ID: 1096216127

View in Genome Browser
Species Human (GRCh38)
Location 12:49798365-49798387
Sequence ACAGTGCCCCAGAGGCAGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 228}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096216116_1096216127 14 Left 1096216116 12:49798328-49798350 CCACAATACCTAGCCCTCCTACC 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1096216127 12:49798365-49798387 ACAGTGCCCCAGAGGCAGCGGGG 0: 1
1: 0
2: 0
3: 20
4: 228
1096216121_1096216127 -7 Left 1096216121 12:49798349-49798371 CCTCTCTCTGCCCAGCACAGTGC 0: 1
1: 1
2: 7
3: 90
4: 805
Right 1096216127 12:49798365-49798387 ACAGTGCCCCAGAGGCAGCGGGG 0: 1
1: 0
2: 0
3: 20
4: 228
1096216117_1096216127 6 Left 1096216117 12:49798336-49798358 CCTAGCCCTCCTACCTCTCTCTG 0: 1
1: 0
2: 4
3: 56
4: 649
Right 1096216127 12:49798365-49798387 ACAGTGCCCCAGAGGCAGCGGGG 0: 1
1: 0
2: 0
3: 20
4: 228
1096216120_1096216127 -3 Left 1096216120 12:49798345-49798367 CCTACCTCTCTCTGCCCAGCACA 0: 1
1: 0
2: 10
3: 81
4: 642
Right 1096216127 12:49798365-49798387 ACAGTGCCCCAGAGGCAGCGGGG 0: 1
1: 0
2: 0
3: 20
4: 228
1096216118_1096216127 1 Left 1096216118 12:49798341-49798363 CCCTCCTACCTCTCTCTGCCCAG 0: 1
1: 0
2: 7
3: 78
4: 799
Right 1096216127 12:49798365-49798387 ACAGTGCCCCAGAGGCAGCGGGG 0: 1
1: 0
2: 0
3: 20
4: 228
1096216119_1096216127 0 Left 1096216119 12:49798342-49798364 CCTCCTACCTCTCTCTGCCCAGC 0: 1
1: 0
2: 7
3: 106
4: 814
Right 1096216127 12:49798365-49798387 ACAGTGCCCCAGAGGCAGCGGGG 0: 1
1: 0
2: 0
3: 20
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096216127 Original CRISPR ACAGTGCCCCAGAGGCAGCG GGG Exonic
900313889 1:2047764-2047786 GCAGTGCCCCAGTCCCAGCGAGG - Intergenic
900844824 1:5088840-5088862 TCACTGCCTCAGAGGCAGCAGGG - Intergenic
900980811 1:6045143-6045165 TCAGTGCCCCAGTCGCAGTGTGG - Intronic
902076301 1:13789515-13789537 ACAGTTCCCCAGAGGCTAGGTGG + Intronic
903136082 1:21310132-21310154 ACATTGCCTCAGAGGGAGGGAGG + Intronic
903320035 1:22537559-22537581 AAAGTGCCACAGAGGCAGCCAGG + Intergenic
903438814 1:23371718-23371740 ACAGTGCTCCACAGGCACAGTGG - Exonic
904034377 1:27551045-27551067 GCAGTGCCCCAGGGGCTGCTGGG + Exonic
904697455 1:32338233-32338255 CCAGAGCCCCAGAGGGAGCCTGG + Intergenic
905856823 1:41319962-41319984 CCAGTGGCCCAGAGGCAGGACGG + Intergenic
911217288 1:95208870-95208892 AATGTGTCCCAGAGGCAGAGAGG - Intronic
912542396 1:110427007-110427029 AGGATGCCCCAGAGGCAGCGTGG + Intergenic
912549074 1:110472842-110472864 ACAGTGCCCAGCAGGCACCGTGG - Intergenic
912670476 1:111619958-111619980 AGACGGCCCCAGAGGGAGCGGGG + Intronic
913516304 1:119608486-119608508 CCAGTACCCCAGAGGTAGCCGGG + Intergenic
915596334 1:156898373-156898395 AGAGTGCGCCAGAGGCTGGGCGG - Intronic
915940146 1:160113840-160113862 AGAGTGGCCCCGAGGCAGCTAGG - Intergenic
916348829 1:163825718-163825740 ACAGTGTACCAGAGGTAGGGAGG - Intergenic
916481312 1:165217260-165217282 TCAGAGCCCCAGAGGCAGGATGG + Intronic
920084000 1:203401226-203401248 CCAGTGCTCCAGAGCCAGAGAGG - Intergenic
920219352 1:204385170-204385192 ACAGTTCCCCAGAGGGAGAGGGG + Intergenic
922570689 1:226633218-226633240 ACAGTTCCCCAGAGACCCCGGGG + Exonic
923113808 1:230915232-230915254 CCAGAGCCCAAGAGGCAGAGGGG + Intronic
924561729 1:245162107-245162129 TCAGTGCCCCATCGGCAGGGCGG + Intronic
1062803730 10:399005-399027 CCAGGGCCCCAGAAACAGCGAGG + Intronic
1063052602 10:2468896-2468918 ACAGAGTCCCAGGGGCAGTGAGG - Intergenic
1063368057 10:5503188-5503210 ACAGGTCCCCAGAGGCAGGAAGG + Intergenic
1063386507 10:5619586-5619608 CCTGAGCCCTAGAGGCAGCGGGG + Intergenic
1067067891 10:43113796-43113818 ACAGAGGCCCAGAGGGAGGGAGG - Intronic
1068399418 10:56509050-56509072 ACAGTGCCCCAGTGGTGGCTCGG - Intergenic
1069739183 10:70676695-70676717 ACAGAGCCGCAGAGCCAGAGTGG - Intronic
1069923787 10:71834066-71834088 ACAGAGGCCCAGAGGCAGCATGG + Intronic
1070850679 10:79559590-79559612 GCAGAGCCCGAGAGGCAGGGCGG + Intronic
1070856541 10:79611697-79611719 GCAGAGCCCGAGAGGCAGGGCGG - Intronic
1071131262 10:82396214-82396236 AAAATGTTCCAGAGGCAGCGAGG - Intronic
1074448795 10:113542100-113542122 AGAGTGCTGCAGAGGCAGAGTGG - Intergenic
1075084017 10:119402032-119402054 TCAGTGCCACAGAGGAAGAGAGG + Intronic
1077300625 11:1845199-1845221 ACAGAGACACAGAGGCAGAGAGG + Intergenic
1077300629 11:1845288-1845310 ACAGAGGCACAGAGGCAGAGAGG + Intergenic
1078103335 11:8343149-8343171 ACAGAGCCCCAGTGGGAGCGTGG + Intergenic
1078494209 11:11799656-11799678 ACAGTGCCCTACAAGCAGCTGGG + Intergenic
1080761516 11:35254582-35254604 ACAGTGCCCCAGAAGGAGTGAGG + Exonic
1081633802 11:44707373-44707395 ACAGTTCAGCAGAGGCATCGAGG - Intergenic
1083372450 11:62192913-62192935 ACAGCAACCCAGAGGCAGCCAGG - Intronic
1083876943 11:65529260-65529282 ACACTGCCCAGGAGGCAACGGGG - Intronic
1084942713 11:72621695-72621717 ACAGTGACACAGAGCCAGTGTGG - Intronic
1085058779 11:73425503-73425525 ACAGTGACCCAGAGGCTTCAGGG - Intronic
1085188051 11:74592861-74592883 TCTGTGCCCCAGAGCGAGCGAGG + Intronic
1085273822 11:75285671-75285693 ACAGTGCCCCAGAGTTCTCGGGG + Intronic
1089981894 11:122779573-122779595 ATAGAGCTCCAGGGGCAGCGGGG - Exonic
1091193152 11:133711021-133711043 GCAGTGGCCCAGGGGCAGGGAGG - Intergenic
1092059679 12:5538116-5538138 ACAGTCCCGCAGAGATAGCGAGG + Intronic
1092940421 12:13402620-13402642 ACAATGGCCCAGAAGCAGGGAGG + Intergenic
1094825297 12:34264793-34264815 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1095085262 12:38053312-38053334 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
1096216127 12:49798365-49798387 ACAGTGCCCCAGAGGCAGCGGGG + Exonic
1096981076 12:55728561-55728583 CCTGGGCCCCAGAGGCGGCGGGG - Intronic
1101749382 12:107570870-107570892 ACAGAGGCCCAGAGGAAGCCTGG - Intronic
1102816040 12:115867353-115867375 ACAGTGTCCCAGAACCACCGAGG - Intergenic
1102975508 12:117204360-117204382 GCTCTGCCCCAGAGGCAGCCGGG - Intergenic
1104069817 12:125334701-125334723 ACAGTGCCCCATAAGCATCATGG - Intronic
1104599213 12:130141274-130141296 CCAGGGTCCCAGAGGCAGGGCGG - Intergenic
1104709784 12:130977448-130977470 ACAGGGCCCATGAGGCAGCCGGG + Intronic
1104745503 12:131207868-131207890 ACAGTGCAGCAGCGGCAGTGTGG - Intergenic
1104788837 12:131469241-131469263 ACAGTGCAGCAGCGGCAGTGTGG + Intergenic
1105050947 12:133050238-133050260 ACAGTGCCTCAGAGGCACTCAGG - Intronic
1107538509 13:41361407-41361429 ACAGTGACCCCGAGTCAGCAAGG + Intronic
1107715493 13:43195453-43195475 ACAGTGTCCCTGATGCAGCCTGG - Intergenic
1113457931 13:110462203-110462225 TCAGTGCCCCAGGGGCCGCGTGG - Intronic
1113992985 14:16042735-16042757 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1114616929 14:24073266-24073288 AGATTGACCCAGAGGCAGTGGGG + Intronic
1115391562 14:32860479-32860501 ACAGAGCCACAGAGGGAGCCAGG - Intergenic
1115437070 14:33387266-33387288 ACACTTCCACAGAGGCAGCTTGG + Intronic
1118082852 14:62381840-62381862 ACAGTGACTCGGAGGCAGCTGGG + Intergenic
1118307664 14:64668735-64668757 ACAGTGCTCTACAGGCAGTGAGG + Intergenic
1119867790 14:77988584-77988606 TCAGTGACTCAGAGGCAGAGTGG + Intergenic
1119931656 14:78553485-78553507 AGAGTGCCCCATTGGCAGGGGGG - Intronic
1121992716 14:98575061-98575083 AAAGTGTCCCAGAGGCAACTTGG - Intergenic
1122070091 14:99200579-99200601 ACTTTGCCCATGAGGCAGCGAGG + Intronic
1122464146 14:101918656-101918678 ACAGTGCCCGGGAGGGGGCGAGG - Intronic
1122765437 14:104066297-104066319 GCAGAGCCACAGAGGCAGAGCGG - Intergenic
1122859620 14:104576708-104576730 TCACTGCCCCAGAGGGAGCTGGG + Intronic
1124399136 15:29333375-29333397 ACTGTGCCCAGGAGGCAGCCTGG + Intronic
1126796530 15:52264427-52264449 ACAGTGCCCCAGATGCCCCTGGG - Intronic
1127772239 15:62241539-62241561 ACTGTGCCCCATAGGCACCACGG + Intergenic
1128549943 15:68591567-68591589 ACATTGCCCTAGAGGCAGAGAGG + Intronic
1129399657 15:75274593-75274615 ACTGTGCCCCATAGGCACCATGG - Intronic
1129689962 15:77707598-77707620 ACGGTTCCCCAGAGGCTGCTGGG + Intronic
1129717498 15:77860687-77860709 AGAGTGGCCCAGGGGCAGCAGGG - Intergenic
1130461254 15:84159510-84159532 AGAGTGGCCCAGGGGCAGCAGGG + Intergenic
1130668484 15:85889997-85890019 ACAGTGAGCAAGAGGGAGCGAGG - Intergenic
1132618519 16:853792-853814 TCAAGGCCTCAGAGGCAGCGAGG + Exonic
1136912352 16:34154487-34154509 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1138151168 16:54658527-54658549 ACAGTGTCCCAGGAGCAGCAAGG + Intergenic
1140530341 16:75660368-75660390 ATCTTGCCCCAGAGGCAGCAGGG + Intronic
1141982082 16:87556947-87556969 CCAGGGCCCCAGGGGCAGGGAGG + Intergenic
1142167096 16:88597952-88597974 GCAGTTCCCCAGAGGCTGCCAGG - Intronic
1142580041 17:936337-936359 GCAGTGCCTCAGAGGGAGGGCGG - Intronic
1142676516 17:1516808-1516830 ACACTGCCCCAGACGACGCGAGG + Exonic
1142690174 17:1601413-1601435 ACAGAGCCCCACAGCCAGAGAGG + Intronic
1143121170 17:4607928-4607950 GCAGTGGCCCAGAGGGAGGGAGG - Exonic
1144132900 17:12265451-12265473 CCAGTGCCTCAGAGGGAGTGTGG - Intergenic
1144738364 17:17567443-17567465 GCAGTGCCCCAGGGGCAGCAGGG + Intronic
1144761805 17:17711315-17711337 ACAGTGCACCAGATGCCTCGGGG - Intronic
1144828976 17:18121340-18121362 GCAGAGCCCCAGGGGCGGCGAGG - Exonic
1148458112 17:47821705-47821727 ACGGTGACTCAGAGGCAGAGCGG - Exonic
1148587567 17:48791695-48791717 ACAAGGCTCCAGAGCCAGCGAGG + Intronic
1148641463 17:49190966-49190988 CCAGTGTCCCAGGGGCAGTGGGG - Intergenic
1148857395 17:50586242-50586264 CCAGGGCCTCAGTGGCAGCGTGG + Intronic
1151140782 17:71990206-71990228 GCAGTGACCCAGAGGCAGTGGGG - Intergenic
1151958353 17:77392011-77392033 GCTGTGCCCCATAGGCAGGGTGG + Intronic
1152694904 17:81739161-81739183 TCAGGGCCCCGGTGGCAGCGGGG - Intergenic
1152742864 17:82025994-82026016 CCAGTGCCCCAGACTCAGCTGGG + Intronic
1153591943 18:6683368-6683390 TCTGCGCACCAGAGGCAGCGCGG - Intergenic
1161233183 19:3185836-3185858 ACAATTCCCGACAGGCAGCGCGG + Exonic
1161416943 19:4152677-4152699 ACAGTGACCTAGAGCCAGAGGGG + Intergenic
1162140920 19:8585219-8585241 GCAGTGCGCCGGGGGCAGCGTGG + Exonic
1162699007 19:12499734-12499756 AAAGTGCACCAGTGGCAGCCAGG + Intronic
1165579503 19:36850164-36850186 ACTGTGCCCCGGAGGCTGCTTGG - Intronic
1165727998 19:38125555-38125577 TCAGTGCCCCAGAGCCTGCTGGG + Intronic
1165856417 19:38881295-38881317 ACAGTGCCCCAGATCCATCCTGG - Intronic
1167315764 19:48761966-48761988 ACAGAGACCCAGAGGAAGGGGGG + Intergenic
1167358147 19:49016482-49016504 CCAGACCCACAGAGGCAGCGGGG - Intronic
1167359642 19:49023372-49023394 CCAGACCCACAGAGGCAGCGGGG - Intronic
1167361489 19:49032713-49032735 CCAGACCCACAGAGGCAGCGGGG + Intronic
1167362165 19:49036072-49036094 CCAGACCCACAGAGGCAGCGGGG - Intronic
1167363919 19:49044786-49044808 CCAGACCCACAGAGGCAGCGGGG + Intronic
1167364579 19:49048141-49048163 CCAGACCCACAGAGGCAGCGGGG - Intronic
1167365864 19:49054777-49054799 CCAGACCCACAGAGGCAGCGGGG - Intronic
1167413202 19:49356931-49356953 ACAGAGACCCAGAGACAGAGGGG - Intronic
1167485073 19:49758043-49758065 ACAGAGACCCAGAGACAGAGGGG - Intronic
1167564793 19:50249438-50249460 ACAGAGACCCAGAGACAGAGAGG - Intronic
1167740607 19:51322918-51322940 ACAGAGACCCAGAGGCAGAGGGG - Intronic
1167740626 19:51323010-51323032 ACAGAGACCCAGAGACAGAGGGG - Intronic
1167740664 19:51323221-51323243 ACAGAGACCCAGAGACAGAGGGG - Intronic
1168250396 19:55138170-55138192 CCAGTGCCGCAGAGGCTGCTGGG + Intronic
1168507210 19:56946297-56946319 TCAGTGCTCCTGAGGCAGCAAGG - Intergenic
925124206 2:1442302-1442324 ACAGTCCTCCAGAGGCAGTGGGG + Intronic
925210224 2:2038998-2039020 ACAGTGCCTCATCGGCAGAGAGG - Intronic
925458923 2:4043247-4043269 CCAGAGCCCGAGAGGAAGCGGGG + Intergenic
925634957 2:5934061-5934083 ACAGGGCCCCCAAGGCAGTGGGG - Intergenic
925674815 2:6350948-6350970 ACAATACCCCAGAGTCAGCTGGG + Intergenic
927702386 2:25276631-25276653 CCAGCGCCCCGGAGGCTGCGGGG + Intronic
928809437 2:35204702-35204724 ACAGCCCTCCAGAAGCAGCGTGG - Intergenic
931985083 2:67733702-67733724 ACAGTGCCCCACATCCAACGAGG + Intergenic
932613084 2:73214163-73214185 AGAGTGCCCCTGAGGCTGCGAGG - Intergenic
932776484 2:74530921-74530943 TGAGCGTCCCAGAGGCAGCGTGG - Exonic
936906243 2:117538073-117538095 ATAGTGACCCAAAGGCATCGTGG + Intergenic
938538717 2:132268147-132268169 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
946631353 2:221672463-221672485 ACAGAGCCACAGAGGAAGGGTGG - Intergenic
1169113150 20:3046007-3046029 ACCGTGCCCCGGAAGCGGCGCGG - Exonic
1169764333 20:9132785-9132807 CCATTGCCCTAGAGGCAGTGAGG - Intronic
1170795641 20:19544595-19544617 AAAATGCCCCAGAGGAAGAGTGG - Intronic
1171867632 20:30500110-30500132 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
1171907636 20:30912634-30912656 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1172623549 20:36334797-36334819 ACAGTGGCCTAGGGGCAGCTGGG + Intronic
1173811262 20:45957308-45957330 ACAGGGCCCCAGATGCCGCAGGG + Intronic
1174574286 20:51525778-51525800 ACAGAGCCACAGAGGAAGTGGGG - Intronic
1175289288 20:57863269-57863291 ACACTGCCCCAGAGAAAGCATGG + Intergenic
1175760703 20:61560753-61560775 GCAGTGCCCCAGAAGGAGCCCGG + Intronic
1176040047 20:63060552-63060574 ACAGAGCCCCAGGGCCAGCCAGG - Intergenic
1176181109 20:63749945-63749967 ACAGTGCCCCAGAGCCTGGGCGG - Intronic
1176207568 20:63897803-63897825 ACAGAGCCACAGAGGCTGCTTGG + Intronic
1178124556 21:29502674-29502696 AAAGTCCCGCAGAGGCAGTGTGG - Intronic
1178589625 21:33898450-33898472 TCTGTGCCCCAGAAGCAGCCTGG - Exonic
1178806797 21:35846103-35846125 ACAGGAGCCCAGAGGCAGTGTGG + Intronic
1179587738 21:42384376-42384398 AGAGTGCCCAAGGGACAGCGTGG + Intronic
1179727555 21:43348803-43348825 ACAGGGTCCCAGCCGCAGCGAGG + Intergenic
1180314283 22:11264784-11264806 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
1180341075 22:11618767-11618789 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1180883399 22:19222636-19222658 ACTGGGGCCCAGAGGCAGCCGGG + Intronic
1181294373 22:21823633-21823655 ACAGTGTACCAGAGAGAGCGTGG + Intronic
1181443915 22:22953724-22953746 GCAGTGCCCCAGGGTCAGCAAGG + Intergenic
1181522600 22:23458288-23458310 ACAGTGCCCCAGGCCCAGCCAGG + Intergenic
1183418747 22:37697775-37697797 ACAGAGCCCCAGGGGGAGGGTGG - Intronic
1184504845 22:44894484-44894506 ACGGTGCCACAGAGGCAGCATGG - Intronic
1185019446 22:48365611-48365633 ACAGTGTCCAGGAGGCAGCAGGG + Intergenic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950672739 3:14536964-14536986 ACAGTGCCCAAGTGGCAGTGTGG - Intronic
950788495 3:15454501-15454523 ACTGTGCACCAGAGGCAGAAGGG + Intronic
953750721 3:45606560-45606582 ACAGAGCCCCAGAGGCTCGGAGG + Intronic
954414505 3:50386566-50386588 ACAGGGCCCGAGACGGAGCGGGG - Intronic
960366365 3:116777574-116777596 ACAGTGGCCCAGGGAGAGCGAGG + Intronic
966325519 3:178749046-178749068 CAAGTGACCCAGAGGCAGCGTGG + Intronic
967980273 3:195061289-195061311 AGAGAGCCCCAGAGCCAGGGTGG - Intergenic
967980438 3:195062096-195062118 AGAGAGCCCCAGAGCCAGGGTGG - Intergenic
967994037 3:195153353-195153375 GCAATTCCCCAGAGCCAGCGGGG + Intronic
968222324 3:196948166-196948188 CGAGTGCCCCAGAGGTAGAGGGG + Exonic
968491731 4:893784-893806 GCAGTGCCCCAAGGGGAGCGGGG + Intronic
968648313 4:1750576-1750598 ACAGGGGCCCAGCGGCAGAGTGG + Intergenic
968742783 4:2339873-2339895 ACAGGGCCCCAGGAGCAGGGAGG + Intronic
969059805 4:4425687-4425709 AGAGGGGCCCAGAGGCAGCTCGG - Intronic
969422062 4:7103285-7103307 ACACTGCACCCGAGGCAGCCAGG - Intergenic
969555885 4:7909841-7909863 ACAGCCCCCCAGATGCAGCTAGG + Intronic
969691518 4:8706585-8706607 CCAGGGCCCCAGAGGGAGCGGGG + Intergenic
970216639 4:13765663-13765685 ACAAAGTCCCAAAGGCAGCGGGG - Intergenic
972599687 4:40561164-40561186 AAAGTGCCCAAGAGGCAGGATGG + Intronic
972834530 4:42853678-42853700 ACTCTGCCCCAGAGACAGAGGGG - Intergenic
973778464 4:54265691-54265713 CCAGTGACCAAGAGGCAGCATGG - Intronic
974145642 4:57943930-57943952 AGAGTGCGCCAGAGGCTGGGTGG + Intergenic
975033066 4:69647467-69647489 AAAGTGCACCAGAGGCAACTAGG + Exonic
979059946 4:116044643-116044665 ACAGTGCCCCAGGGGTAGGGAGG + Intergenic
980063928 4:128161375-128161397 CCAGAACCCCAGAGGCAGGGAGG + Intronic
991515428 5:67429632-67429654 ACAATGCCCCAGAAGAAGAGAGG - Intergenic
997675284 5:135708060-135708082 ACAGTGCCATAGAGCCAGCAGGG - Intergenic
999147720 5:149406937-149406959 AAAATGCCCCTGTGGCAGCGAGG + Intergenic
999171776 5:149601432-149601454 ACCGAGCCCCAGAGACAGAGAGG + Intronic
999779333 5:154836384-154836406 ACAATGCCCCAGATTCAGAGAGG + Intronic
1002025363 5:176393021-176393043 ACAGTGCCCCAGAGTAGGCTGGG - Intronic
1002793013 6:449288-449310 ACTGATCCCCAGAGGCAGGGAGG + Intergenic
1006119585 6:31795810-31795832 ACACTGCCCCGGGGGCCGCGCGG + Exonic
1006191573 6:32212846-32212868 CCAGTGGGGCAGAGGCAGCGGGG + Exonic
1006463391 6:34176974-34176996 TCAGTGTCCCTGAGGCAGGGTGG - Intergenic
1014724998 6:124962735-124962757 CCAGCGCCCCAGAGCCCGCGAGG + Exonic
1015959310 6:138631008-138631030 ACCATCCCCCAGTGGCAGCGTGG + Intronic
1016614461 6:146029698-146029720 AAAGTGCCCGAGAGGAAGTGTGG + Exonic
1016838396 6:148502540-148502562 GCAGTGCCCCTGAGGTAGGGAGG + Intronic
1017624667 6:156336381-156336403 ACAGTGCCGCTGAGTCAGAGTGG - Intergenic
1017688771 6:156942436-156942458 CCTGGGCCACAGAGGCAGCGTGG + Intronic
1018070686 6:160161760-160161782 GCAGAGCCCCAGAGTCAGTGCGG + Intergenic
1018864541 6:167736633-167736655 ACAGTGCTCCAGATGCGGCCTGG + Intergenic
1019563621 7:1669492-1669514 GCAGAGCCCCAGGGGCAGCCTGG - Intergenic
1021896056 7:25237085-25237107 AAACTGCCCAAGAGGCAGGGAGG - Intergenic
1022475571 7:30707458-30707480 ACCCTGCCGTAGAGGCAGCGTGG - Intronic
1024039148 7:45536285-45536307 ACAGTGCCTCAGTGCCAGCAGGG + Intergenic
1024604775 7:51014391-51014413 CCAGTGTCCAAGAGGCAGTGTGG + Intergenic
1024633494 7:51268122-51268144 ACAGTGCCCCAGACGGCACGTGG - Intronic
1027993706 7:85396592-85396614 ACAGTGTGCCTGAGGCAGTGAGG + Intergenic
1029595155 7:101533745-101533767 ACCGTCTCCCAGAGGGAGCGTGG - Intronic
1034433296 7:151051436-151051458 ACGGAGCCCCAGAGCCAGTGAGG - Intronic
1035171047 7:157017737-157017759 ACAGGGCCCCGGAGACTGCGGGG - Intergenic
1037746615 8:21650494-21650516 ACAGGGCCCCAGATACAGCTTGG - Intergenic
1037842566 8:22255781-22255803 ATGGTTCCCCAGAGGCAGCTGGG - Intergenic
1045393053 8:101734089-101734111 GCAGTGCCCCAGGAGCAGGGAGG + Intronic
1047348147 8:124048448-124048470 ACATTCCCCCAGAGGCAGCATGG - Intronic
1048371022 8:133776293-133776315 ACACTGCCCCGGAGGCTGCTGGG - Intergenic
1049063601 8:140295460-140295482 CTGCTGCCCCAGAGGCAGCGTGG - Intronic
1053415885 9:37946566-37946588 ACAGGGCCCCAGTGCCAGCCCGG + Intronic
1059641233 9:116218939-116218961 ACAGTGCACCAATGGCAGCATGG + Intronic
1059886034 9:118745614-118745636 ACAGGGCCCCAGATGCAAGGGGG + Intergenic
1060767600 9:126306753-126306775 ACAGAGCCCTGGAGGCAGCATGG - Intergenic
1187828519 X:23357102-23357124 GAAGAGCCCCAGAGGCAGCCTGG - Intronic
1193029088 X:76878886-76878908 GCAGTGCCCCAGTGGAAGTGGGG + Intergenic
1195684006 X:107569586-107569608 ACAGTGCATCAGAGCCAGCTGGG + Intronic
1196469113 X:116005409-116005431 ACAGAGTCCCAGAGACATCGTGG + Intergenic
1197765570 X:130057441-130057463 ACAATGCCACAGAGGGGGCGGGG - Exonic
1199488414 X:148372801-148372823 AAAGTGCCAAACAGGCAGCGTGG - Intergenic
1202378002 Y:24255634-24255656 AGAGTGGCCCAGGGGCAGCAGGG - Intergenic
1202492780 Y:25414487-25414509 AGAGTGGCCCAGGGGCAGCAGGG + Intergenic