ID: 1096214769

View in Genome Browser
Species Human (GRCh38)
Location 12:49792906-49792928
Sequence TGGGGGTCCCACTGCTACCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096214764_1096214769 9 Left 1096214764 12:49792874-49792896 CCGCGGTGGCTTGGTCTTAGGAA 0: 1
1: 0
2: 1
3: 7
4: 75
Right 1096214769 12:49792906-49792928 TGGGGGTCCCACTGCTACCATGG 0: 1
1: 0
2: 4
3: 12
4: 160
1096214762_1096214769 13 Left 1096214762 12:49792870-49792892 CCAGCCGCGGTGGCTTGGTCTTA 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1096214769 12:49792906-49792928 TGGGGGTCCCACTGCTACCATGG 0: 1
1: 0
2: 4
3: 12
4: 160
1096214757_1096214769 27 Left 1096214757 12:49792856-49792878 CCCAGGTGGGGGATCCAGCCGCG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1096214769 12:49792906-49792928 TGGGGGTCCCACTGCTACCATGG 0: 1
1: 0
2: 4
3: 12
4: 160
1096214756_1096214769 28 Left 1096214756 12:49792855-49792877 CCCCAGGTGGGGGATCCAGCCGC 0: 1
1: 0
2: 0
3: 13
4: 110
Right 1096214769 12:49792906-49792928 TGGGGGTCCCACTGCTACCATGG 0: 1
1: 0
2: 4
3: 12
4: 160
1096214758_1096214769 26 Left 1096214758 12:49792857-49792879 CCAGGTGGGGGATCCAGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1096214769 12:49792906-49792928 TGGGGGTCCCACTGCTACCATGG 0: 1
1: 0
2: 4
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096214769 Original CRISPR TGGGGGTCCCACTGCTACCA TGG Exonic
900428688 1:2592131-2592153 TGGGGGTCCTGCTGCTGCAAGGG + Intronic
900457943 1:2786404-2786426 TGGGGGTCCCACAGCGGCCAGGG + Intronic
901764972 1:11494122-11494144 TGGTGGTCACACAGCTACTAAGG - Intronic
901858439 1:12058980-12059002 GGAGAGTCCTACTGCTACCAAGG + Intergenic
903741918 1:25563212-25563234 GGGGGGTCCCACTCCTGCCTGGG + Intronic
905576588 1:39049558-39049580 TGGGGGTCTCACTGTTTCCCAGG + Intergenic
905793738 1:40803723-40803745 TGGGGTTCCCACTGGGAGCATGG + Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906692720 1:47803184-47803206 TGGGGGTCCCACAGCCTCCATGG + Intronic
909992981 1:82246317-82246339 TGGAGGTGCCTCTGCTACCATGG - Intergenic
912286214 1:108372323-108372345 TTGGGGACCCTCTGATACCACGG - Intergenic
915801169 1:158794940-158794962 TGGGTGTCCCAAAGCTCCCATGG + Intergenic
918627507 1:186674626-186674648 TGGTGCTCCAACTTCTACCATGG + Exonic
919732859 1:200925033-200925055 TGGGGGTCTCACTGTTGCCCAGG - Intergenic
920244085 1:204575103-204575125 TTGGGGTCACACTGCTAGCAAGG + Intergenic
920444527 1:206005862-206005884 TGTGGGGCCCACTGCTGCCGAGG + Intergenic
1063574051 10:7245109-7245131 TGGGGTCCTCACTGCTACCGGGG + Intronic
1065304615 10:24356511-24356533 TGGGGGACACACTGAAACCACGG - Intronic
1069330164 10:67282712-67282734 TGTGGGTTTCACAGCTACCATGG + Intronic
1069952837 10:72031488-72031510 GAGAGGTCCCTCTGCTACCAAGG + Intergenic
1070703052 10:78617377-78617399 TGGTGGTCCCACTGTTTACATGG + Intergenic
1070817598 10:79335252-79335274 TGGGGGGACCACTTCTCCCAGGG + Intergenic
1072772996 10:98158830-98158852 TGGGGGTCTCACTGTTGCCCAGG + Intronic
1076320271 10:129574928-129574950 TGTGGGCCCCTCTGATACCAGGG + Intronic
1077442547 11:2575352-2575374 TGGGGGGCCCAGGGCGACCAGGG - Intronic
1083179733 11:60977411-60977433 TGGGGATCCCAGCCCTACCAGGG - Intronic
1083714800 11:64569055-64569077 GAGGGTCCCCACTGCTACCAGGG - Intronic
1086040229 11:82467461-82467483 TGTTGTGCCCACTGCTACCATGG + Intergenic
1087568628 11:99895679-99895701 TGGGGATCACACTTCTGCCATGG + Intronic
1090023320 11:123146720-123146742 TGGGGGTGACAATGATACCAGGG - Intronic
1091588732 12:1830555-1830577 TTTGGGTCCCACTGACACCATGG - Intronic
1093098093 12:14995038-14995060 TGGGGGTGCTACTGCCACTAGGG - Intergenic
1094078913 12:26511229-26511251 TGTGTGTTCCACTGCTCCCAGGG + Intronic
1096214769 12:49792906-49792928 TGGGGGTCCCACTGCTACCATGG + Exonic
1096602708 12:52741922-52741944 TGGGGCTCCCACTGGCTCCATGG - Intergenic
1096783495 12:54004216-54004238 TTGGGGTCCCACGGCCACCAGGG - Intronic
1097952311 12:65445430-65445452 TGGTGGTGGCACTGCTGCCAGGG - Intronic
1102739871 12:115197648-115197670 GGCGGGTGCCACTGCCACCACGG - Intergenic
1103514788 12:121500497-121500519 TTCGGGTCCCACTGCTTCCTAGG + Intronic
1103786243 12:123435545-123435567 TGGGGGTCTCACCGTTACCCAGG - Intronic
1107234846 13:38155638-38155660 TGGGGCTCCCACTGGCTCCATGG + Intergenic
1111551608 13:89819565-89819587 TGGGGGTTCCACTGTCACCCAGG - Intergenic
1113881359 13:113628580-113628602 TGTGGGTCCCACTCCAACCAGGG - Intronic
1121266499 14:92606112-92606134 TGGGGTTCCCTCTGCTTCCCAGG - Intronic
1121562446 14:94885401-94885423 TGGGGGTTGCACACCTACCATGG + Intergenic
1122530000 14:102418790-102418812 TGGTGGTCGGACTGCTTCCAAGG + Intronic
1124022713 15:25938976-25938998 AGGGGGTCCCTCAGCTTCCATGG + Intergenic
1124270779 15:28278348-28278370 TGGGGGTCTCACTGTTGCCCAGG - Intronic
1124375718 15:29127570-29127592 TGAGGGTCACACAGCCACCAAGG + Intronic
1125265565 15:37876399-37876421 TGGTGCTCCTTCTGCTACCATGG - Intergenic
1126145471 15:45469350-45469372 AGGGGGTCCCACTGCTAGTTTGG - Intergenic
1127293598 15:57591592-57591614 TGAGGGTCCCAGTGATACGAGGG + Intergenic
1128356878 15:66934311-66934333 TGGGGGTCACCCTTCGACCAAGG - Intergenic
1129115536 15:73363429-73363451 TGGGGGTCCCTCTGCAATCTGGG - Intronic
1131084033 15:89560287-89560309 TGGGGCTTCCACTGACACCATGG - Intergenic
1132909021 16:2299038-2299060 TGGGGGTCCCCCTGCATTCATGG + Intronic
1132909040 16:2299090-2299112 TGGGGGTCCCCCTGCATTCACGG + Intronic
1132909059 16:2299142-2299164 TGGGGGTCCCCCTGCATTCACGG + Intronic
1133197088 16:4178717-4178739 TGGGGGTCTCACTGTTGCCCAGG + Intergenic
1134007909 16:10830541-10830563 TGGGGGTCTCACTGTCACCCAGG + Intergenic
1136778323 16:32883078-32883100 TGTGGGTCCCACTGCCACCATGG + Intergenic
1136892297 16:33978436-33978458 TGTGGGTCCCACTGCCACCATGG - Intergenic
1137698592 16:50479064-50479086 CGGGGCTCCCACTGGCACCATGG + Intergenic
1138334414 16:56241231-56241253 TGTGAGTCCCACTGCTATCCAGG + Intronic
1138467719 16:57204757-57204779 TGGAGGTGCCGCTACTACCATGG + Exonic
1138973141 16:62170707-62170729 TGGGGATCCCACAGCTCCCCTGG + Intergenic
1139796615 16:69487946-69487968 TGGGGGTCTCTCTGTTACCCAGG + Intergenic
1203080745 16_KI270728v1_random:1145187-1145209 TGTGGGTCCCACTGCCACCATGG + Intergenic
1142632259 17:1232637-1232659 TGGGGGTCTCACTGTTGCCCAGG + Intergenic
1143399912 17:6637373-6637395 TGAGGGGCCCACAGCTGCCAGGG - Intronic
1146151355 17:30475391-30475413 TGTGGTCCCCACTGCCACCATGG - Intergenic
1146386675 17:32383093-32383115 TGGGGGTCTCACTGTTGCCCGGG - Intergenic
1150632549 17:66890224-66890246 TGGAGCAGCCACTGCTACCATGG - Intergenic
1151856012 17:76722517-76722539 TGGAGGTCTCACTGTTACCCAGG - Intronic
1154069626 18:11141607-11141629 TGTGGGTGCCACTGCTGCCTTGG - Intronic
1156061515 18:33082444-33082466 TGGGGGTCTCACTGTCACCCAGG - Intronic
1156298116 18:35810945-35810967 TTGGGGTGTCACTGCTCCCAGGG - Intergenic
1157596841 18:48869417-48869439 CGGGGCTCCCACAGCTGCCAGGG + Intergenic
1157614804 18:48979961-48979983 GGGGGCTCCCACAGCTGCCAGGG - Intergenic
1159557643 18:69962065-69962087 TGGAGGTCCCACAGCTAGCCAGG - Intergenic
1160318773 18:77871059-77871081 GGGGGCTCCCAGTGCTCCCATGG - Intergenic
1160852546 19:1199863-1199885 TGGGAGTCCCAGAGCCACCAGGG + Intronic
1161013000 19:1969130-1969152 TGGGGGTGCGACTGCTCCCCTGG + Intronic
1161326037 19:3664747-3664769 GGGGGATCCCACTGGTAGCATGG - Intronic
1162915714 19:13873382-13873404 TGGGGGTCCCTCATCTACCTTGG + Intronic
1163593167 19:18205381-18205403 TGGGCGTCCCAGTACTCCCAGGG - Intergenic
1164638844 19:29811023-29811045 TGGGGGTCTCACTGTTACCCAGG + Intergenic
1166054859 19:40282384-40282406 AGGGGGTGACACAGCTACCAGGG - Intronic
1166826079 19:45610062-45610084 GGGGTGTCCCAGTGTTACCAGGG + Intronic
1167381303 19:49139801-49139823 TGGGGGTCCCCCATCTTCCAGGG - Exonic
1168419064 19:56189119-56189141 TGGGGGTCTCACTGTTACCCAGG + Intergenic
927866672 2:26592332-26592354 TGGGGATCCCAATGCATCCAGGG - Intronic
929890661 2:45916434-45916456 TGGGGGTCTCACTGTTGCCCAGG + Intronic
931774532 2:65529073-65529095 TGGGGGACCCCCTTCTACCCTGG + Intergenic
933429612 2:82159097-82159119 TGGGATTCCCACTGCTTGCATGG + Intergenic
933823750 2:86139609-86139631 GGGGGGTCTCACTGTTACCCAGG - Exonic
935612299 2:105038074-105038096 TGGAGCTCCCACAGCTAACATGG + Exonic
936465929 2:112750107-112750129 TTGGAGTCCCATTTCTACCAGGG + Intronic
936663149 2:114564606-114564628 TGGGTTTTCCACTGGTACCAAGG + Intronic
939914756 2:148025010-148025032 TGGGGGTCCCACTGATGACTAGG - Intronic
945399815 2:209367606-209367628 TGGAGTCACCACTGCTACCATGG - Intergenic
1170875536 20:20246568-20246590 TATGGGTCCCACAGCTACCCTGG + Intronic
1175999611 20:62826013-62826035 TGGGGGTCCCACCTCTGCCAAGG + Intronic
1178597690 21:33969602-33969624 GGGGAGTCCCACTGCTTCCCTGG + Intergenic
1180055053 21:45353422-45353444 TGGGCGTCCCACAGCCATCATGG - Intergenic
1180781868 22:18525012-18525034 TGGGGGTCTCACTGTTGCCCAGG + Intergenic
1181238754 22:21464356-21464378 TGGGGGTCTCACTGTTGCCCAGG + Intergenic
1183831486 22:40420539-40420561 GGGGGGTCCCGCTGCTTCCCAGG + Exonic
1185324687 22:50219917-50219939 TGGGGGTCCCACAGCAGGCAGGG - Intronic
949145090 3:690614-690636 TGGGGGCCCCACATCTGCCATGG + Intergenic
950044956 3:9943577-9943599 TGGAGCTGCCACTGCTACCTGGG - Intronic
950602759 3:14049364-14049386 TGGGGGTCCCTGTACTACCAGGG + Intronic
953157097 3:40385757-40385779 TGGGGGTCCGTCTGCACCCAGGG - Intergenic
955298846 3:57757618-57757640 TGGGGGTGTCTCTCCTACCAGGG - Exonic
960974001 3:123157975-123157997 TGGGGGCCCCACCTCTGCCATGG + Intronic
961803902 3:129474961-129474983 GTGGGGTCCCACTGTTACCCAGG - Intronic
961832379 3:129630332-129630354 TGGGGGTCTCACTGTCACCCAGG + Intergenic
962302220 3:134252483-134252505 TGGGACAGCCACTGCTACCAGGG + Intergenic
966968913 3:185024368-185024390 AGGGGATCCCACTGCTAAAAAGG + Exonic
968915904 4:3496967-3496989 TGGGGGGCCCACTGCCAGCAGGG + Intronic
972971567 4:44582861-44582883 TGGGGATCCCACAGCTCCCTAGG - Intergenic
982735609 4:159004040-159004062 TTGGGGTCTCACTGTTACCCAGG + Intronic
983219739 4:165032563-165032585 TCGGGGTCCCACTGCCTCCGCGG - Intronic
985815319 5:2124121-2124143 TGGGGGTCCCAGGGCTCACAGGG + Intergenic
985962551 5:3313648-3313670 TGGAGGTCCCAGGTCTACCATGG + Intergenic
987931327 5:24402494-24402516 TGGGACTGCCACTGCCACCATGG - Intergenic
990539777 5:56760759-56760781 TGAGGCACCCACTGCTTCCAAGG + Intergenic
993306263 5:86279081-86279103 TTGGGGACCCTCTGATACCACGG - Intergenic
994191997 5:96879033-96879055 TGGGGGTCTCCCTGTTACCCAGG - Intronic
994245696 5:97472376-97472398 CAGGGTTCCCACTGCTGCCACGG + Intergenic
997472252 5:134123553-134123575 TGGGGGCCCCACTGGAACAAAGG + Intronic
997622406 5:135307482-135307504 GAGAGGACCCACTGCTACCAGGG - Intronic
998382504 5:141735740-141735762 TGTGGGTCCCAGTGCTAGGAGGG + Intergenic
1005996767 6:30936296-30936318 TAGGAGTTCCACTGCCACCATGG + Intergenic
1006389815 6:33751734-33751756 TGGGGCCCCCACTCCTAACACGG + Intergenic
1007743217 6:44025335-44025357 TGGGGGACCCACTGCCTCCCAGG - Intergenic
1007809522 6:44476156-44476178 TGTGGGCCCCACAGCTCCCAGGG - Intergenic
1010065569 6:71679105-71679127 TGTGGGTCCCACTGGTACTGAGG - Intergenic
1011650637 6:89503257-89503279 ATGGGGTCCCACTGCTTCTAAGG + Intronic
1013013852 6:106143733-106143755 TGGGGCTCCCACTGCTGCGCTGG - Intergenic
1013457993 6:110349376-110349398 TGGCAGTCACACTGCTAGCATGG + Intronic
1014102218 6:117524059-117524081 TCAGGGTCCCACTGCTAGCTAGG + Intronic
1019481966 7:1270984-1271006 AGGGGGTCCACCTGCTTCCAGGG - Intergenic
1021999628 7:26213968-26213990 TGGGGGTCTCACTGTTGCCCGGG - Intergenic
1022635787 7:32133494-32133516 TGGGGCATCCACTGCTGCCAGGG + Intronic
1023082177 7:36536086-36536108 TGGGTGTCTCACTCCTGCCAGGG - Intronic
1023731594 7:43197247-43197269 TGGGGGTCACAGTCTTACCATGG + Intronic
1023778552 7:43634449-43634471 CGTGGGTCCCACTGATACCATGG + Intronic
1026091804 7:67306704-67306726 TGGGGGTACCACAGCTACAGAGG - Intergenic
1027164221 7:75823227-75823249 TGGGGGTGTCACTGCTTCCTGGG + Intronic
1029377279 7:100186902-100186924 TGGGGGTACCACAGCTACAGAGG - Intronic
1031188649 7:118517479-118517501 TGGGAGTTCCTCTGCTGCCATGG + Intergenic
1033405687 7:141070697-141070719 TTGGGTTCCCACTGCAAGCAGGG + Intergenic
1033582862 7:142752593-142752615 TGAGGCTCCCACTGATACCTAGG + Intronic
1033584417 7:142763514-142763536 TGAGGTTCCCACTGATACCCAGG + Intronic
1034738731 7:153453831-153453853 TTGGGGTCCAAGTGCTACCCAGG - Intergenic
1035432632 7:158833739-158833761 TGGGGGTCCCATTGTTGCCCAGG - Intergenic
1037208435 8:16354836-16354858 TGGGGGACCCACAGCCACAATGG + Intronic
1038270292 8:26069422-26069444 TGAGGGTCCCACAGCTCACACGG - Intergenic
1039108106 8:34011559-34011581 ATGGGGTCATACTGCTACCAGGG - Intergenic
1048369595 8:133766015-133766037 TTGAGGTCCCACAGCTCCCATGG - Intergenic
1049025287 8:139984286-139984308 TGGTGCTCTCACTGCTACCTGGG - Intronic
1053050030 9:34953751-34953773 TGGGGGTCTCACTGTTGCCCAGG - Intergenic
1056192167 9:84194971-84194993 TGGGGTTCCCACTGGCTCCATGG + Intergenic
1057281597 9:93716646-93716668 TCTGGGCCCCACTGATACCAGGG + Intergenic
1057333499 9:94138554-94138576 AGGGGGTCCCAATGCTAGCTTGG + Intergenic
1057483498 9:95463687-95463709 TGGGCATCCCACGGCAACCAAGG + Intronic
1058140767 9:101355005-101355027 TGGGGGTGGCTCTGCTCCCACGG + Intergenic
1061951815 9:133940483-133940505 TGGGGGACCCTCCGCTCCCAGGG - Intronic
1062592911 9:137282010-137282032 TGGGGTGCCCACTGCTCCCCAGG + Exonic
1062688807 9:137830358-137830380 TGGGGTGCCCACTGCTGTCAGGG + Intronic
1188488871 X:30714523-30714545 TGGGGGTCCCTCAGATAGCAGGG - Intronic
1190023792 X:46903779-46903801 TGGGAGTCCCAGCGGTACCAGGG + Intergenic
1190375146 X:49782021-49782043 TGGGGGTCACATGGCTGCCATGG + Intergenic
1196868449 X:120090214-120090236 AGGGGGTCTCCCTGCTACCCTGG + Intergenic
1200101508 X:153690983-153691005 TGTGGGTCCCACTGCCACCATGG - Intronic
1201368036 Y:13230222-13230244 TGGGGGTCTCACTGTTTCCCAGG + Intergenic