ID: 1096192187

View in Genome Browser
Species Human (GRCh38)
Location 12:49626997-49627019
Sequence GTGGCCCCCTACTGTTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096192182_1096192187 7 Left 1096192182 12:49626967-49626989 CCCTGAATAACTACTAGACCTAA 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1096192187 12:49626997-49627019 GTGGCCCCCTACTGTTTTGTAGG 0: 1
1: 0
2: 2
3: 4
4: 74
1096192183_1096192187 6 Left 1096192183 12:49626968-49626990 CCTGAATAACTACTAGACCTAAC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1096192187 12:49626997-49627019 GTGGCCCCCTACTGTTTTGTAGG 0: 1
1: 0
2: 2
3: 4
4: 74
1096192181_1096192187 28 Left 1096192181 12:49626946-49626968 CCAGTTCTGACATTCTATGTTCC 0: 1
1: 0
2: 0
3: 13
4: 263
Right 1096192187 12:49626997-49627019 GTGGCCCCCTACTGTTTTGTAGG 0: 1
1: 0
2: 2
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096192187 Original CRISPR GTGGCCCCCTACTGTTTTGT AGG Intronic
907468400 1:54654842-54654864 GTGCCTCCCTCCTGATTTGTAGG + Intronic
913662422 1:121016223-121016245 GTGGCCTCCGCGTGTTTTGTGGG - Intergenic
914013802 1:143799419-143799441 GTGGCCTCCGCGTGTTTTGTGGG - Intergenic
914164022 1:145161778-145161800 GTGGCCTCCGCGTGTTTTGTGGG + Intergenic
914652425 1:149708038-149708060 GTGGCCTCCGCGTGTTTTGTGGG - Intergenic
917584725 1:176414798-176414820 GTGTCCCACTATTGTTGTGTGGG + Intergenic
924383959 1:243486395-243486417 CTGGTCCCCTGCTGTCTTGTGGG + Intronic
1065940219 10:30557601-30557623 GTCCCCACCCACTGTTTTGTGGG + Intergenic
1069625976 10:69867891-69867913 CTGGGCCCCTGCTGTCTTGTTGG + Intronic
1072606225 10:96984940-96984962 CCGGCCCCCTTCTGTTTTGCAGG - Exonic
1074047033 10:109848616-109848638 GTGTCCCCCAGCTCTTTTGTTGG - Intergenic
1075786587 10:125054024-125054046 ATGGCCCTCTACTGTTTTGTGGG - Intronic
1081013286 11:37843191-37843213 ATGGCACTCTGCTGTTTTGTAGG + Intergenic
1084670257 11:70602475-70602497 GTGACCCCCTCCTGGTTTGGGGG - Intronic
1095976398 12:47943313-47943335 GTGGCTCCCTCCTGCTGTGTGGG - Intergenic
1096192187 12:49626997-49627019 GTGGCCCCCTACTGTTTTGTAGG + Intronic
1100226497 12:92561744-92561766 GTGCTGACCTACTGTTTTGTTGG + Intergenic
1102151615 12:110692315-110692337 GTGACCACCTACTGTGTGGTAGG + Intronic
1102523482 12:113494094-113494116 ATTGCCCCTTACTGCTTTGTAGG - Intergenic
1105593798 13:21817604-21817626 GTGTCCCTCTACTGTTCCGTTGG - Intergenic
1113368531 13:109701095-109701117 GTTGTCCCCTTCTGTGTTGTGGG - Intergenic
1118150445 14:63183310-63183332 ATAGCCTCCTATTGTTTTGTAGG - Intergenic
1138601474 16:58057394-58057416 GTGCCCCCCTCCTGTTATCTGGG - Intergenic
1151462319 17:74261724-74261746 GTGGCCCCATTCTGTTGTGGAGG - Exonic
1161294503 19:3512939-3512961 GTGACCCCCCATTTTTTTGTGGG + Intronic
1166422088 19:42645020-42645042 GTGGTCCCCAAATGTGTTGTGGG + Intronic
1167539692 19:50077394-50077416 GTGGACACCTACTGCTTTGAGGG - Intergenic
1167630017 19:50620476-50620498 GTGGACACCTACTGCTTTGAGGG + Intergenic
926254163 2:11175603-11175625 GAGCCTTCCTACTGTTTTGTAGG - Intronic
934103368 2:88674254-88674276 GTGGCCCCCTGCTGTATTCCTGG + Intergenic
945524900 2:210876300-210876322 GTGGCCACCCATTGTTTTTTGGG - Intergenic
947714535 2:232333070-232333092 GAGGCCGCCTGCGGTTTTGTTGG - Intronic
948600466 2:239105105-239105127 GTGGCCCCTTCCTGCTTTCTTGG + Intronic
948815077 2:240506326-240506348 GGGGCCCCCTAATGTTCTTTCGG - Intronic
1168966319 20:1900552-1900574 CAGGCCCCCTACTGCTTTGCAGG - Intronic
1169911314 20:10649866-10649888 GTGGCTTTCTGCTGTTTTGTTGG - Intronic
1170243245 20:14193378-14193400 GTGGACATCTACTGTTTTGCTGG - Intronic
1175489886 20:59372746-59372768 GTGGCACCCTTCTGCTCTGTCGG + Intergenic
1175527750 20:59647279-59647301 GTTCCCCCCTACTGTTTTCATGG - Intronic
1176868615 21:14070611-14070633 GTGGCACCCTGCTGTTGAGTGGG - Intergenic
1177864929 21:26500905-26500927 CTGTCCCACTACTGTTTTATAGG - Intronic
1180596016 22:16973897-16973919 GTGGCCCTCTGCTGTCTTGGAGG - Intronic
1182436755 22:30335753-30335775 ATGACCACCTCCTGTTTTGTAGG - Exonic
949107098 3:212622-212644 CTGGCTCCCTACTGCTTTGCAGG + Intronic
949843803 3:8350578-8350600 CTGGCCACCTGCTCTTTTGTAGG + Intergenic
951574549 3:24100429-24100451 ATGCTCCCTTACTGTTTTGTTGG + Intergenic
957946258 3:87067260-87067282 GTGGCCCTGTCCTGCTTTGTGGG + Intergenic
960278430 3:115753411-115753433 GTGGCCCACTATTATTGTGTGGG - Intergenic
960981533 3:123232548-123232570 CTGGCCCTTTACTGTTTTTTTGG - Intronic
961288818 3:125828772-125828794 CTGGCCTCCTTTTGTTTTGTTGG - Intergenic
962064635 3:131965759-131965781 GTCTCCCACTACTATTTTGTGGG - Intronic
966424817 3:179769976-179769998 GTGGCCCCCTGCTGTGTTTGTGG - Intronic
975724971 4:77283052-77283074 GTAGTCCCCTACTTTTGTGTGGG - Intronic
984055779 4:174927988-174928010 GTGGCCTTCTTCTGTTTGGTGGG + Intronic
991605709 5:68398560-68398582 GTGGCCCCCTTCTGTCTTTAAGG - Intergenic
997694906 5:135852861-135852883 GTGGCCCTTTCCTGGTTTGTGGG + Intronic
997725120 5:136113872-136113894 GGGGCCTCCTGCTGTTGTGTGGG + Intergenic
1004564437 6:16782113-16782135 GTGGCCTCCTCCTGTTTTGTAGG - Intergenic
1012648975 6:101728417-101728439 GTGGCACTCTACTGTGATGTGGG - Intronic
1012676018 6:102114555-102114577 GGGGCCCTCTACTGGCTTGTAGG - Intergenic
1013411570 6:109888396-109888418 GTGCCCCCATACTGTGATGTTGG - Intergenic
1017908242 6:158771407-158771429 GTGGCCCTGTTCTGTTTTGTAGG - Exonic
1030659566 7:112205626-112205648 GCGCCTCCCTACTGTTTTGGGGG + Intronic
1033651703 7:143348652-143348674 CTGCCCCCATACTGTTTTTTTGG - Intronic
1035393431 7:158520615-158520637 GCGGCCTTCCACTGTTTTGTGGG + Intronic
1036757963 8:11483971-11483993 ATGGCCCCCTACAGCTGTGTGGG - Intergenic
1037303369 8:17477970-17477992 GGGGCCCCCTTCTGTGTTGTGGG + Intergenic
1037669694 8:21003701-21003723 GGGGCCCCCAAAAGTTTTGTGGG - Intergenic
1040291630 8:46128475-46128497 GCGGCCCCCTTTTCTTTTGTGGG + Intergenic
1041694992 8:60726713-60726735 GTGGGCCCAGAGTGTTTTGTTGG + Intronic
1051885914 9:21892661-21892683 GTGTCCCACTATTATTTTGTGGG - Intronic
1054983850 9:71238422-71238444 GTGCCCCCCTACTTTATTTTAGG + Intronic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1059223908 9:112653606-112653628 GTGGCCTGCTTCTGTCTTGTAGG - Intronic
1187407962 X:19021545-19021567 GTGGCCAGCTAGTGTTTTGGGGG - Intronic
1187902171 X:24035339-24035361 GTGGTCCCCTGCTGGTTTGTTGG - Intergenic
1188210351 X:27416659-27416681 GTGGCCCATTTCTGCTTTGTGGG - Intergenic
1191168303 X:57415832-57415854 GTCTCCCACTACTATTTTGTGGG + Intronic
1192849886 X:74943200-74943222 GTGGCCCCCTACTGCCTTGATGG + Intergenic
1193334895 X:80276278-80276300 GTCTCCCACTATTGTTTTGTGGG - Intergenic
1199168832 X:144711391-144711413 CTGGCCTCCTTCTTTTTTGTAGG - Intergenic