ID: 1096200981

View in Genome Browser
Species Human (GRCh38)
Location 12:49682778-49682800
Sequence TTTTATCTTTTGAAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3947
Summary {0: 1, 1: 0, 2: 12, 3: 233, 4: 3701}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096200981_1096200987 3 Left 1096200981 12:49682778-49682800 CCTTGCCCCTTCAAAAGATAAAA 0: 1
1: 0
2: 12
3: 233
4: 3701
Right 1096200987 12:49682804-49682826 AGAAACCAACAGCCACCCAGGGG 0: 1
1: 0
2: 1
3: 27
4: 290
1096200981_1096200989 12 Left 1096200981 12:49682778-49682800 CCTTGCCCCTTCAAAAGATAAAA 0: 1
1: 0
2: 12
3: 233
4: 3701
Right 1096200989 12:49682813-49682835 CAGCCACCCAGGGGATTCACAGG 0: 1
1: 0
2: 0
3: 18
4: 181
1096200981_1096200985 1 Left 1096200981 12:49682778-49682800 CCTTGCCCCTTCAAAAGATAAAA 0: 1
1: 0
2: 12
3: 233
4: 3701
Right 1096200985 12:49682802-49682824 CAAGAAACCAACAGCCACCCAGG 0: 1
1: 0
2: 1
3: 23
4: 189
1096200981_1096200986 2 Left 1096200981 12:49682778-49682800 CCTTGCCCCTTCAAAAGATAAAA 0: 1
1: 0
2: 12
3: 233
4: 3701
Right 1096200986 12:49682803-49682825 AAGAAACCAACAGCCACCCAGGG 0: 1
1: 0
2: 2
3: 22
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096200981 Original CRISPR TTTTATCTTTTGAAGGGGCA AGG (reversed) Intronic
Too many off-targets to display for this crispr