GRCh38)
Location 12:49591415-49591437
Sequence AGGTGGGCAGCTTTTTCTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 442}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096187518 Original CRISPR AGGTGGGCAGCTTTTTCTTT CGG (reversed) Intronic
900576291 1:3384096-3384118 GGGTGGGCAGCTGTGTCCTTGGG - Intronic
903700661 1:25246269-25246291 AAGTGGACAGCATTCTCTTTAGG - Intronic
905879250 1:41452878-41452900 AAGTTGGCAGCTTTTTGTTATGG + Intergenic
906895778 1:49769645-49769667 AGGTGTGCAGCTTTATTTCTGGG - Intronic
906959011 1:50403841-50403863 AGGTGTGCAGGTTTTTATATAGG - Intergenic
909163063 1:72179313-72179335 AGGTGTGCAGCTTTATTTCTGGG + Intronic
909267620 1:73581001-73581023 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
909679198 1:78272583-78272605 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
909874940 1:80790082-80790104 AGGTGGGCAGCTTTATTTCTGGG - Intergenic
910606666 1:89092646-89092668 AGGTGGGCATCTTTTCCCTTGGG - Intergenic
911029301 1:93469055-93469077 AGGTAAGCAGGTATTTCTTTAGG - Intronic
911510071 1:98800645-98800667 AGGTGTTCAGCTTTATCTCTGGG + Intergenic
911748630 1:101469821-101469843 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
911785108 1:101936788-101936810 AGGTGCGCAGCTTTATTTCTGGG - Intronic
911788447 1:101980522-101980544 AGGTGGGCACCTTTTTCACAGGG - Intronic
911801579 1:102145827-102145849 AGGTGTGCAGCTTTATTTCTAGG + Intergenic
912234766 1:107837718-107837740 AGGTGTGCAGCTTTATTTATTGG - Intronic
912490596 1:110060697-110060719 AGGTGGGCAGCTCATTCTGCAGG + Exonic
912588960 1:110794814-110794836 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
912857499 1:113183314-113183336 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
912957048 1:114162177-114162199 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
913590309 1:120318354-120318376 AGGTGTGTAGCTTTATTTTTGGG - Intergenic
913617877 1:120580009-120580031 AGGTGTGTAGCTTTATTTTTGGG + Intergenic
913959729 1:143329034-143329056 AGGTGGGGAGCCTTTCCTGTTGG + Intergenic
914054088 1:144154607-144154629 AGGTGGGGAGCCTTTCCTGTTGG + Intergenic
914125058 1:144811758-144811780 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
914572395 1:148930963-148930985 AGGTGTGTAGCTTTATTTTTGGG - Intronic
914600444 1:149199296-149199318 AGGTGTGTAGCTTTATTTTTGGG + Intergenic
915817346 1:158982451-158982473 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
917302586 1:173592177-173592199 AGGTGTGCAGCCTTATTTTTGGG + Intronic
918024527 1:180730198-180730220 AGGTGTGCAGCTTTATTTCTGGG + Intronic
918947868 1:191093191-191093213 AGGTGGGCAGCTTTATTTCTGGG - Intergenic
919287522 1:195583089-195583111 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
919617536 1:199826107-199826129 AGGTGGTCAACTTTTATTTTAGG - Intergenic
920040840 1:203095287-203095309 TGGTTGACAGCCTTTTCTTTTGG - Intronic
921109791 1:212024023-212024045 AGGTGTGCAGCTTTATCTCTGGG + Intronic
921479822 1:215651076-215651098 AGATGAGCAGTTTTTTCATTAGG - Intronic
922373387 1:224934881-224934903 CGGTTGGCATTTTTTTCTTTTGG - Intronic
923298364 1:232616722-232616744 AGGTGGGAAGACTTTTCCTTAGG - Intergenic
923645535 1:235816744-235816766 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1064776494 10:18783865-18783887 AGGTGGGCAACTTTATTTCTGGG + Intergenic
1064818846 10:19300539-19300561 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1067244546 10:44526906-44526928 AGTTGGGCAGCATTCACTTTTGG + Intergenic
1068071450 10:52201364-52201386 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1068396335 10:56466342-56466364 AGGCCTGCAGCTTTTTCTTCTGG - Intergenic
1068396456 10:56467930-56467952 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1068434273 10:56970530-56970552 AGATGGACAGATTTTTATTTAGG - Intergenic
1068640546 10:59400431-59400453 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1068999572 10:63248316-63248338 ATGTTGGTTGCTTTTTCTTTGGG - Intronic
1069068307 10:63969082-63969104 AGGTGTGCAGCTTTATATCTGGG - Intergenic
1069130604 10:64697439-64697461 AGATGTGCAGCTTTGTTTTTGGG - Intergenic
1070620811 10:78009396-78009418 AGGTGGAAAGTTTTTTCTTCAGG - Intronic
1071357737 10:84814841-84814863 AGGTGGGCAGCATTATCTGTGGG + Intergenic
1072883652 10:99253314-99253336 AGGTGTGCAGCTTTGTTTCTGGG - Intergenic
1073670553 10:105582888-105582910 AGGAAAGCAGCTTTTTCTTCTGG + Intergenic
1073880801 10:107977440-107977462 AGGTGTGCAGCCTTTTTTCTGGG + Intergenic
1074190686 10:111132965-111132987 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1074925009 10:118059775-118059797 TGGAGGGCTGCTTTTTCATTTGG - Intergenic
1075149069 10:119910168-119910190 AGATGGCCAGATTTTTCTGTGGG + Intronic
1075929737 10:126285661-126285683 AGGAGGGAAGCTTTGTCGTTGGG + Intronic
1076609786 10:131716703-131716725 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1078694368 11:13615624-13615646 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1079114302 11:17631237-17631259 TGGGGGGTAGCTTTTTATTTTGG + Intronic
1080023523 11:27589597-27589619 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1080818291 11:35779916-35779938 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1081048671 11:38310221-38310243 AGGTAGGCTGCGTTGTCTTTGGG - Intergenic
1081095724 11:38932003-38932025 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1082650254 11:55782149-55782171 AGGTGTGGAGCTTTATTTTTGGG - Intergenic
1083572225 11:63766892-63766914 ATGTTGGCAGCTTTGTCTTGGGG - Intronic
1084926347 11:72515619-72515641 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1084961171 11:72717448-72717470 AGGTGGGCAGTTTTTATTTATGG - Intronic
1085478623 11:76804255-76804277 AGGAGGGTGGCTTTTTCATTTGG - Intergenic
1085569782 11:77549436-77549458 AGGTAAGGAGCTTTTTCTCTGGG - Intronic
1085876374 11:80411217-80411239 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1086045877 11:82530971-82530993 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1086523081 11:87693827-87693849 AGGTGTGCAGCTTTATTTCTTGG + Intergenic
1087693020 11:101343944-101343966 AGGTGTGCAGCTTTATTTTGGGG + Intergenic
1087969898 11:104467327-104467349 GGATTGTCAGCTTTTTCTTTTGG + Intergenic
1088877470 11:113947960-113947982 AGGGGGGCAGATTTTTCTAAAGG - Intergenic
1088964377 11:114703217-114703239 AGTTAGGGAGCTTTTTCTGTAGG + Intronic
1089380333 11:118026103-118026125 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1090497268 11:127225823-127225845 AGATAGGCTGCTTTTTCCTTGGG + Intergenic
1092441204 12:8506318-8506340 AGGTGTGCAGCTTTATTTCTTGG + Intergenic
1093019504 12:14189998-14190020 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1093545939 12:20348126-20348148 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1093753276 12:22825860-22825882 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1094624578 12:32111254-32111276 CATTGGGCAGCTTTTTCTTTTGG + Intronic
1095816465 12:46427961-46427983 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1096187518 12:49591415-49591437 AGGTGGGCAGCTTTTTCTTTCGG - Intronic
1096944403 12:55388304-55388326 TGGTTGGCTGATTTTTCTTTTGG + Intergenic
1098589686 12:72196035-72196057 AGGTGTGCAGCTTTATCTTTGGG + Intronic
1099200783 12:79674234-79674256 AGGTGTGCAGCTTTATTTTTGGG - Intronic
1099367142 12:81781193-81781215 AGGTGTGCAGATTTTTCATGTGG - Intergenic
1099619091 12:84977613-84977635 TGGTGGGCAGTTTCTTGTTTTGG - Intergenic
1100168992 12:91951433-91951455 TGGTTGGCAGCCATTTCTTTTGG + Intergenic
1100592234 12:96040151-96040173 AGGTGGGCAGATTTTTCAGGTGG + Intronic
1100928535 12:99579029-99579051 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1100972264 12:100082701-100082723 AGGTGTGCAGCTTTATTTCTAGG + Intronic
1101180273 12:102209183-102209205 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1105235843 13:18552833-18552855 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1106030569 13:25998431-25998453 AGGGGGCCACCTTTTTCTCTGGG + Intronic
1106148307 13:27072346-27072368 AGTTAGGCGGCTTTTTCCTTTGG + Intronic
1106316657 13:28600210-28600232 ATATGAGCAACTTTTTCTTTTGG - Intergenic
1106372621 13:29150854-29150876 AGGTGTGCAGCTTTATTTCTAGG + Intronic
1106984227 13:35325966-35325988 AGGTGTACAGCTTTATCTCTGGG + Intronic
1107207902 13:37817717-37817739 AGGTGTGCAGCCTTTTTTTTTGG - Intronic
1107295822 13:38906229-38906251 AGCTGGGCTGCATTTTCATTTGG - Intergenic
1107309083 13:39057362-39057384 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1107471031 13:40691494-40691516 AGGTGTGCAGCTTTATTTCTCGG - Intergenic
1107570582 13:41653741-41653763 AGGTGGGCAACTTTGTTTCTGGG - Intronic
1108155700 13:47582881-47582903 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1108675529 13:52734561-52734583 AGGTGGGTTTCTTTTTTTTTTGG + Intronic
1108990575 13:56651953-56651975 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1109042970 13:57365387-57365409 AGGTGGACAGTTTCTTCTCTGGG - Intergenic
1109930538 13:69211028-69211050 AGGTGGGTAGCTTTATTTCTAGG + Intergenic
1110664357 13:78099197-78099219 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1110989932 13:82027259-82027281 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1111179269 13:84640655-84640677 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1112186788 13:97135521-97135543 AGGTGCTCAGCTGTTTCTTGCGG - Intergenic
1113538766 13:111090140-111090162 AGGTGGGCAGCCTTTCCCTCTGG + Intergenic
1113697965 13:112361436-112361458 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1114054506 14:18955380-18955402 AGGTAGGATGCTTTCTCTTTGGG + Intergenic
1114108047 14:19446551-19446573 AGGTAGGATGCTTTCTCTTTGGG - Intergenic
1116306238 14:43260759-43260781 AGTTTGGCAGCTTTTTCATTTGG - Intergenic
1117671746 14:58114772-58114794 AGGTGTGCAGCTTTATTTCTTGG - Intronic
1117783502 14:59258606-59258628 AGGTGGGCAGGTTCTTCTGAGGG + Intronic
1118479569 14:66150708-66150730 AGGTGTGCAGCTTTATATCTGGG - Intergenic
1118527121 14:66658244-66658266 AGATGAGGAGCTTTTTCTTATGG + Intronic
1120206477 14:81592053-81592075 AGGTGGGCAGTTATTTATTTGGG + Intergenic
1121199465 14:92105819-92105841 AGGCGGCCAGCTTTGTTTTTAGG - Intronic
1121809813 14:96874639-96874661 ATGTGTGAAGCATTTTCTTTAGG + Intronic
1121868706 14:97387305-97387327 ACCTGGGCAGCTTTTATTTTGGG + Intergenic
1122930967 14:104932964-104932986 AGGGGGGCCTCTTTTTCTCTCGG + Exonic
1123423531 15:20149789-20149811 AGGTGGGGAGCCTTTCCTGTTGG + Intergenic
1123532753 15:21156310-21156332 AGGTGGGGAGCCTTTCCTGTTGG + Intergenic
1124635355 15:31361440-31361462 AGGGGTGCAGCTTTTACTTTTGG - Intronic
1124915820 15:33972739-33972761 AGTTGGTCTGCTTTGTCTTTTGG - Intronic
1125327283 15:38548954-38548976 ATGTAGGGAGCTTTTCCTTTAGG + Intronic
1125635386 15:41183908-41183930 AGATGGGCAGTTTGTTCTTAAGG - Exonic
1126455188 15:48853669-48853691 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1127054993 15:55122214-55122236 AGGTGTGCAGCCTTATCTCTGGG - Intergenic
1127518178 15:59716402-59716424 AGCTGGGCATTTTTTTTTTTTGG + Intergenic
1127767882 15:62205427-62205449 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1128947247 15:71835207-71835229 AGGTTGAAAGCTTTTCCTTTGGG + Intronic
1129560142 15:76557830-76557852 AGGTGAGCAGCTTTATTTCTGGG - Intronic
1130397785 15:83518979-83519001 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1132245213 15:100290686-100290708 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1133902374 16:9989221-9989243 AGGTGTGCAGCTTTATTTTAGGG - Intronic
1136861288 16:33705817-33705839 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
1137335935 16:47549001-47549023 ACGTGGAAACCTTTTTCTTTAGG + Intronic
1137426704 16:48385888-48385910 AGGGCAGCCGCTTTTTCTTTGGG - Intronic
1140851637 16:78940084-78940106 AGGTGGTCATCATTTTATTTGGG + Intronic
1141010967 16:80398527-80398549 TGCTGGGAGGCTTTTTCTTTTGG - Intergenic
1203122785 16_KI270728v1_random:1554008-1554030 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
1144016901 17:11204765-11204787 AGCTGAGCAGCTTGTACTTTTGG - Intergenic
1147348286 17:39819899-39819921 AGGTGGGCGGATTTTTCTGGAGG - Intronic
1147380877 17:40055427-40055449 AGGTGGGTAACATTTGCTTTCGG - Intronic
1148040788 17:44705324-44705346 AGGTGTACAGCTTTATTTTTGGG + Intergenic
1150028449 17:61704190-61704212 AGGTGTGCAGTTTTATTTTTAGG + Intronic
1150151283 17:62810522-62810544 AGGTAGGGAGCTTGTTCTGTTGG + Intergenic
1150851767 17:68710144-68710166 AGCTGGGCAGTTTTTTTTTTAGG + Intergenic
1151896308 17:76983081-76983103 AGGTGAGCAGCTTTGTTGTTGGG - Intergenic
1153680415 18:7495368-7495390 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1154109968 18:11559415-11559437 AGGTGCACAGATTTTTCCTTTGG - Intergenic
1154402928 18:14059198-14059220 AGGTGTGCAGCTTTGTTTCTGGG + Intronic
1154513698 18:15137165-15137187 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1155480321 18:26279689-26279711 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1155613371 18:27694313-27694335 AGGTGTGCAGCATTATTTTTGGG + Intergenic
1155836945 18:30597678-30597700 ATCTGGGCTGCTTTTTATTTAGG - Intergenic
1156436506 18:37135963-37135985 AGGTGTGTGGCTTTATCTTTGGG + Intronic
1158039659 18:53077378-53077400 AGGTGGTCAGCTTGGTCTGTGGG - Intronic
1158626101 18:59072744-59072766 AGGTTGGCAGCTGCTTCTTTGGG + Intergenic
1159110405 18:64049464-64049486 ATTTGGGCTGCTTTTGCTTTGGG + Intergenic
1159641458 18:70867275-70867297 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1160109278 18:76010189-76010211 AGGTGTGCAGCTTTATTTCTTGG + Intergenic
1160668236 19:343667-343689 GGGTGGGCACCTTTTCCTTTGGG + Intronic
1162266633 19:9581009-9581031 AGGTTGTCAGCTTCTCCTTTAGG + Intronic
1163096570 19:15062285-15062307 ATGTGGGCAGGTTTCTCCTTTGG - Intergenic
1165750282 19:38255469-38255491 AGGTGGTCAGTTTTTTCTTTAGG + Intronic
1165761148 19:38321687-38321709 TAGGGGGCAGCTTTTGCTTTTGG + Intronic
1166955156 19:46459130-46459152 ACGTGGGCATCTTTTACTTCTGG + Intergenic
1168188023 19:54713680-54713702 AGGTGGGCAGATTTGTATTTGGG + Intergenic
1202693567 1_KI270712v1_random:107285-107307 AGGTGGGGAGCCTTTCCTGTTGG + Intergenic
924960722 2:31874-31896 GGGAGTGCAGCTCTTTCTTTGGG - Intergenic
925017274 2:540228-540250 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
925071688 2:974232-974254 AGGTGGGCTGCTCCTTCTGTGGG + Intronic
925458454 2:4039780-4039802 AGGAGGGCAGATCTTCCTTTAGG + Intergenic
927228148 2:20790792-20790814 AGGTGTACAGCTTGATCTTTTGG + Intronic
928597607 2:32870870-32870892 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
929266916 2:39928775-39928797 AGGGTGGCTTCTTTTTCTTTTGG - Intergenic
930162760 2:48175146-48175168 AAGGGGGTAGCTTTTGCTTTGGG - Intergenic
930528988 2:52568124-52568146 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
930748956 2:54913968-54913990 AGGTGTGCAGCTTTATTTCTGGG + Intronic
930950376 2:57135576-57135598 AGATGGAAAGCTTTTTTTTTTGG + Intergenic
932880479 2:75496868-75496890 AGGTGTGCAGCTTTATTTCTGGG - Intronic
933605694 2:84380427-84380449 AGGTGCGCAGCTTTATTTCTGGG - Intergenic
933613087 2:84457647-84457669 AGGTGGGCAACTTCTTCCTAGGG + Intronic
933642096 2:84774374-84774396 AGGTGTGCAGCTTTATTTCTGGG + Intronic
933953003 2:87347297-87347319 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
934237238 2:90243642-90243664 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
934459659 2:94206936-94206958 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
935311268 2:101786120-101786142 CGGCCGGCATCTTTTTCTTTTGG + Intronic
937335325 2:121058876-121058898 AGGTGGGCATCTGTTTCTTCTGG - Intergenic
938513939 2:131981776-131981798 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
938994064 2:136658898-136658920 ATGTGGGCAGCTCTCTCATTTGG - Intergenic
939782017 2:146460634-146460656 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
940028211 2:149231224-149231246 AATTTGGCAGCTTTTCCTTTTGG - Intergenic
940464330 2:154009209-154009231 AGGTGTGCAGCTTTATTTCTGGG + Intronic
940535158 2:154931789-154931811 AGGTGGGCAGCTTTTTTTCTGGG + Intergenic
940615401 2:156043095-156043117 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
941077824 2:161026280-161026302 AGGTGTGCAGCTTTATTTGTGGG - Intergenic
941112871 2:161435878-161435900 AGGTGTGCAGCTTTATTTTTGGG + Intronic
941194601 2:162433459-162433481 AGGTGTGCAGCTTTATTTCTGGG - Intronic
942578896 2:177395189-177395211 AGGAGGGCAGGTTTTCCTTATGG + Intronic
942865705 2:180672021-180672043 AGGTGTGCAGCTTTATTTCTAGG + Intergenic
942935690 2:181553914-181553936 ATGTGAGCAGCATGTTCTTTTGG - Intronic
943193285 2:184708478-184708500 AGGTGTGCAGCTTTATTTCTGGG - Intronic
943489528 2:188533313-188533335 AGGTGTGCAGCTTTAATTTTGGG - Intronic
943502534 2:188710027-188710049 AGGTGTGCAGATTTGTTTTTGGG - Intergenic
944081195 2:195790521-195790543 AGGTGTGCAGCTTTATTTCTGGG - Intronic
944303343 2:198150457-198150479 AGTTGTTCAACTTTTTCTTTGGG + Intronic
944335981 2:198535498-198535520 AGGTGTGCAGCTTTATTTCTGGG - Intronic
944472771 2:200072658-200072680 AGGAGTTCAGCTTCTTCTTTGGG + Intergenic
945193130 2:207211019-207211041 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
945365404 2:208946584-208946606 AGGTAGGGAGGTTTTTCTGTAGG + Intergenic
945487419 2:210413448-210413470 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
946166298 2:217866172-217866194 AGCCAGGCAGCATTTTCTTTAGG - Intronic
946280076 2:218660079-218660101 AGATGGGCAGATTTTCATTTGGG + Exonic
948601120 2:239108010-239108032 AGGTGGGCAGCTGCGGCTTTGGG - Intronic
1169642034 20:7763358-7763380 ATGTGGGCAGCTTTCACATTTGG - Intergenic
1169642115 20:7764427-7764449 ATGTGGGCAGCTTTCACATTTGG - Intergenic
1170298344 20:14853984-14854006 AGGTGGGCAGTTTGTTCATTTGG + Intronic
1171937700 20:31291456-31291478 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1174654702 20:52161101-52161123 AGGTGGGCAGCTCTGTCCTAGGG - Intronic
1175462498 20:59162603-59162625 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1175701493 20:61140870-61140892 AGTCAGGCAGCTTCTTCTTTGGG + Intergenic
1175845591 20:62057145-62057167 AGGTGGGCACCTTGTTCCATGGG - Intronic
1176779844 21:13181119-13181141 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1176898404 21:14411002-14411024 AGGTGTGTGGCTTTTTCTCTTGG + Intergenic
1177382266 21:20360128-20360150 AGGTGGGCAGATTTGTTTCTGGG - Intergenic
1177977493 21:27870146-27870168 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1178068461 21:28934014-28934036 AGGTGGGCAGGATTTTGTTATGG - Intronic
1179263521 21:39780308-39780330 AGGAAGGAAGCTGTTTCTTTGGG + Intronic
1180472976 22:15677756-15677778 AGGTAGGATGCTTTCTCTTTGGG + Intergenic
1181356536 22:22299519-22299541 AGGTGGGGAGCCTTTCCTGTTGG + Intergenic
1181991311 22:26839072-26839094 AGGTGGACTGCTTTTTTTATTGG + Intergenic
1182442313 22:30371660-30371682 GGGTGGCCATCTTTGTCTTTAGG - Exonic
1182515299 22:30855330-30855352 TGGTGGGCAGCTTTGGCTCTGGG - Intronic
1182814328 22:33146155-33146177 TGGTGGGAAGCATTTTCATTAGG - Intergenic
1184402754 22:44283299-44283321 AGGTGGGACACTTTTCCTTTTGG - Intronic
949186364 3:1196853-1196875 AGGTGGACAGCTTTTACTTGTGG - Intronic
949696623 3:6704081-6704103 AGGTGTGCAGCTTTATTTTTGGG - Intergenic
949758536 3:7441788-7441810 AAGTGTGCAGCTTTATTTTTGGG + Intronic
949909975 3:8895124-8895146 AGGTGGTGAGTTTTTTTTTTTGG - Intronic
950588792 3:13919477-13919499 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
950608074 3:14102213-14102235 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
952141494 3:30483773-30483795 AGGTGTGCAGCTTTGTTTCTGGG - Intergenic
952205705 3:31180290-31180312 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
952562195 3:34608037-34608059 AGGTGTGCAACTTTATTTTTGGG + Intergenic
953267493 3:41406278-41406300 AGGTGTGCAGCTTTATTTCTGGG + Intronic
953650186 3:44795552-44795574 AAGTGGTCATCTTTTTCTGTGGG - Intronic
953674970 3:44993837-44993859 AGCAGAGCAGCTTTTTATTTAGG + Intronic
955123943 3:56090835-56090857 AGGTGGTCAGTTTTTTTTCTAGG - Intronic
955217636 3:56997473-56997495 AGGGGGGCAGAGTTTGCTTTTGG - Intronic
955265483 3:57439380-57439402 AGGTGTGCAGCTTTATTTTTGGG - Intronic
955818302 3:62870998-62871020 TGGTGGGGAGATTTTTGTTTTGG + Intronic
956087539 3:65628481-65628503 CGGTGGGCAGCTTTTCATATGGG - Intronic
956889736 3:73600654-73600676 AGCTGGGCAGGATTTTCTCTTGG - Intronic
957223694 3:77415680-77415702 GTGTGGGCAGTTTTTGCTTTGGG + Intronic
958594601 3:96205341-96205363 AGGTGTGCAGCTTTATTTCTAGG - Intergenic
959326846 3:104947629-104947651 AGGTGTGCAGCCTTATTTTTGGG + Intergenic
959738707 3:109690661-109690683 AGGTGTGCAGCTTTATTTTTGGG + Intergenic
961227723 3:125268391-125268413 AGGTGTGCAGCTTTTTTTTCTGG - Intronic
962332686 3:134493467-134493489 ACATGGGAACCTTTTTCTTTAGG + Intronic
962510042 3:136089392-136089414 AGGTGTGCAGCTTTATTTCTGGG + Intronic
963889997 3:150623978-150624000 AGCTGTGCTTCTTTTTCTTTGGG + Intronic
964151841 3:153535006-153535028 AGGTGTGTGGATTTTTCTTTGGG - Intergenic
964511619 3:157458933-157458955 AGGTGTGCAGCTTTATTTCTGGG + Intronic
964513685 3:157481981-157482003 AGGTGTGCAGCTTTATTTCTAGG + Intronic
964593524 3:158395011-158395033 AGGTGTGCAGCTTTATTTCTGGG - Intronic
964828354 3:160855055-160855077 AGGTATGCAGCTTTTTTTTCTGG - Intronic
964868328 3:161286372-161286394 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
966617564 3:181928394-181928416 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
966686922 3:182705522-182705544 ATGTTGGAAGCTTTCTCTTTTGG - Intergenic
966750548 3:183317562-183317584 AGGAGTGCATCTTTTTATTTGGG - Intronic
966908787 3:184546278-184546300 TGGTGGGCAGCCCTTCCTTTCGG + Intronic
967122372 3:186394043-186394065 AGGTGAGCAGCTTTATTTCTGGG - Intergenic
967702069 3:192604884-192604906 AGGTGTGCAGCTTTATTTCTGGG - Intronic
970048052 4:11878118-11878140 ATGTGTGCAGGTTTTTCTGTAGG + Intergenic
970126096 4:12813158-12813180 AGGTGTGCAGCTTTATTTTAGGG + Intergenic
970352973 4:15224278-15224300 AGGTGTGCAGCTTTATTTATGGG - Intergenic
970355342 4:15245558-15245580 GGGTGAGCAGCTTTTTCTCAAGG - Intergenic
972235004 4:37121747-37121769 AGGTGTGCAGCTTTATTTCTAGG + Intergenic
972256591 4:37362500-37362522 AGGTGTGCAGCTTTATTTCTGGG - Intronic
972715629 4:41643156-41643178 AGGTGGGCAGCCATTGCTTTGGG + Intronic
973012244 4:45091600-45091622 AGGTGTGCAGCTTTATTTCTAGG - Intergenic
973151526 4:46894320-46894342 AGGTGGGCAGCCTTATTTCTGGG - Intronic
973767312 4:54174599-54174621 AGGTGTGCAGCTTTATTTCTGGG - Intronic
974355844 4:60811734-60811756 GGGTGGGCATCTTTCTCTGTAGG - Intergenic
977458385 4:97292906-97292928 AGGTGTGCAGATTTATTTTTGGG + Intronic
978222763 4:106296984-106297006 AGGAATGCAGCTTCTTCTTTTGG - Intronic
978601750 4:110435485-110435507 AGGTGTGCAGCTTTATTTCTGGG + Intronic
979945470 4:126826034-126826056 AGAGAGGCAGCTTTTTCTTATGG - Intergenic
980288722 4:130815695-130815717 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
981302274 4:143201212-143201234 AGGTGTGCAGCTTCGTCTGTGGG - Intronic
981622745 4:146722503-146722525 AGGTGTGCAGCTTTATTTTCAGG - Intronic
981729234 4:147880166-147880188 TGGTGGGAAGCTTTGTCTCTAGG - Intronic
981874894 4:149530133-149530155 AGATGGGGACATTTTTCTTTGGG - Intergenic
982095087 4:151914519-151914541 AGGTGTGCAGCTTTATTTTTGGG + Intergenic
982128438 4:152204818-152204840 AGGATGACACCTTTTTCTTTTGG + Intergenic
982569295 4:157028041-157028063 TGGTGGACAGTCTTTTCTTTAGG - Intergenic
983778143 4:171634181-171634203 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
986244468 5:5993361-5993383 TGGTGTGCAGCTTTATTTTTGGG + Intergenic
986866410 5:11994408-11994430 AGGTATGCAGCTTTATCTCTGGG + Intergenic
987076706 5:14389397-14389419 AAGTGAGTGGCTTTTTCTTTGGG + Exonic
987806280 5:22773334-22773356 AGGTGTGCAGCTTTATTTTTGGG - Intronic
988141086 5:27241649-27241671 AGGTGGGCAGCTTTATTTCTGGG - Intergenic
988513721 5:31887520-31887542 AGGTTGGCAGCTTTTCCAATAGG + Intronic
988979843 5:36556203-36556225 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
989208594 5:38836085-38836107 AGGAGGGCTGATTTTTCTTATGG - Intergenic
989346000 5:40430138-40430160 AGATGAGCAGCTGTTGCTTTAGG - Intergenic
989715937 5:44463307-44463329 AGGTGTGCATCTTTATCTCTGGG + Intergenic
990071964 5:51793435-51793457 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
990122596 5:52473468-52473490 AGTTGAGCAGTTATTTCTTTGGG - Intergenic
991324729 5:65418050-65418072 AGGTGTGCAGCTTTATTTCTAGG - Intronic
991659934 5:68940634-68940656 AGGTGTGCAGCTTTATTTCTAGG - Intergenic
992207161 5:74442123-74442145 TAGTGGTCAGCATTTTCTTTAGG + Intergenic
992520881 5:77549925-77549947 AGGTGTGCAGCTTTATTTCTGGG - Intronic
992922519 5:81541602-81541624 AGGTCTGCAGCTTTTTTTCTGGG - Intronic
993696597 5:91068972-91068994 AGGTGTGTAGCCTTTTTTTTCGG - Intronic
993998156 5:94747041-94747063 AGGTTTCCAGCTTTTTTTTTAGG + Intronic
994257731 5:97619518-97619540 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
994650878 5:102525705-102525727 AGGTGTGCAGCATTATTTTTGGG - Intergenic
994803814 5:104417087-104417109 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
995307734 5:110673649-110673671 AGTTGGGCTGCTTTTTGATTTGG + Intronic
996264721 5:121524455-121524477 AGGTGAGCATCCTTTTCTTCTGG - Intergenic
996266728 5:121550342-121550364 AGGAGGGCAGTCTTTTCTTCTGG - Intergenic
996469319 5:123841693-123841715 AGGTGGGCAGCTTTATTTCTGGG - Intergenic
996641465 5:125760293-125760315 AGGTGTGCAGCTTTATTTTTTGG + Intergenic
997021872 5:130012276-130012298 AGGTGTGCAGCTTTATTTGTGGG - Intronic
997183543 5:131858267-131858289 AGGTGTGCAGCTTTATTTCTGGG - Intronic
997618656 5:135270693-135270715 AGGTAGGCAGCTTTTGGCTTGGG + Intronic
997784053 5:136690732-136690754 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
998291381 5:140917704-140917726 AGGTGTGCAGCTTTATTTCTGGG + Intronic
998633158 5:143923480-143923502 AGATGGGAAGCTATTTCTTAAGG - Intergenic
998927824 5:147146276-147146298 AGGTGTGCAGCTTTATTTCTTGG - Intergenic
1000186039 5:158859060-158859082 AGAGGGGCTGATTTTTCTTTTGG - Intronic
1000612806 5:163393481-163393503 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1000802365 5:165744339-165744361 AGGAAGATAGCTTTTTCTTTTGG - Intergenic
1001767699 5:174265492-174265514 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1002003446 5:176212917-176212939 ACTTGAGCAGCTTTTTGTTTGGG - Intergenic
1002223012 5:177698002-177698024 ATTTGGGCAGCTTTTTGTTTGGG + Intergenic
1002880746 6:1250126-1250148 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1004496030 6:16163996-16164018 AGGGGAGGAGCTTTTTCTGTTGG - Intergenic
1004766288 6:18731372-18731394 AAGTGTGCAGCTTTATCTCTGGG - Intergenic
1005097000 6:22127609-22127631 AAGTGTGCAGCTTTATTTTTGGG + Intergenic
1005227096 6:23655722-23655744 TGGTGAGCAGCTTTTGGTTTGGG - Intergenic
1005277541 6:24236262-24236284 AGGTGTGCAGCTTTATTTTTGGG - Intronic
1006280419 6:33048408-33048430 AAGTTGAAAGCTTTTTCTTTAGG - Intergenic
1007919812 6:45596551-45596573 ATGTGGGCAACTTTTTCCTAAGG - Intronic
1008499574 6:52167535-52167557 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1009849323 6:69175449-69175471 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1010624511 6:78120949-78120971 AGGTGTGAAGCTTTATTTTTGGG + Intergenic
1010835005 6:80575173-80575195 AAGTAGGCAGCTAGTTCTTTTGG + Intergenic
1011320248 6:86083453-86083475 AGGTGTGTAGCTTTATTTTTGGG + Intergenic
1011978145 6:93334087-93334109 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1012250895 6:96979448-96979470 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1012770587 6:103428545-103428567 AGGTGTGCAGCTTTATTTGTGGG - Intergenic
1013640275 6:112069343-112069365 AGGTTGGCATGTTTTTCCTTTGG - Exonic
1014117260 6:117679536-117679558 AGTTGGGCAGTTTTTCCTTTGGG + Intronic
1014852333 6:126357239-126357261 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1014860908 6:126467323-126467345 AGGTGTGCAGCCTTGTTTTTGGG - Intergenic
1014872746 6:126615721-126615743 AGGTGTGCAGTTTTTTTTATGGG - Intergenic
1014887540 6:126799906-126799928 GGGAGTGCAGATTTTTCTTTGGG - Intergenic
1015324385 6:131907942-131907964 AGGTTTGCAGCTTCTGCTTTAGG + Intergenic
1016374801 6:143409488-143409510 AGGTGTGCAGTGTTTACTTTAGG + Intergenic
1018566239 6:165157000-165157022 AGGTAGACACATTTTTCTTTTGG - Intergenic
1020551303 7:9608670-9608692 AGGTGTGCAGCTTTGTTTCTGGG - Intergenic
1020651090 7:10877305-10877327 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1020804681 7:12774072-12774094 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1021565621 7:22013913-22013935 ATGTTGGCACCTTGTTCTTTTGG + Intergenic
1021589580 7:22246408-22246430 AGGTGTGCAGCTTTATTTCTAGG - Intronic
1021674337 7:23065059-23065081 AGGTGGCCAGCCTTTTCTTTAGG + Intergenic
1021854370 7:24839301-24839323 AGGTGGGCAGATTCTTTTTAAGG + Intronic
1023236016 7:38088302-38088324 ACATGGGCATTTTTTTCTTTTGG - Intergenic
1023763033 7:43484301-43484323 AGGATGGCAGGTTTGTCTTTAGG + Intronic
1024239212 7:47421082-47421104 AGGTAGCCAGTTGTTTCTTTGGG - Intronic
1024935369 7:54706633-54706655 AGGTGCGCATCTTTAACTTTGGG - Intergenic
1027554285 7:79643769-79643791 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1027765505 7:82335886-82335908 AGGTAGTCAAATTTTTCTTTTGG - Intronic
1029967682 7:104757038-104757060 AGGTGTGCAGCTTTATTTTGGGG - Intronic
1031238074 7:119201941-119201963 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1031716511 7:125115245-125115267 AACTGGGGAGCATTTTCTTTGGG + Intergenic
1032354821 7:131201016-131201038 AGGTGGCCACCTCTTTTTTTTGG + Intronic
1032598875 7:133271650-133271672 ATGTGGGCAGGCTTCTCTTTGGG + Intronic
1032672230 7:134095651-134095673 AGGTGTGCAGCTTTATTTTTGGG - Intergenic
1033725552 7:144112578-144112600 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1034999067 7:155597054-155597076 AGGTGGGGAACGTTTTGTTTTGG + Intergenic
1035481239 7:159187650-159187672 AGGTGGCCAGTCTTTTCCTTTGG - Intergenic
1036429637 8:8678292-8678314 AGGAGGGCAGTTCTTTTTTTGGG + Intergenic
1037114413 8:15206425-15206447 AGGTAGGCTGCTTTTACTCTGGG + Intronic
1037547516 8:19939281-19939303 AAGTGGGCAGCTTTCCCTTGAGG - Exonic
1037697029 8:21232452-21232474 AGGTCTGCAGATTTTTTTTTGGG - Intergenic
1037727401 8:21494426-21494448 AGGTGGGCCCCTTTTTCCTCAGG + Intergenic
1038233120 8:25724251-25724273 AGATGTGCAGCCTTATCTTTGGG + Intergenic
1038562560 8:28593057-28593079 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1038960728 8:32516216-32516238 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1039367280 8:36943311-36943333 AGGTGTGCAGCTTTATTTTTTGG - Intergenic
1040080871 8:43283652-43283674 AGGTGTGCAGCTTTATTTCTTGG + Intergenic
1042433747 8:68739934-68739956 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1042649291 8:71022144-71022166 AGGTGTGCAGCTTTAATTTTGGG + Intergenic
1042703850 8:71645950-71645972 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1043135209 8:76514559-76514581 AGGTGCGCAGCTTTATTTCTGGG - Intergenic
1043789004 8:84438893-84438915 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1044201231 8:89440571-89440593 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1044473381 8:92598466-92598488 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1045095758 8:98796324-98796346 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1045295729 8:100870397-100870419 AGGTGGGCAGCCTTTGCCTGGGG - Intergenic
1045328118 8:101132298-101132320 AGATGGGCAGCATTTTGCTTGGG - Intergenic
1045589122 8:103573528-103573550 AGGTGTGCAGCTTTGTTTTTGGG + Intronic
1045900270 8:107270343-107270365 AGCTGAGCAGATTTTTATTTTGG + Intronic
1045993119 8:108333479-108333501 AGGTGGGCACCTTAGTCCTTAGG + Intronic
1046480233 8:114807613-114807635 TGGTGGGAAGGCTTTTCTTTTGG + Intergenic
1047919096 8:129614825-129614847 AGGTTGCCAGCTTTTTCTACTGG - Intergenic
1048803999 8:138222390-138222412 TGGTGGGGAAGTTTTTCTTTGGG - Intronic
1049496684 8:142938939-142938961 AGGTGGGCAGCTGTTCCTGGGGG + Intergenic
1050153560 9:2642021-2642043 AGTTGGGTAGACTTTTCTTTGGG - Intronic
1050177939 9:2888631-2888653 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1050481591 9:6093371-6093393 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1050617917 9:7421835-7421857 AGGTGTGCAGCTTTATTTCTAGG + Intergenic
1051419451 9:16875289-16875311 GGGGGGAAAGCTTTTTCTTTTGG + Intergenic
1051886639 9:21899860-21899882 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1051942281 9:22522293-22522315 AGTTGGGCATAATTTTCTTTTGG + Intergenic
1053690166 9:40582750-40582772 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
1054301416 9:63383710-63383732 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
1054982265 9:71220808-71220830 AGTTGGTCAGCTTTTTCCTTGGG - Intronic
1056091407 9:83209047-83209069 AGTTGGGCAGCAATTTCTCTTGG + Intergenic
1056556107 9:87689245-87689267 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1056709608 9:88980096-88980118 GGGTGGGCTGCTATTTCTTGTGG + Intergenic
1057692934 9:97302589-97302611 GGGTGGGAAGCTATTTCTGTTGG + Intergenic
1057964161 9:99487295-99487317 AGGTGTCCAGCTTTCTCTTTTGG - Intergenic
1058095967 9:100860746-100860768 AGGTGTGCAGCTTTATTTTTTGG + Intergenic
1058517532 9:105791592-105791614 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1059492423 9:114680004-114680026 AGCCAGGCTGCTTTTTCTTTGGG - Intergenic
1059807513 9:117818879-117818901 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1060090621 9:120739481-120739503 TGGTTGGCAGCTTATTTTTTTGG + Intergenic
1061536787 9:131255247-131255269 AGGTGGGAAGCCATTTCTGTGGG + Intergenic
1062627581 9:137450210-137450232 AGGTGGCCACCTTGTTCTTGAGG + Exonic
1203609820 Un_KI270748v1:86403-86425 ATGTGGGCAGGATTTTATTTAGG + Intergenic
1186431676 X:9510392-9510414 AGGAGGGGGGCTTTTTCTTTAGG + Intronic
1186663908 X:11699268-11699290 AGGTCGGCAAGTTTCTCTTTTGG - Intergenic
1187384150 X:18832096-18832118 AGGTAGGCAGCTTGTTTTTAAGG - Intergenic
1187926954 X:24259241-24259263 AGCTGGGTAGTTGTTTCTTTGGG - Intergenic
1188035222 X:25310100-25310122 AGGTGTACAGCTTTATGTTTAGG + Intergenic
1188087514 X:25919009-25919031 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1188221166 X:27543293-27543315 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1189128075 X:38469062-38469084 AGGTGGGCAGGTTTCTCTGTGGG - Intronic
1190810260 X:53876389-53876411 AGGTGTGCAGCCTTATCTCTGGG + Intergenic
1191738465 X:64412198-64412220 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1192158916 X:68768500-68768522 AGCTGGTCTGCTTTTTCTTTTGG - Intergenic
1192916996 X:75662939-75662961 AGGTGTGCAGCTTTATTTCTAGG + Intergenic
1192966996 X:76187921-76187943 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1193417897 X:81246616-81246638 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1193675027 X:84439710-84439732 AGGTGTGCAGCTTTGTTTCTGGG + Intronic
1193688378 X:84607461-84607483 AGGTGTGCAGCTTTATGTCTGGG + Intergenic
1193697422 X:84725733-84725755 AGGTGTGCAGCTTTATTTTGGGG + Intergenic
1193774503 X:85625375-85625397 AGGTGTGCAGCTTTATCTCCGGG - Intergenic
1194134062 X:90116995-90117017 AGGTGGGCAGCCTTATTTCTGGG - Intergenic
1194320834 X:92443839-92443861 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1194359608 X:92933449-92933471 AGGTGTGCAGCTTTATTTCTAGG - Intergenic
1194394115 X:93359157-93359179 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1194514474 X:94834500-94834522 AGATGGCCATCTTTTTCCTTTGG + Intergenic
1194689752 X:96969034-96969056 AGGTGTGCAGCTTTATTTCTTGG + Intronic
1194767491 X:97858926-97858948 AGCTGTGCTGATTTTTCTTTTGG - Intergenic
1195103248 X:101576561-101576583 AGGTGTGCAGCTTTGTTTCTGGG + Intergenic
1195540954 X:106062322-106062344 AGGTGAGCAGCCTTTTTTCTAGG + Intergenic
1195610306 X:106859019-106859041 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1195755107 X:108192267-108192289 GGGTGAGCAGCTTTTGTTTTTGG - Intronic
1195839129 X:109153169-109153191 TGGTTGGCAGGTGTTTCTTTTGG + Intergenic
1196874162 X:120142460-120142482 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1197497264 X:127200232-127200254 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1197950157 X:131886199-131886221 AGGTGAGCAGCTTTATTTCTGGG + Intergenic
1200147504 X:153934356-153934378 AGGTGGGCAGCTTCTGAATTTGG - Exonic
1200479841 Y:3687110-3687132 AGGTGGGCAGCCTTATTTCTGGG - Intergenic
1200848260 Y:7854661-7854683 AGGTTGGCAGGTTTTGCTGTGGG + Intergenic
1201690711 Y:16761934-16761956 AGGTGTGTAGCTTTTTTTCTGGG + Intergenic
1202075623 Y:21035355-21035377 ACAAGGGCAGCTTTTTTTTTAGG + Intergenic