ID: 1096193443

View in Genome Browser
Species Human (GRCh38)
Location 12:49634317-49634339
Sequence GTCCAGAACTGGAGGGCACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 214}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096193443_1096193450 1 Left 1096193443 12:49634317-49634339 CCCTGTGCCCTCCAGTTCTGGAC 0: 1
1: 0
2: 0
3: 14
4: 214
Right 1096193450 12:49634341-49634363 GCATCAGCCACAGCAGGAGGAGG 0: 1
1: 0
2: 5
3: 66
4: 807
1096193443_1096193448 -5 Left 1096193443 12:49634317-49634339 CCCTGTGCCCTCCAGTTCTGGAC 0: 1
1: 0
2: 0
3: 14
4: 214
Right 1096193448 12:49634335-49634357 TGGACAGCATCAGCCACAGCAGG 0: 1
1: 0
2: 0
3: 33
4: 304
1096193443_1096193451 4 Left 1096193443 12:49634317-49634339 CCCTGTGCCCTCCAGTTCTGGAC 0: 1
1: 0
2: 0
3: 14
4: 214
Right 1096193451 12:49634344-49634366 TCAGCCACAGCAGGAGGAGGAGG 0: 2
1: 1
2: 26
3: 153
4: 916
1096193443_1096193453 27 Left 1096193443 12:49634317-49634339 CCCTGTGCCCTCCAGTTCTGGAC 0: 1
1: 0
2: 0
3: 14
4: 214
Right 1096193453 12:49634367-49634389 AATCAAAGCCAGAACCAGAGAGG 0: 1
1: 0
2: 3
3: 23
4: 245
1096193443_1096193449 -2 Left 1096193443 12:49634317-49634339 CCCTGTGCCCTCCAGTTCTGGAC 0: 1
1: 0
2: 0
3: 14
4: 214
Right 1096193449 12:49634338-49634360 ACAGCATCAGCCACAGCAGGAGG 0: 1
1: 0
2: 4
3: 40
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096193443 Original CRISPR GTCCAGAACTGGAGGGCACA GGG (reversed) Exonic
900112678 1:1015148-1015170 GGCCAGCAGTGGAGGGCACCTGG + Intergenic
901343704 1:8519161-8519183 GTCCTGAACTCCTGGGCACAAGG - Intronic
902847226 1:19121258-19121280 GTCCAGAACTGGCAGCCACAGGG + Exonic
903268666 1:22174158-22174180 GTCCAGGGCTGGAGGGGGCAAGG - Intergenic
904788169 1:32998126-32998148 GCCCTGAACAGGAAGGCACAGGG + Intergenic
907388137 1:54139149-54139171 GTTCAAGACTGGAGGGGACAGGG - Exonic
908358986 1:63349117-63349139 GGCCAGAACTGGAGTGGAGAGGG + Intergenic
909932579 1:81514416-81514438 GTTCAGCACTGCAAGGCACAAGG - Intronic
910268248 1:85364248-85364270 GTACAGAATTGGAAGGCAGAAGG - Intronic
911607168 1:99919945-99919967 GACCAGAAATGGAGGGGAAAGGG - Intronic
913077001 1:115348751-115348773 GTCCAGAACTTGAGGGTAAATGG - Intergenic
913123557 1:115764706-115764728 GTCCAGCTCTGGAGGGCCCAAGG - Intronic
914817295 1:151072327-151072349 GTCTAGAACTCCAGGGCTCAAGG - Intronic
917348685 1:174055536-174055558 GTCCAGAACTGGTGGGTTCTTGG + Intergenic
918096868 1:181343282-181343304 CTCCAGCACCGGAGGTCACATGG - Intergenic
921416284 1:214891019-214891041 TTACTGAACTGGAGAGCACAGGG + Intergenic
923288375 1:232519434-232519456 CTCCAAAACTGGATGGCACATGG + Intronic
1062785888 10:264347-264369 ATTCATAACTGGAGGGTACATGG + Intergenic
1065903523 10:30228628-30228650 GTGCAGAAATGGAGGGCAAATGG - Intergenic
1067816360 10:49480320-49480342 GTCCAGTAGGGGTGGGCACAGGG - Intronic
1069510885 10:69041683-69041705 ATCCAGAACAGGAGTGCACTGGG - Intergenic
1069728399 10:70595810-70595832 GACAAGACCTGGAGGGCAAACGG + Intergenic
1072520209 10:96224289-96224311 AAGCAGCACTGGAGGGCACAGGG + Intronic
1073348139 10:102799987-102800009 GTCCAGTGCAGGAGAGCACAAGG + Intronic
1075198715 10:120383352-120383374 TTCCAGGGCTGGAGGGCACATGG + Intergenic
1076691910 10:132228121-132228143 ATGCACACCTGGAGGGCACAGGG + Exonic
1077318951 11:1932355-1932377 GGCCAGAGCAGGAGGGCACCAGG + Intronic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1078929267 11:15901048-15901070 CTCCATAGCTGGGGGGCACAAGG - Intergenic
1080845100 11:36020073-36020095 CTCCAGAACTCCGGGGCACAAGG - Intronic
1082821190 11:57545820-57545842 GACCAGCACTGCAGGACACAGGG - Intronic
1083576233 11:63793857-63793879 GACCTGAACTGCAGGGCTCAAGG - Intergenic
1083879976 11:65543542-65543564 GTCCACATCTGCAGGGCATAGGG + Exonic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1088737605 11:112740574-112740596 GAGCAGCACTGGAGGGCAAAGGG - Intergenic
1089690777 11:120185504-120185526 ATTCAGAACAGGAGGACACAAGG - Intronic
1090817336 11:130310241-130310263 GTCCAGAACTTCTGGGCTCAAGG - Intronic
1091450294 12:568699-568721 GTCCAGAAGTTGAGGACACTCGG - Intronic
1092678464 12:10949038-10949060 AGCCAGGACTGAAGGGCACAAGG - Intronic
1095864730 12:46959084-46959106 GTCCAGAACTGTGGGAGACATGG + Intergenic
1096193443 12:49634317-49634339 GTCCAGAACTGGAGGGCACAGGG - Exonic
1098178144 12:67815297-67815319 TTCCAGAAGTCAAGGGCACAGGG - Intergenic
1101193074 12:102354709-102354731 GTCCTGAACAGGAGGGCCCTGGG + Intergenic
1102004728 12:109581851-109581873 GTCCAGATCTAGAGGGCAGCAGG + Intronic
1102341510 12:112125652-112125674 TTCCTAAACTGGAGGCCACAGGG - Exonic
1102475553 12:113185948-113185970 GTCCAGACCTGGTGGGAAGAAGG + Exonic
1104319112 12:127733615-127733637 GTCTAGCACTGATGGGCACATGG - Intergenic
1104719094 12:131034739-131034761 CTCCAGAGCTGGGGGACACATGG - Intronic
1106840809 13:33683218-33683240 GTCCAGAATTGGTGGGCTCTTGG - Intergenic
1108522295 13:51257459-51257481 GTCTAGATCTGGAGTGTACAGGG - Intronic
1108762768 13:53589813-53589835 GTCCAGAACTGCTGGTCATATGG + Intergenic
1109428694 13:62202490-62202512 TTCCAGAACTAAAGGTCACATGG + Intergenic
1110261288 13:73487975-73487997 GTCCAAGACTTGAAGGCACAAGG + Intergenic
1115317002 14:32035433-32035455 GTACAGAACTGGAGGGTGGAGGG + Intergenic
1116790636 14:49336213-49336235 GTCCAGAACTGGGGGTTAGAAGG - Intergenic
1117475446 14:56090099-56090121 GTCATGTACTGGAGGCCACAGGG + Intergenic
1118790917 14:69091880-69091902 GGAGAGAACTGGAAGGCACAAGG + Exonic
1119191775 14:72687957-72687979 GTTCAGGACTCAAGGGCACAGGG - Intronic
1120030211 14:79632316-79632338 GTCCAGAATTGGTGGGCTCTTGG - Intronic
1122021431 14:98840881-98840903 TTCCAGAGCTGATGGGCACATGG - Intergenic
1128419227 15:67475777-67475799 CTCCAGATCTGTAGGGCCCATGG + Exonic
1128449878 15:67799330-67799352 GTCCTGCACTTGAGGGCACAGGG - Intronic
1128534958 15:68483451-68483473 TTCCAGTACTGGAGGTCTCAAGG + Intergenic
1130904442 15:88229930-88229952 GTACAGAACTGGGTAGCACAGGG + Intronic
1131543729 15:93298379-93298401 GGCCACAACTCTAGGGCACAAGG + Intergenic
1133639434 16:7702615-7702637 GACCAGAAGGGGAGGGCGCATGG - Intronic
1136550737 16:30981046-30981068 TTCCGGAACTGGGGGGCAGAAGG - Exonic
1137761156 16:50941376-50941398 GTCCAGATCTGGTGAGCAGATGG - Intergenic
1138054138 16:53814700-53814722 GTGGAGAGCTGGAGGTCACAGGG - Intronic
1139036251 16:62950157-62950179 GTACAGAACTGGAAGCCATATGG - Intergenic
1141171732 16:81695983-81696005 GTCAAGAAAGGGAGGGCAGAAGG + Intronic
1142178348 16:88655410-88655432 GCCCGGAACTGCAAGGCACAGGG + Exonic
1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG + Intronic
1142708822 17:1712527-1712549 GACCAGGCCTGGAGAGCACAGGG - Intergenic
1142974489 17:3635654-3635676 ATCCTGAACTTGAGGTCACAGGG + Intronic
1142975094 17:3638740-3638762 ATCCTGAACTTGAGGCCACAGGG + Intronic
1144456549 17:15423447-15423469 GTGCTGAAATGGAGGGCACGTGG + Intergenic
1145323665 17:21781827-21781849 GAACAGAACTGCAGGGCACTGGG + Intergenic
1145746844 17:27326215-27326237 CTCCAGACCTGGAGGGCAGGCGG + Intergenic
1146679596 17:34797498-34797520 ATCCAGAATTGTAGGACACAGGG - Intergenic
1147056261 17:37837608-37837630 GTCCAGAACAGGAGAACCCATGG - Intergenic
1147428368 17:40356909-40356931 GAGGAGAACTGGGGGGCACAGGG - Intronic
1147636514 17:41967433-41967455 GTCCAGAACAGGGCAGCACAGGG - Intronic
1147953159 17:44118183-44118205 TTCCAGAGCTGGGTGGCACAAGG - Intronic
1148105635 17:45117320-45117342 GCCCAGGACTGGAGAACACAGGG - Intronic
1150440306 17:65185954-65185976 GGCCAGAACATGGGGGCACAGGG - Intronic
1150772447 17:68053055-68053077 GTCCAGAACTGGTGGGTTCCTGG - Intergenic
1150778461 17:68100590-68100612 GTCCAGAATTGGTGGGCTCTTGG - Intergenic
1151289107 17:73136063-73136085 GTCCAAATCTGGAAGACACATGG - Intergenic
1154165481 18:12011357-12011379 GCCCAGCACTGGTGGGCACAGGG - Intronic
1155903623 18:31422868-31422890 GTCCATCACTGATGGGCACATGG - Intergenic
1156481381 18:37438594-37438616 CTCCAGACCTGGAAGGCACCAGG - Intronic
1156697924 18:39790036-39790058 GTCCCCAACTGGTGGGCATATGG - Intergenic
1157323734 18:46654442-46654464 TTCCAGAACTGGAGAGTAGAAGG - Intronic
1158455869 18:57607138-57607160 GTCCAGAACACGAAGGCACCTGG - Exonic
1158626686 18:59077688-59077710 TTGCACAACTGGAGGGAACAAGG - Intergenic
1158675897 18:59517927-59517949 GTCCAGAATTGTTGGGCACAGGG + Intronic
1159833887 18:73312416-73312438 GTCAAGGACTGGAGAGCCCAGGG + Intergenic
1160740051 19:681427-681449 GGCCGGGGCTGGAGGGCACAGGG - Exonic
1161614278 19:5261252-5261274 GTCCAGACTAGGAGGGGACAAGG + Intronic
1161737596 19:6001239-6001261 TCTCAGAACTGAAGGGCACAAGG - Intronic
1161962572 19:7530643-7530665 GTTCAGAACTGGGGGGCGCAGGG + Intronic
1162115163 19:8424786-8424808 CTCCAGAACTGTCGGCCACAAGG - Intronic
1162139723 19:8578483-8578505 GTGCAGAAGTGGAGGGTACTGGG + Intergenic
1165393953 19:35553874-35553896 GACCCGAAGTGGAGGGGACAAGG - Intronic
1165422672 19:35730129-35730151 GGCCAGAACTGTGGGGTACACGG + Intronic
1165658073 19:37550837-37550859 GTCCAGAAAAGGCGGGAACAAGG - Intergenic
1166782358 19:45349222-45349244 GTCCAGAAACGTGGGGCACAGGG - Intronic
925275373 2:2644863-2644885 GCCCAGAGGTGGAGGGGACATGG - Intergenic
925551977 2:5086374-5086396 CTCCAGAACTGGAGGCAGCATGG + Intergenic
925987408 2:9227295-9227317 GTCAGGCACTGCAGGGCACAGGG - Intronic
926119149 2:10232150-10232172 TTCCAGAGCTGCACGGCACAGGG - Intergenic
926830590 2:16957936-16957958 GTCCAAAACTGGGGAGCCCAGGG - Intergenic
927500386 2:23579018-23579040 GTCCAGGACTGGCGGGGGCACGG - Intronic
928333937 2:30379700-30379722 GGCCAGAAGTGGAGGGGATAAGG - Intergenic
929996174 2:46827640-46827662 GTCCAGACCTGGCGGGGGCAGGG - Intronic
930822295 2:55658664-55658686 GTCATGAGCTGGAGAGCACATGG - Intronic
942867441 2:180692400-180692422 GTCCAGAACTGGTGGGTTCTTGG - Intergenic
943969649 2:194386814-194386836 GGCAAGAACTGGAGTGCTCAAGG - Intergenic
948387118 2:237587640-237587662 GTCCAGAACAGGAGGGTTTAGGG + Intronic
1171230915 20:23484287-23484309 GACAGGAACTGGAGGCCACAGGG - Intergenic
1171493579 20:25538784-25538806 GCACAGAACTGGGGAGCACAGGG + Intronic
1171493585 20:25538815-25538837 GCACAGAACTGGGGAGCACAAGG + Intronic
1172019830 20:31906265-31906287 GTCCAGATCTGGAGGTCACCTGG + Intronic
1173001971 20:39111381-39111403 CTCCAGAGCTGGAGGGGCCATGG + Intergenic
1173126195 20:40338376-40338398 CTCCAGATCTGTAGGGCATAAGG - Intergenic
1175055660 20:56195332-56195354 GTCCAGATCTGAAGGCCTCAGGG + Intergenic
1175707965 20:61195092-61195114 GTCCAGTCCTGCAGGACACATGG - Intergenic
1175900756 20:62359056-62359078 GCCCAGAGCTGCAGGGCAAATGG - Intronic
1177182219 21:17756729-17756751 GTCCAGAACTGGTGGGTTCTTGG + Intergenic
1177387021 21:20421858-20421880 ATTCAAAATTGGAGGGCACATGG - Intergenic
1178482154 21:32989076-32989098 GACCAGAACCGGAGGTTACATGG + Intergenic
1178790261 21:35693264-35693286 GGCCAGATTTGGAGGGGACAGGG - Intronic
1179263103 21:39775944-39775966 GCCCAGAACAGGAAGCCACAGGG - Intronic
1180616779 22:17133606-17133628 CTGCAGAACTGGAGGTCAGAAGG + Intergenic
1180684935 22:17658652-17658674 GCCCAGAGCTGGAGTGCAAATGG - Intronic
1182151659 22:28031421-28031443 GTGAAGAAGTGGAGGGCACCAGG + Intronic
1182430673 22:30297179-30297201 GTTCAGGGCTGGAGGGGACAGGG + Intronic
1182740847 22:32566396-32566418 GGTCAGAACCGTAGGGCACATGG + Intronic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1183948305 22:41339058-41339080 GTCCAGAACGTGAGGGAACAGGG - Exonic
1184584397 22:45437613-45437635 GTCCAGAACTGGTGGGTTCTTGG - Intergenic
950442439 3:13018022-13018044 GTCCAGAGCTGGGGAGCAGATGG + Intronic
953289738 3:41649432-41649454 TTCCAGGCCTGGAGAGCACAGGG - Intronic
953475440 3:43202016-43202038 GTCCAAAAGTGGAGGGCATCCGG + Intergenic
954224631 3:49173915-49173937 GGTCAGACCTGGAGGCCACAAGG - Intronic
954972588 3:54663751-54663773 TTCCAGGACTGGTGTGCACATGG - Intronic
957446292 3:80315676-80315698 GTCCAGAATTGGTGGGCTCTTGG - Intergenic
958531042 3:95330378-95330400 GGCCAGAACTGGGGGGCAAGTGG - Intergenic
959022563 3:101204383-101204405 TTCCAGAACAGGGGAGCACATGG - Intergenic
964299103 3:155268174-155268196 GTCTAGAAGTGGAGAGCAAATGG - Intergenic
966151213 3:176869239-176869261 GTCCCGAAATGGTGGCCACAGGG + Intergenic
968901877 4:3435839-3435861 GGCCAGTCCTGGAGGGAACATGG - Intronic
968998804 4:3963867-3963889 GTCCAGAACTGGTGGGTTCTTGG + Intergenic
969097930 4:4748097-4748119 GGCAAGAACTGGAGGGATCATGG - Intergenic
969660755 4:8526040-8526062 GTCCAGGAGTGGAGGGCATGTGG - Intergenic
970570335 4:17374874-17374896 GCCTAGAACTGGAGTCCACAGGG + Intergenic
970576951 4:17437126-17437148 TGGAAGAACTGGAGGGCACATGG + Intergenic
972207077 4:36786782-36786804 GTCCATAACTGACTGGCACAGGG + Intergenic
977039619 4:92000544-92000566 GTCTTCAACAGGAGGGCACAAGG - Intergenic
977391636 4:96416978-96417000 GTTCAGAACTGGGTGGCACATGG - Intergenic
981185941 4:141803412-141803434 AGCCAGGACTGGAGGCCACATGG + Intergenic
981983555 4:150826741-150826763 CTCTAGAACAGGAGGTCACAAGG + Intronic
984083524 4:175280072-175280094 GTCCACAAATGGATGGCAAAGGG + Intergenic
986052702 5:4104930-4104952 ACCAAGAACTGGAGGGGACAAGG - Intergenic
987215987 5:15737857-15737879 GTCCAGAACTGATGGGTACCAGG - Intronic
988605836 5:32677664-32677686 GTCCAGAACTGGTGGGTTCTTGG + Intergenic
988866311 5:35338907-35338929 GTCCAGAACTGGTGGGCTCTGGG - Intergenic
989712605 5:44418039-44418061 CTCCAGAAATGGTGGGCAAATGG - Intergenic
990869640 5:60416705-60416727 GTCCAGAATTGGTGGGCTCTTGG - Intronic
995707469 5:115000081-115000103 GTCCAGAACTGGTGGGTTCTTGG - Intergenic
998001770 5:138631219-138631241 GCCCAGGGCTGGAGAGCACAAGG + Intronic
999095341 5:148973065-148973087 CACCAGTTCTGGAGGGCACAGGG - Intronic
1001813893 5:174651544-174651566 GGCTAGAATTGGAGGGTACAAGG - Intergenic
1002603817 5:180370379-180370401 ATCCAGCCCTGGAGGGCACCAGG + Intergenic
1003577610 6:7312721-7312743 GGCCAGAACTGGAGGGTCCTCGG - Intronic
1004129516 6:12905496-12905518 GTCCAGAACTGAGGGTGACACGG + Intronic
1005947276 6:30603562-30603584 GGCCAGAACTGGAGGCAACTTGG + Exonic
1006475546 6:34250359-34250381 ATCCAGAGCTGGAGGACACGAGG - Intergenic
1006748678 6:36363138-36363160 GTCCAGAACTGGTGGGTTCTTGG + Intronic
1008822454 6:55650531-55650553 CTCCAGTACTGGTGGCCACAAGG - Intergenic
1009805629 6:68598470-68598492 GCAAAGAACTGCAGGGCACAGGG + Intergenic
1010705037 6:79098064-79098086 GTACAGAACTGGAGGACTCCAGG - Intergenic
1012526411 6:100183227-100183249 GTACAAAATTGGAGGGGACAGGG - Intergenic
1012969157 6:105708000-105708022 TTCCACAACATGAGGGCACAGGG + Intergenic
1018842081 6:167524546-167524568 TTTCAGAAATGGAGGGGACAGGG - Intergenic
1019685627 7:2380342-2380364 GTCCAGAGCCAGAGAGCACAGGG - Exonic
1023106785 7:36770644-36770666 GCCCAGAACAAGAGGGCTCATGG - Intergenic
1023130379 7:36997159-36997181 GTCCATAAGTGAAAGGCACAGGG + Intronic
1023909077 7:44541156-44541178 GTCCCTAACTGGAGGCCGCAGGG + Intronic
1024795810 7:53018070-53018092 GTCCAGAATTGGTGGGCTCTTGG - Intergenic
1025003780 7:55339796-55339818 GCCCAGAAGGGGAGGGCAGAGGG + Intergenic
1027055761 7:75048382-75048404 GTCCTGACCTGCAGGGCCCACGG + Intronic
1027214328 7:76174117-76174139 GACCAGAACTGGAGGTCAGGGGG - Intergenic
1028916610 7:96266428-96266450 GGCCATAACTGGAGGGAAAAGGG - Intronic
1029124393 7:98286616-98286638 CCCCAGCACTGGAGGGCAGAAGG - Intronic
1029160748 7:98549623-98549645 GTCCAGACCTGGTGAGGACAGGG - Intergenic
1033260624 7:139840929-139840951 GTCCAGATCGGGAAGGCACTCGG - Intronic
1034442326 7:151092230-151092252 GCCCAGAAGTGGAGGGAACGAGG + Intronic
1034683841 7:152952305-152952327 GTGCAGAACTGGACAGAACAAGG - Intergenic
1035432349 7:158831458-158831480 GTCAACCACTGGATGGCACATGG - Intergenic
1037966248 8:23135929-23135951 ATCCAGAAGTGCAGGGGACAAGG + Exonic
1038436232 8:27538778-27538800 GTTCAGAGCTGGAGAGCTCAGGG - Intronic
1039004493 8:33018918-33018940 GTACAAAACTGGAGGACTCATGG - Intergenic
1040577353 8:48665412-48665434 CTCCAGAACTGTATGTCACAGGG - Intergenic
1045393267 8:101736003-101736025 GCCCAGATGTGTAGGGCACAAGG - Intronic
1049298129 8:141854750-141854772 AGCCAGAGCTGGAGGGCACTTGG + Intergenic
1050140196 9:2509910-2509932 GGGCAGAAGTGGAGGTCACAAGG - Intergenic
1057322483 9:94027373-94027395 GCCAATAACTTGAGGGCACATGG + Intergenic
1059716545 9:116918317-116918339 GACTAGCAGTGGAGGGCACAGGG + Intronic
1062055329 9:134467043-134467065 GTGCAGACCTGGAGTGGACAAGG - Intergenic
1189294847 X:39910849-39910871 GTGCAGAGCTGCAGGGAACAGGG + Intergenic
1192682510 X:73266855-73266877 GGCCAGAACTGGGAGGCAAATGG + Intergenic
1194166507 X:90522492-90522514 GTCCAGAATTGGTGGGCTCTTGG - Intergenic
1195168503 X:102244198-102244220 GGCCAGAACTGGAGGTCTCTAGG - Intergenic
1195190354 X:102442889-102442911 GGCCAGAACTGGAGGTCTCTAGG + Intronic
1197721849 X:129750668-129750690 CTCAAGAATTGGTGGGCACATGG - Intronic
1198047211 X:132914677-132914699 GCCCTGACCTGGGGGGCACAAGG + Intronic
1198391156 X:136175788-136175810 GACAAGAACTAGAAGGCACAAGG + Intronic
1198933079 X:141880397-141880419 GTCCAGAACTGTGGGGCTCTGGG + Intronic
1198935067 X:141896070-141896092 GTCCAGAACTGTGGGGCTCTGGG + Intronic
1199170105 X:144725779-144725801 GGCCAGAACTGAAGGGCAAGTGG + Intergenic
1199929809 X:152506700-152506722 GTACAGAACAGGGGGGCCCAGGG + Intergenic
1200512776 Y:4100273-4100295 GTCCAGAATTGGTGGGCTCTTGG - Intergenic
1200760756 Y:7036738-7036760 GTCCAGACCTGGAAGTCAAATGG + Intronic
1202266628 Y:23026256-23026278 GTCCAGGACAGCAGGGCAGAAGG - Intergenic
1202419621 Y:24659999-24660021 GTCCAGGACAGCAGGGCAGAAGG - Intergenic
1202451165 Y:25010085-25010107 GTCCAGGACAGCAGGGCAGAAGG + Intergenic