ID: 1096200887

View in Genome Browser
Species Human (GRCh38)
Location 12:49681965-49681987
Sequence CAGGAGAAAGACCCTGTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096200882_1096200887 20 Left 1096200882 12:49681922-49681944 CCTCTTAAAAATGAATAAAAGGG 0: 1
1: 0
2: 7
3: 79
4: 599
Right 1096200887 12:49681965-49681987 CAGGAGAAAGACCCTGTAAGTGG 0: 1
1: 0
2: 2
3: 24
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096200887 Original CRISPR CAGGAGAAAGACCCTGTAAG TGG Intronic
901609393 1:10485167-10485189 CTGGGGAAATAACCTGTAAGTGG + Intronic
904682478 1:32239206-32239228 AAGAAGAAAGACCCTGCATGTGG - Intergenic
905452622 1:38066381-38066403 CAGCAGGAAGACCAAGTAAGAGG - Intergenic
905615419 1:39394319-39394341 CATGAGAAAAGCCCTGGAAGAGG + Intronic
912548107 1:110465734-110465756 CAGAGGAAAGAGCCTGTGAGGGG + Intergenic
912696172 1:111843751-111843773 CAGCAGTAACACCGTGTAAGGGG - Intronic
913248167 1:116888490-116888512 CAGGACACAGCACCTGTAAGTGG + Intergenic
913328081 1:117645136-117645158 CTTGAGAAAGACCATGTAACTGG + Intergenic
915885803 1:159719323-159719345 CAGGAGAGAGACAGTGTGAGTGG - Intergenic
915922613 1:159988028-159988050 CAGGTGAAAGACCTTGAAAGAGG + Intergenic
919422327 1:197385478-197385500 GAGGAGAAAGACTCTGGAGGAGG - Intronic
920001596 1:202803874-202803896 CAGGAGAAAAACCTGGTAGGAGG - Intronic
920272101 1:204773396-204773418 CAGGAGATTGCCACTGTAAGAGG + Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
923128819 1:231057187-231057209 CAGGAGAGAGACACAGTGAGGGG + Intergenic
923373037 1:233331394-233331416 CAGGATAAAGACCATGTATGAGG - Intronic
1063725526 10:8633360-8633382 AAGGAGAATGATCCAGTAAGGGG + Intergenic
1064602588 10:17008579-17008601 TAGAAGAAAGACCCTGTGATAGG - Intronic
1064608521 10:17071519-17071541 CTGGAGAAAGAACCTGTAGGTGG - Exonic
1064747427 10:18491566-18491588 CAACAGAAAGACCCTGTCTGGGG + Intronic
1065280522 10:24133092-24133114 CAGGAGAGAAAACCTTTAAGTGG + Intronic
1067184078 10:44012377-44012399 CAGAAGAAAGACACTGCAACTGG - Intergenic
1067628820 10:47944894-47944916 CAGGAGAAGGAACCTGTACAAGG - Intergenic
1069869368 10:71523868-71523890 CAGGGGAAAGAATCTTTAAGGGG - Intronic
1069877806 10:71573906-71573928 CAGGAGAGAGGCTCTGCAAGAGG - Intronic
1070439514 10:76429705-76429727 CAGAAGAAAGACACTGTGAAAGG - Intronic
1071107998 10:82121203-82121225 CAGGAGCAAGAGGGTGTAAGAGG - Intronic
1074101118 10:110355609-110355631 CATAAGAAAGACCCTCTGAGGGG + Intergenic
1076762156 10:132611251-132611273 CAGGGGAGAGGCCCTGTCAGAGG + Intronic
1076762170 10:132611296-132611318 CAGGGGAGAGGCCCTGTCAGAGG + Intronic
1076762271 10:132611610-132611632 CAGGGGAGAGGCCCTGTCAGGGG + Intronic
1076762288 10:132611655-132611677 CAGGGGAGAGGCCCTGTCAGGGG + Intronic
1076762379 10:132611925-132611947 CAGGGGAGAGGCCCTGTCAGAGG + Intronic
1076762394 10:132611970-132611992 CAGGGGAGAGGCCCTGTCAGAGG + Intronic
1077648074 11:3944220-3944242 CAGGGGAAACACCCTGTAAAAGG - Intronic
1078024468 11:7681525-7681547 CAGGAATAGGACCCTGCAAGCGG - Intergenic
1080186619 11:29495035-29495057 AAGGAAAAAGATCCTGAAAGAGG + Intergenic
1080276790 11:30512221-30512243 AAGTAGAATGACCCTGGAAGGGG - Intronic
1080846547 11:36032042-36032064 CAGGAAAGAGACCATGTAAGAGG - Intronic
1082772809 11:57221734-57221756 AAGGAGAAAGAGCCTGAAAGAGG - Intergenic
1083629550 11:64088552-64088574 CAGGAGAAACACACTGTAAAGGG - Intronic
1083730053 11:64648032-64648054 CAGGAGAAAGACCCTATGAGGGG + Intronic
1084340839 11:68499464-68499486 CAAGAGAAAGAGCCCCTAAGTGG + Intronic
1084501927 11:69540167-69540189 AAGGACAAAGACCCTGGGAGAGG + Intergenic
1085118616 11:73952181-73952203 AAGGAGAGAGACCCTTTAGGAGG + Intronic
1087873767 11:103331284-103331306 ATGGAGAAAAAGCCTGTAAGGGG - Intronic
1090190751 11:124765669-124765691 CAAGAGTACGAACCTGTAAGTGG + Intergenic
1091001527 11:131913831-131913853 CAAGAGAAAGGCCCTGACAGTGG + Intronic
1091019215 11:132083596-132083618 CAGGTGAGGAACCCTGTAAGGGG + Intronic
1096200887 12:49681965-49681987 CAGGAGAAAGACCCTGTAAGTGG + Intronic
1096458037 12:51803540-51803562 CAGTAGAAACACCATTTAAGGGG - Intronic
1096586892 12:52628739-52628761 CAGAAGAAAGCCCCTCTCAGTGG - Intergenic
1096742180 12:53701991-53702013 CAGGAGACAAACCCAGAAAGTGG - Intergenic
1098051918 12:66463101-66463123 AAGGAGAAATACTCGGTAAGAGG + Intronic
1098799737 12:74939958-74939980 CAGCAGACGGACCCTGTGAGGGG - Intergenic
1099649332 12:85404469-85404491 CAGAAGAAAGACCAAGTAATAGG - Intergenic
1100900595 12:99236444-99236466 CAGGAGAGAGACACAGTAAAGGG + Intronic
1101322153 12:103682083-103682105 GAGGAGACAGATACTGTAAGAGG - Intronic
1103734987 12:123055228-123055250 CAGGAGAAAGACGCTGCAGCTGG + Intronic
1104519612 12:129461267-129461289 CAGGAGAAGGACCCAGAAAGGGG + Intronic
1105061505 12:133155724-133155746 CAGGAGAGAGTCTCTGAAAGTGG + Exonic
1106862009 13:33920068-33920090 CAGGAGTGAGTCCCTGTGAGAGG - Intronic
1108940020 13:55941235-55941257 CAGGAAAAAGACCTGGGAAGGGG - Intergenic
1111524666 13:89452633-89452655 CAGGAGAAAGCCCTTTAAAGAGG - Intergenic
1113500067 13:110766232-110766254 CAGGAGCAAGAAAATGTAAGTGG + Intergenic
1113563149 13:111299773-111299795 CAGAAGAAAGACCCAGCAAGCGG + Intronic
1115899148 14:38125708-38125730 CAGGAGACAGCTCCTGTCAGAGG - Intergenic
1116811944 14:49547662-49547684 CAGGAGAATGGCCCGGGAAGCGG + Intergenic
1118953379 14:70455956-70455978 CTCTATAAAGACCCTGTAAGGGG - Intronic
1120355576 14:83429052-83429074 CAGGACAAAGGCCATGTGAGTGG - Intergenic
1120936928 14:89905812-89905834 CAGCAGAAAGACACTGAATGAGG + Intronic
1121731295 14:96189037-96189059 CAGGAGAGAGAGCGTGAAAGTGG + Intergenic
1122290403 14:100677764-100677786 CTGGAGGAAGTGCCTGTAAGCGG + Intergenic
1123147293 14:106144815-106144837 CAAGAGAAAAATCCTGTTAGTGG + Intergenic
1133325622 16:4940573-4940595 GGGGAGAAAGACCCTGGGAGAGG + Intronic
1134408250 16:13981626-13981648 CAGGAAAGAGGCCCTGAAAGCGG - Intergenic
1136691636 16:32036250-32036272 CAAGAGAAAAATCCTGTTAGTGG - Intergenic
1136792225 16:32979813-32979835 CAAGAGAAAAATCCTGTTAGTGG - Intergenic
1136877592 16:33874095-33874117 CAAGAGAAAAATCCTGTTAGTGG + Intergenic
1137357740 16:47782809-47782831 CAGGAGATACAGCCTGTGAGAGG - Intergenic
1137918319 16:52456910-52456932 CAGGAGAAAGACTCAGTTTGGGG - Intronic
1137957114 16:52842875-52842897 CAGGAGCAAGGACCTGAAAGGGG - Intergenic
1139781040 16:69351668-69351690 CAGAAGACAGAACCTCTAAGTGG - Exonic
1140678824 16:77363794-77363816 CTGGAACAAGAACCTGTAAGTGG - Exonic
1203094431 16_KI270728v1_random:1241277-1241299 CAAGAGAAAAATCCTGTTAGTGG - Intergenic
1142837276 17:2595972-2595994 CAAGAGAAAGACGCTGTGAAAGG - Intronic
1143796173 17:9338567-9338589 CATGACAAAGACCATGTGAGTGG - Intronic
1144495742 17:15743595-15743617 CAGGAGGAAGACCAGGTAGGAGG - Intronic
1144614818 17:16759280-16759302 CAGGATAAAGTCACTGTAAATGG - Intronic
1144897886 17:18556394-18556416 CAGGATAAAGTCACTGTAAATGG + Intergenic
1145134487 17:20389320-20389342 CAGGATAAAGTCACTGTAAGTGG - Intergenic
1146141408 17:30371217-30371239 CAGTAGGATGACCCTGGAAGAGG + Intergenic
1148469027 17:47882138-47882160 CAGGAGAAAACCCCTCTATGAGG + Intergenic
1148694358 17:49550110-49550132 CAGGAGACAGACCCTCTCTGAGG - Intergenic
1149129590 17:53282063-53282085 CAGGATAAAGTCCATGGAAGTGG + Intergenic
1152012692 17:77728089-77728111 CAGGAGATCGACCCTGGACGGGG + Intergenic
1152497889 17:80687255-80687277 CAGGAGAAAGAAACAGGAAGAGG - Intronic
1153735881 18:8066752-8066774 CAGGAGACAGAGGCTGTATGAGG - Intronic
1154293177 18:13128284-13128306 CAGAAACAAGACCGTGTAAGAGG + Intergenic
1155661393 18:28253208-28253230 CAGGAGAAAGAGAGTGAAAGGGG - Intergenic
1157314218 18:46574932-46574954 CAGGAGAAGGAGCCTGGAAAGGG - Intronic
1157322581 18:46645942-46645964 CAGGAGAAACACCATGAAAGAGG + Intronic
1158626359 18:59075131-59075153 CAGGGGAAAGACCCAGTGGGAGG + Intergenic
1159327649 18:66944134-66944156 AAGAAGAGAGCCCCTGTAAGAGG - Intergenic
1160391658 18:78538730-78538752 CCGGGGTATGACCCTGTAAGGGG - Intergenic
1161093577 19:2375941-2375963 CAGGAGGAACACCCTGCAAATGG - Intergenic
1161146787 19:2683721-2683743 CAAGAGAGAGACCCTGGAGGAGG + Intronic
1162934577 19:13975273-13975295 CAGGAGAACCACCCTGAAGGTGG + Intronic
1164951249 19:32338842-32338864 CAGGAGAGAGACAGAGTAAGGGG - Intergenic
926273459 2:11385670-11385692 TAGGAGAAAGAGCATGTAGGAGG - Intergenic
929921301 2:46173557-46173579 CAGGAGCAAGAGCCAGGAAGGGG + Intronic
930436807 2:51354568-51354590 CATGGGAGAGACCCTGTGAGAGG + Intergenic
931940136 2:67242954-67242976 TAGGAGAAAGACCATGGAACTGG - Intergenic
935805055 2:106737420-106737442 CAGGGGAAGGACCCAGTAGGAGG + Intergenic
936924620 2:117723612-117723634 CAGGAGAAAGGCAGTGAAAGAGG + Intergenic
937637767 2:124176102-124176124 GAGGAGAAAGATCCTGGAAATGG - Intronic
937688599 2:124726281-124726303 CAAGAGAAGGACCTGGTAAGAGG + Intronic
937909892 2:127070389-127070411 CAGGAGAAAGGCCCTCAGAGAGG + Intronic
938804056 2:134789571-134789593 CAGGAGGATGATCCTGCAAGGGG + Intergenic
939249653 2:139667457-139667479 CAGAAGAAAGACCCACTAATTGG - Intergenic
939882552 2:147646744-147646766 CAGGAGAAATCCTCTGTAAAAGG - Intergenic
940714636 2:157206162-157206184 CAGGAGAAAGACACAATAACTGG - Intergenic
947639617 2:231699643-231699665 CAGGAGAAAGATGCTGGAAGGGG + Intergenic
948470359 2:238173514-238173536 CAGGTAAAAGGCCCTATAAGAGG - Exonic
948644985 2:239398870-239398892 CAGGAGAAAGAACCCTAAAGAGG + Intronic
1172067315 20:32230746-32230768 CAGAAGCAAGACCTGGTAAGTGG - Intronic
1172436200 20:34930559-34930581 AAGCAGAAAGACCGTGGAAGAGG - Intronic
1172652632 20:36514892-36514914 CAGGAGAAAGGCCATGTCTGAGG + Intronic
1173406914 20:42774370-42774392 CTGGAGAGAGACTCTGAAAGGGG + Intronic
1173910599 20:46666998-46667020 CAAGAGAAAGACCCAGGAAGGGG + Intronic
1175545659 20:59776176-59776198 CACAAGAAACACCCGGTAAGGGG - Intronic
1177024416 21:15904643-15904665 CCGGTGAAAGACACTGGAAGTGG + Intergenic
1178135585 21:29623314-29623336 CATGGGAAGGACCCTGTGAGAGG - Intronic
1178575692 21:33787727-33787749 AAGGAGAAAGACTCAGAAAGAGG + Intronic
1178668860 21:34572849-34572871 CAGGAGAGAGACAGTGAAAGGGG + Intronic
1180952956 22:19728961-19728983 CAGGACAAAGGCCATGTCAGTGG - Intergenic
1182117976 22:27768304-27768326 CAGGGCTCAGACCCTGTAAGTGG - Intronic
1184480936 22:44746610-44746632 CAGAAGAAAGAACTTGAAAGGGG + Intronic
1184745225 22:46452210-46452232 CAGGAGATTGACCCTGGAAGAGG - Intronic
949239503 3:1853062-1853084 TAGGAGAAAAACTCTGAAAGAGG - Intergenic
949448752 3:4163498-4163520 TAGAAGAAAGATCCTGTAATAGG - Intronic
949972359 3:9419126-9419148 GGGGAGAAAAATCCTGTAAGTGG - Intronic
953584281 3:44185740-44185762 CAGGACAATCAGCCTGTAAGAGG + Intergenic
953703368 3:45213508-45213530 CAGGAGAGAGACTCTTTGAGGGG + Intergenic
955105443 3:55893289-55893311 AAGGAGAAAGACCCAGTTATGGG - Intronic
955892287 3:63662704-63662726 GAGGAGAAACAGCCTATAAGAGG + Intronic
957294142 3:78314511-78314533 TCTGAGAAAGACCCTGTAATTGG - Intergenic
958094057 3:88918744-88918766 GAGGAGACAGACCCAGTAGGTGG - Intergenic
961425922 3:126847777-126847799 AAGGAGAAAGACACTGGTAGGGG - Intronic
961561854 3:127735864-127735886 CAGGAGAAAATCCTTGTAAGTGG - Intronic
961765008 3:129203221-129203243 CAGGAGCAAGACAGTGTAGGGGG - Intergenic
963407801 3:144889858-144889880 CAGGAAATAGACCATGTAAAGGG - Intergenic
963440802 3:145336932-145336954 CAGGAGAAAGGCCATATGAGAGG + Intergenic
964154351 3:153565795-153565817 AAGGAAATATACCCTGTAAGTGG - Intergenic
966191594 3:177276790-177276812 CAGGAGACACAACCAGTAAGAGG - Intergenic
967626629 3:191693677-191693699 CAGAAGAAAGCCCCTTTCAGGGG + Intergenic
967979199 3:195055377-195055399 CAGGAGAAAGCCCAGGTAGGGGG - Intergenic
969624262 4:8294383-8294405 CAGGGGGAAGATCCTGAAAGAGG - Intronic
969693750 4:8723564-8723586 CAGGAGACAGACACTGCCAGGGG + Intergenic
970758320 4:19452410-19452432 CATGAGAAGGACCCAGTGAGAGG - Intergenic
971969038 4:33598275-33598297 CAGGCCAGAAACCCTGTAAGGGG - Intergenic
974166634 4:58212958-58212980 CAGGTCAAAGACCCTGACAGAGG - Intergenic
977859586 4:101940716-101940738 GAGGAGAAAGACCATGGAGGTGG + Intronic
979385726 4:120063662-120063684 CAGGATAAAGACCCTGAAAAAGG + Intronic
979500717 4:121436892-121436914 CAGGAGAAATACGGTGTATGTGG + Intergenic
979846287 4:125516723-125516745 CAGGAGAGGGACCCAGTGAGAGG - Intergenic
984320148 4:178185332-178185354 CATGAGAAAGACCCCGTGGGAGG - Intergenic
984960423 4:185092107-185092129 TAGGAGAAAGGCTTTGTAAGTGG + Intergenic
985838130 5:2285293-2285315 CATGAGGAAGACGCTGTTAGGGG - Intergenic
986414892 5:7518708-7518730 CAGGAGAAACCCACTGTGAGTGG - Intronic
986803093 5:11281702-11281724 CAGAAGAACGACCATGTGAGTGG - Intronic
987057196 5:14205001-14205023 CAGGAAAAAGAGCTTGGAAGAGG - Intronic
988811086 5:34786073-34786095 CAGGGGACAGACATTGTAAGGGG + Intronic
989172082 5:38481896-38481918 CAAGAAAATGACCCTGTAGGAGG - Exonic
989683502 5:44057798-44057820 AAGGAGAAAGATCTTGGAAGGGG + Intergenic
990657929 5:57978362-57978384 CAGGAGATAGACCTTGAAAGTGG + Intergenic
990814243 5:59765618-59765640 CAGGAGAAAGACCATGAAAGAGG - Intronic
992628219 5:78653939-78653961 CAGGAGGTAGAGACTGTAAGTGG - Intronic
994297236 5:98105237-98105259 TATGAGAAAGACTCTGTCAGCGG - Intergenic
995195266 5:109359534-109359556 TAGCAGAAACACCCTGGAAGTGG - Intronic
995751716 5:115459165-115459187 CAGGAGAAAGACATGGGAAGTGG + Intergenic
998855496 5:146391017-146391039 CAGGATAAAGACACTCTGAGAGG + Intergenic
999080876 5:148842503-148842525 CAGGTGACAGACTCTGGAAGGGG - Intergenic
1000230837 5:159313796-159313818 CAGATGAAAGACCCTGTAGGGGG + Intergenic
1001182988 5:169538290-169538312 CTGGAGACAGAGCCTTTAAGAGG + Intergenic
1001641736 5:173249095-173249117 CAGGAAAAACTCCCTGGAAGAGG - Intergenic
1001908521 5:175494010-175494032 TACGAAAAAGACTCTGTAAGAGG + Intronic
1002593642 5:180307660-180307682 CAAGACAAGGCCCCTGTAAGTGG + Intronic
1003392788 6:5727921-5727943 CAGGTGAATGACGCTGTTAGAGG + Intronic
1005525173 6:26640424-26640446 AAGGATAAAGACCCTGAAATGGG - Intronic
1006668110 6:35712392-35712414 CAGGAGAAAGCCCCAGAAGGGGG + Intronic
1008885646 6:56429791-56429813 CAGGAGAAAGAATTTGAAAGAGG - Intergenic
1011696860 6:89920955-89920977 CAGGTGAACGTCCATGTAAGAGG - Intergenic
1012523733 6:100152104-100152126 CAGGCCAAGGCCCCTGTAAGGGG + Intergenic
1013017193 6:106170593-106170615 TTGGAGAAAGCCCCTGTAAGTGG - Intergenic
1013593901 6:111644478-111644500 CTGGAGAAAGTCCCTGTTAATGG + Intergenic
1013633198 6:112005087-112005109 CAGGAGAATGAGCATGGAAGTGG - Intergenic
1014599314 6:123389482-123389504 CAGGATGAAGACCCAATAAGAGG - Intronic
1015316626 6:131824303-131824325 CAGGGGAAAGGCCCTGGGAGAGG + Intronic
1015974266 6:138773575-138773597 CAGGAGCAAGACGCAATAAGCGG - Exonic
1016292164 6:142537990-142538012 GAGAAGAAAGAACCTGGAAGTGG - Intergenic
1016890039 6:148996554-148996576 CAAGAGAAAGAGTCTGTAGGAGG - Intronic
1021332391 7:19354832-19354854 CAGGAGGAAGACAGTGAAAGGGG + Intergenic
1023374395 7:39541533-39541555 CAGGAGAAAATCATTGTAAGAGG - Intergenic
1024557919 7:50619646-50619668 AAGGAGAAAGAACTTGAAAGAGG + Intronic
1025603878 7:63024871-63024893 CAGGAGAGAAACACTGAAAGAGG - Intergenic
1027600758 7:80237757-80237779 CAGGAGAAAGAGCATGAAGGGGG + Intergenic
1028356102 7:89911350-89911372 CAGTAGAAGGAACCTGTCAGTGG - Intergenic
1029381693 7:100219561-100219583 GAGGAGAAAGCCCCTGGGAGTGG - Intronic
1029401858 7:100352009-100352031 GAGGAGAAAGCCCCTGGGAGTGG - Intronic
1030157332 7:106468371-106468393 CATGAGAAAGACCCAGTGGGAGG - Intergenic
1033425131 7:141237246-141237268 TAGGAGAAAGACCCTTAAATGGG - Intronic
1034310339 7:150082305-150082327 CAGGAGAAAGGCACTGAAAGGGG - Intergenic
1034411233 7:150943256-150943278 CAGGAGACAGACCCAGGCAGTGG - Intergenic
1034796506 7:154018348-154018370 CAGGAGAAAGGCACTGAAAGGGG + Intronic
1036218749 8:6902775-6902797 CAGGACAGAGCCCCTGCAAGTGG - Intergenic
1037400345 8:18489414-18489436 AAAGACAAAGACCCTGTAATTGG + Intergenic
1037724107 8:21468847-21468869 TTGGAAGAAGACCCTGTAAGAGG + Intergenic
1038624687 8:29179645-29179667 CAGCAGAAAGAGCCAGAAAGGGG - Intronic
1041014315 8:53576132-53576154 TCTGAGAAAGATCCTGTAAGAGG + Intergenic
1043297174 8:78680704-78680726 CAGGAGAAATTACCCGTAAGAGG + Intronic
1043312415 8:78876768-78876790 CAGGAGGAAGGGCCTGTAATGGG + Intergenic
1045822037 8:106350108-106350130 GAGGAGAAAGAACCAGTAAGAGG + Intronic
1047006033 8:120621302-120621324 CAGGAAAGTGACCCTATAAGTGG + Intronic
1048880278 8:138866900-138866922 GAGAAGAGAGACCCTCTAAGAGG + Intronic
1058388826 9:104471003-104471025 CAGAAGAAAGACACAGTGAGGGG + Intergenic
1060509476 9:124221664-124221686 TAGGATAAAAACTCTGTAAGTGG - Intergenic
1061969041 9:134034056-134034078 CAGGAGACAGACCCCTTCAGCGG + Intronic
1186329708 X:8518976-8518998 CAGAAGAAAGACCTTGAAAAGGG - Intergenic
1186473780 X:9841486-9841508 CAGGAGGGAGACACTGGAAGAGG + Intronic
1188629574 X:32337032-32337054 CAGGAGAAATATGGTGTAAGTGG + Intronic
1190005852 X:46737273-46737295 CTGGAGGAAAAGCCTGTAAGAGG + Intronic
1194219979 X:91177741-91177763 CAGGAGCTAGAGCCTGTAATGGG + Intergenic
1194382504 X:93212000-93212022 CAGCAAAAAGACCTTGGAAGCGG - Intergenic
1195287235 X:103396966-103396988 GAGGACACAGACCCAGTAAGAGG - Intergenic
1199980429 X:152917593-152917615 CAGGACAAGGACACTGTTAGTGG - Intronic
1200556485 Y:4641502-4641524 CAGGAGCTAGAGCCTGTAATGGG + Intergenic
1201798914 Y:17932652-17932674 GAGGAGAAAAAGCCTGTAAAAGG - Intergenic
1201802639 Y:17973305-17973327 GAGGAGAAAAAGCCTGTAAAAGG + Intergenic
1202360217 Y:24101265-24101287 CAGGAGAAAAAGCCTGTAAAAGG - Intergenic
1202510560 Y:25568849-25568871 CAGGAGAAAAAGCCTGTAAAAGG + Intergenic