ID: 1096216714

View in Genome Browser
Species Human (GRCh38)
Location 12:49801762-49801784
Sequence GGCACGTGAGAAGACAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 196}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096216705_1096216714 19 Left 1096216705 12:49801720-49801742 CCCAGAATGGAAGGTGGACAGCT 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1096216714 12:49801762-49801784 GGCACGTGAGAAGACAGTGATGG 0: 1
1: 0
2: 1
3: 20
4: 196
1096216704_1096216714 20 Left 1096216704 12:49801719-49801741 CCCCAGAATGGAAGGTGGACAGC 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1096216714 12:49801762-49801784 GGCACGTGAGAAGACAGTGATGG 0: 1
1: 0
2: 1
3: 20
4: 196
1096216703_1096216714 21 Left 1096216703 12:49801718-49801740 CCCCCAGAATGGAAGGTGGACAG 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1096216714 12:49801762-49801784 GGCACGTGAGAAGACAGTGATGG 0: 1
1: 0
2: 1
3: 20
4: 196
1096216706_1096216714 18 Left 1096216706 12:49801721-49801743 CCAGAATGGAAGGTGGACAGCTG 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1096216714 12:49801762-49801784 GGCACGTGAGAAGACAGTGATGG 0: 1
1: 0
2: 1
3: 20
4: 196
1096216701_1096216714 26 Left 1096216701 12:49801713-49801735 CCATACCCCCAGAATGGAAGGTG 0: 1
1: 0
2: 2
3: 11
4: 146
Right 1096216714 12:49801762-49801784 GGCACGTGAGAAGACAGTGATGG 0: 1
1: 0
2: 1
3: 20
4: 196
1096216711_1096216714 -9 Left 1096216711 12:49801748-49801770 CCTGCTTCCCTAGGGGCACGTGA 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1096216714 12:49801762-49801784 GGCACGTGAGAAGACAGTGATGG 0: 1
1: 0
2: 1
3: 20
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096216714 Original CRISPR GGCACGTGAGAAGACAGTGA TGG Intronic
900939386 1:5788224-5788246 AGCAAGAGAGAAGACAGGGAGGG + Intergenic
905419826 1:37833772-37833794 GGCATTTGAGTAGAGAGTGAAGG + Intronic
907491355 1:54810831-54810853 GGCACATGAGAAGTCAGGGTGGG - Intronic
910042212 1:82866545-82866567 TTCACTTGAGGAGACAGTGAAGG + Intergenic
910514840 1:88048412-88048434 GGCACATTAGAAGTAAGTGAAGG + Intergenic
915631653 1:157157311-157157333 GGCAAGTGAGAAGAAGGTGAGGG + Intergenic
916522791 1:165580270-165580292 GGCAGGAGAGAAGAAAGGGAGGG + Intergenic
918113110 1:181475602-181475624 GGTACGTGAGGAGATAGTGTTGG + Intronic
918507936 1:185278320-185278342 GCCATGTGAGAACACAGAGAAGG + Intronic
921101459 1:211932634-211932656 GACAGCTGAGAAGAGAGTGACGG - Intergenic
921796224 1:219347700-219347722 GACATGTGAGAAGAAAGTAATGG - Intergenic
1063092408 10:2878943-2878965 GGCAGGTGAGAAGGCAGTAATGG - Intergenic
1063972117 10:11388460-11388482 GGCAGGAGAGAAGAGAGGGAAGG + Intergenic
1064091718 10:12391057-12391079 TTCACGAGAGAAGACAGTGTTGG - Intronic
1065779386 10:29152659-29152681 GACACGTGGCAAGACAGAGAAGG + Intergenic
1068612833 10:59079134-59079156 GGCAGGAAACAAGACAGTGAAGG - Intergenic
1072374694 10:94802912-94802934 GACAAGCGAGAAGAGAGTGAGGG - Intronic
1072838318 10:98741337-98741359 GGCACTTTAAAAGACAATGATGG + Intronic
1073846225 10:107558081-107558103 GACAAAAGAGAAGACAGTGATGG + Intergenic
1075554725 10:123422034-123422056 GCCAGGTGACAAGACAGAGAAGG - Intergenic
1083772737 11:64877653-64877675 GACACTTAAGAAGACAGGGAGGG + Intronic
1083937924 11:65880071-65880093 GGCACATGGGAAGACAGAAAAGG + Intronic
1084534037 11:69746351-69746373 GGCCTGTGTGAGGACAGTGAGGG + Intergenic
1087517357 11:99181075-99181097 GGCAGGGGAGAATACTGTGATGG + Intronic
1088739470 11:112755359-112755381 GGAAGGAGAGAAGACAGAGATGG + Intergenic
1088868458 11:113871301-113871323 AGCAAGGGAGAAGACAGTGAAGG + Intronic
1089199234 11:116713865-116713887 GCCACGTGAGGACACAGAGAAGG - Intergenic
1090268895 11:125371798-125371820 GAGCAGTGAGAAGACAGTGAGGG + Intronic
1090616172 11:128517261-128517283 GGCAGGTGAGAAGGCAATGCTGG - Intronic
1096054999 12:48643075-48643097 GGCAAGTGAGAAGCAGGTGAGGG + Intergenic
1096216714 12:49801762-49801784 GGCACGTGAGAAGACAGTGATGG + Intronic
1097282522 12:57853399-57853421 GGAAAGTGAGAAGACTGGGAAGG + Intergenic
1097899605 12:64859515-64859537 GGCCTGTGAGGAGGCAGTGAAGG + Intronic
1099017111 12:77357260-77357282 GGCATGTGAAAAGCCAATGAAGG - Intergenic
1100034178 12:90231050-90231072 GGGAAGTGAGAAAGCAGTGAGGG - Intergenic
1100071959 12:90732222-90732244 GGAATGTGAGATGACAGAGAAGG + Intergenic
1101579253 12:106027086-106027108 GGAAAGTGAGCAGACAGTGCAGG + Intergenic
1101696874 12:107135081-107135103 GGCTGGAAAGAAGACAGTGAAGG - Intergenic
1103023691 12:117556704-117556726 GGCAAGTGAGAGGACAGGGAAGG + Intronic
1103548089 12:121715866-121715888 GGAACGTGAGAAGGCAGAGAGGG - Intronic
1105349667 13:19603583-19603605 GGCAACTGAGAAGACAGACAGGG - Intergenic
1107663007 13:42658700-42658722 GGGCCGTGAGTAGACACTGAGGG - Intergenic
1108172750 13:47760066-47760088 GGCACATGAGAGGAGAGAGAAGG - Intergenic
1109643719 13:65224996-65225018 ACCACGTGAGAACACAGTGAGGG + Intergenic
1112015878 13:95331013-95331035 GGTAGGTGAGAAGACACTGCTGG - Intergenic
1112375473 13:98836115-98836137 GGCACCTGTGAGAACAGTGACGG - Intronic
1112512738 13:100024316-100024338 GGAAGGTGAAGAGACAGTGATGG + Intergenic
1113921319 13:113914512-113914534 CGCACGTGAGCTGACAGTGGAGG + Intergenic
1114738837 14:25072181-25072203 GGAAAGTGAGCAGACAGAGAGGG - Intergenic
1114822375 14:26036691-26036713 CGCACGTGCAAAGACAGAGATGG - Intergenic
1117430252 14:55651346-55651368 GGCCTGTGAGAAGAGAGTGGAGG + Intronic
1117460231 14:55938154-55938176 GCCAAGAGACAAGACAGTGAAGG + Intergenic
1119424914 14:74528830-74528852 AGCACGTGAGCAGGCAGGGAAGG + Intronic
1120267466 14:82269590-82269612 GGAAGGAGAGAAGACAGGGAAGG + Intergenic
1121383219 14:93492825-93492847 TGCACTTGAGAATTCAGTGATGG + Intronic
1124335549 15:28853859-28853881 GGCAGGAGAGAAGAAAGGGAGGG - Intergenic
1125004309 15:34800076-34800098 ATCATGTTAGAAGACAGTGACGG - Intergenic
1125328385 15:38560010-38560032 GGAAAGAGAGAAGGCAGTGAGGG + Intronic
1125506799 15:40271951-40271973 TGCACCTGGGAAGACAGAGAAGG - Intronic
1127626624 15:60786510-60786532 GGCAGGTGGGAAGACAGAGATGG + Intronic
1128529516 15:68434198-68434220 GGCACCTGTGAGGACGGTGAAGG - Intergenic
1129230542 15:74194910-74194932 GGCAAGTGCGAAGTCAGGGATGG - Intronic
1130972127 15:88741641-88741663 GCCACCTGAGAAGGCAGTAAAGG - Intergenic
1131940842 15:97563187-97563209 GGGATGTGAGGAGACAGTGAAGG - Intergenic
1132229025 15:100168133-100168155 GGCAGGTGTGCAGACAGGGAGGG + Intronic
1133551308 16:6856946-6856968 GGGACATGAGAAGAAAGGGAGGG + Intronic
1134600545 16:15530311-15530333 GGCACTTGTGATGACATTGAGGG + Intronic
1134851814 16:17485012-17485034 GTCACATAAGAAGACAGAGAAGG + Intergenic
1136029340 16:27491568-27491590 GGCATCTGAGAAGCCAGTGTGGG + Intronic
1138093696 16:54195935-54195957 GGAAAGTGAGAAGAGAGGGAAGG + Intergenic
1138983316 16:62296994-62297016 GGCACTTAAGAAGACAGTGGAGG + Intergenic
1139825919 16:69757056-69757078 GGCTCGTGAGAAGCCAGAGATGG - Intergenic
1141354005 16:83326300-83326322 GGTAAGAGAGAAGATAGTGATGG - Intronic
1141434097 16:83989359-83989381 GGCACATGAGAAGACAGCTAAGG - Intronic
1141863120 16:86731524-86731546 GACATGTGAGAAGGCGGTGATGG + Intergenic
1142503065 17:344681-344703 GGTAACTGAGATGACAGTGATGG - Intronic
1143096432 17:4480853-4480875 GGCAGGTGGGAAGGCAGGGAAGG - Intronic
1143283101 17:5769544-5769566 AGCATGTGTGAAGACACTGAGGG - Intergenic
1143615528 17:8047113-8047135 GGGACGTGGGAAGACAGGAAAGG + Intronic
1144682959 17:17207024-17207046 TGCTCCCGAGAAGACAGTGAAGG - Exonic
1144833481 17:18144459-18144481 GGCACATGAGCAGACAGAGCTGG - Intronic
1145873269 17:28294345-28294367 GGCATAAGAGAAGACAGAGATGG + Intergenic
1146012925 17:29209951-29209973 GGCATGTGTGAAGGCAGAGAGGG + Intergenic
1146252037 17:31354900-31354922 GGAAGGGGAGAAGACTGTGAAGG + Intronic
1146566239 17:33915441-33915463 GGCAAGTAGGAAGACATTGAAGG - Intronic
1147311938 17:39600616-39600638 GGCACCTGAGGAGAAAGAGAAGG - Intergenic
1147715722 17:42506833-42506855 GGCACGTGGGCAGACGCTGATGG - Intronic
1149043645 17:52219741-52219763 GGGAAGTGAGAGGAAAGTGATGG + Intergenic
1151162978 17:72181433-72181455 GGCTGGTGTGAAGTCAGTGAAGG - Intergenic
1151375268 17:73684190-73684212 GACACTTGAGCAGAGAGTGAAGG + Intergenic
1153153724 18:2125742-2125764 GGAGCTTGAGAAGTCAGTGAGGG - Intergenic
1153642480 18:7168617-7168639 TGCAGGTGTGAAGACAGTGGTGG + Intergenic
1154412675 18:14149826-14149848 GGGAAGTGAGAGGACAGAGACGG + Intergenic
1155090783 18:22508012-22508034 GGAAGGTGGGAGGACAGTGAGGG + Intergenic
1158186866 18:54780530-54780552 GCCACGCGAGGACACAGTGAGGG - Intronic
1158480373 18:57816642-57816664 GGCCCGTGAGAAGACTGAGGAGG + Intergenic
1158546044 18:58397986-58398008 GGCATGTGAGAAGCCATGGAAGG + Intronic
1159555754 18:69942881-69942903 GGGAAGAGAGAAGACAGAGAGGG - Intronic
1162526646 19:11210234-11210256 GACAGGTGAAGAGACAGTGAGGG - Intronic
1162526655 19:11210276-11210298 GACAGGTGAAGAGACAGTGAGGG - Intronic
1162735990 19:12747366-12747388 GGCACGAGAGAGGACAGTGAGGG - Intronic
1163079852 19:14931009-14931031 GAAACGTGAGAAGATAATGAAGG - Intergenic
1165787341 19:38469527-38469549 GGCAGATGAGAAGGCATTGAGGG - Intronic
1166311760 19:41967087-41967109 GACCCGTGAGAAGACAGAGTGGG + Intronic
1167246667 19:48377128-48377150 GGCGTGTGAGGAGTCAGTGAAGG + Intergenic
925575692 2:5357717-5357739 GGCACGTGATCTGAGAGTGAGGG + Intergenic
925747991 2:7060697-7060719 TGCAGGTGAGAAGAGAGTAAGGG - Intronic
925951430 2:8915937-8915959 GGAGGGTGAGATGACAGTGATGG - Intronic
927093506 2:19729980-19730002 AGGATGAGAGAAGACAGTGAGGG - Intergenic
928210304 2:29319046-29319068 GACAGGGGAGAAGAGAGTGAAGG - Intronic
928370064 2:30734239-30734261 GGCACGTGAGAACTCAGACAGGG + Intronic
929077185 2:38087680-38087702 GGCACCTGAGACGAGAGTGGAGG - Intronic
932300267 2:70662196-70662218 AGAACATGAGAAGACAGTGTTGG + Exonic
933702978 2:85269034-85269056 GGTACATGAGAAGAGAGAGATGG + Intronic
935081097 2:99795402-99795424 GGCAGGTGGGAGGGCAGTGAGGG + Intronic
936068555 2:109350082-109350104 GGCTCCTGAGTAGTCAGTGATGG + Intronic
936982351 2:118276404-118276426 GCCATGGGAGAGGACAGTGAGGG + Intergenic
941434562 2:165453218-165453240 GGCAGGTGATAAGGCAGGGAAGG + Intergenic
943081371 2:183262038-183262060 TGCACCTGAGAATACAGTGCAGG - Intergenic
946660163 2:221991123-221991145 AGCAAGTGAGAAGAAAGTGAAGG + Intergenic
947925473 2:233918436-233918458 GGCACCTGTGAAGACAGTAGGGG + Intronic
1170296280 20:14829669-14829691 GGCATGTGTGGACACAGTGATGG - Intronic
1170363785 20:15577783-15577805 GTCACGGGAGAAAACAATGAGGG - Intronic
1172941176 20:38655831-38655853 GGGAGGGGAGAAGCCAGTGAAGG + Intergenic
1173310410 20:41891970-41891992 GGCAGGTGAGAAGGCTGTAAGGG - Intergenic
1173418933 20:42883481-42883503 GGAAAGTGAGTAGACAGGGAAGG + Intronic
1174936223 20:54872923-54872945 AGCAAGAGAGAAGACAGGGAAGG + Intergenic
1174977028 20:55347532-55347554 GGCACTTGAAGAGTCAGTGAAGG - Intergenic
1175245771 20:57581160-57581182 GGCTCGTGAGAGGACAGCAAAGG - Intergenic
1176860331 21:14008429-14008451 GGGAAGTGAGAGGACAGAGACGG - Intergenic
1180168303 21:46041478-46041500 GACACGTGTGAAGGAAGTGAGGG - Intergenic
1181484506 22:23222122-23222144 GACAGGTGAGAAGACGGGGAGGG - Intronic
950567378 3:13778303-13778325 GCCATGTGAGGACACAGTGATGG + Intergenic
950713164 3:14828297-14828319 GGCACTTGAGTAGACATTGCAGG + Intronic
952569159 3:34693660-34693682 GCCAAGTGAGAAAACAGAGAAGG + Intergenic
952781993 3:37109994-37110016 GGCAAGTAAGAAAACACTGAGGG + Intronic
954302592 3:49707873-49707895 GGGTCTTGAGAAGACAGTGTGGG - Intronic
956344643 3:68264870-68264892 TGCATCTGAGAAGACAGAGATGG + Intronic
960675288 3:120187955-120187977 GCCAAGTGAGAAGACAGTGCAGG + Intronic
961160708 3:124722332-124722354 GGGAAGTGAGAAGACAGGAAAGG + Intronic
961222233 3:125210437-125210459 TGCACATGAGGAGACACTGAAGG + Intronic
962965976 3:140354820-140354842 GGCAACTTCGAAGACAGTGAGGG - Intronic
963652528 3:147999909-147999931 GAGAAGTAAGAAGACAGTGAAGG - Intergenic
963951559 3:151207696-151207718 GGAAGGTGAGAAGCCAGTTAAGG + Intronic
966960324 3:184929986-184930008 GGAATTTGAGAAGCCAGTGAAGG + Intronic
967456053 3:189687761-189687783 GGTAGAAGAGAAGACAGTGAGGG - Intronic
967968089 3:194978235-194978257 GGAGCGTGAGAATACAGAGATGG + Intergenic
968187081 3:196640184-196640206 AGCATGTGAGCAGACAGTTAAGG + Intronic
968920402 4:3519358-3519380 GGCAGGTGGGATGACAATGAGGG - Intronic
969137081 4:5038040-5038062 GTCACTTGAGAACACAGTGTTGG - Intergenic
972730533 4:41790291-41790313 AGCAAGAGAGAAGAGAGTGAAGG + Intergenic
974557231 4:63466611-63466633 GACACGTGAAAAAACAGTGAAGG - Intergenic
979266274 4:118706654-118706676 GGCACTTCAGAAGACAGTCTTGG - Intronic
981328286 4:143477423-143477445 GGCACTTGGGAAGGCAGAGAAGG + Intergenic
984273935 4:177584655-177584677 GTCACAGGAGAAGACAGTGATGG - Intergenic
985861989 5:2478359-2478381 CGCACGTGAGCAGACAGGGCCGG - Intergenic
986052494 5:4103113-4103135 TGTCCGTGAGAAGACAGGGAGGG + Intergenic
986393955 5:7309972-7309994 GGCAGGAGAGAAGAAAGGGAGGG - Intergenic
991074871 5:62523847-62523869 GGGACATGAGAAGACAGCCAAGG + Intronic
991602655 5:68368988-68369010 GGCATGTGAATGGACAGTGATGG - Intergenic
993541813 5:89160996-89161018 TACAAGTGAGAAGACAGTGGGGG + Intergenic
994847673 5:105010913-105010935 GTCCTGTGAGAGGACAGTGAGGG + Intergenic
998977506 5:147664407-147664429 GACAGGTGAGGAGACAGAGAGGG - Intronic
1001809804 5:174618974-174618996 GGATCAGGAGAAGACAGTGAAGG - Intergenic
1002108521 5:176892429-176892451 GGCAGGTGAGAAGGCAGGGAAGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1004671263 6:17799934-17799956 GTCGGGTGAGAGGACAGTGATGG - Exonic
1005360674 6:25028122-25028144 GGTATCTGAGAATACAGTGAAGG - Intronic
1007135950 6:39522103-39522125 GGAAAGTGAGATGTCAGTGAAGG - Intronic
1007238638 6:40409362-40409384 TGCAAGTGAGAAAACTGTGAAGG - Intronic
1011139463 6:84136382-84136404 GGCAGGTGATGAGACAGAGAGGG + Intronic
1012122916 6:95389233-95389255 GGAAAGTGAGAGGACAGTGGAGG + Intergenic
1012862223 6:104573578-104573600 AGCACTTGAGTAGGCAGTGATGG - Intergenic
1014693830 6:124594743-124594765 AGCAAGAGAGAGGACAGTGAGGG + Intronic
1014832285 6:126116876-126116898 GGAAAGTGTCAAGACAGTGAAGG - Intergenic
1016107046 6:140175786-140175808 GGCACTTGACAAGACACTGTAGG - Intergenic
1016443176 6:144105935-144105957 GGCACATGAGGACACAGAGAAGG - Intergenic
1016525540 6:144997964-144997986 GGGAAGTGAGGAGAGAGTGAGGG + Intergenic
1018216080 6:161529248-161529270 GGAAGGTGAGAAGACAATGATGG + Intronic
1023687517 7:42751807-42751829 GGAAAGTGAGAGGAAAGTGAGGG + Intergenic
1023982637 7:45078765-45078787 GGGACGTCAGAAGGCGGTGAGGG + Intergenic
1023982691 7:45079029-45079051 GGGACATCAGAAGGCAGTGAGGG + Intergenic
1023982717 7:45079170-45079192 GGGACATCAGAAGGCAGTGAGGG + Intergenic
1024317863 7:48037616-48037638 GGCAAATGAGAAGGCAGGGAAGG + Intronic
1026202687 7:68228437-68228459 GACACGTGAAAAGGCAGAGAAGG + Intergenic
1027193399 7:76011279-76011301 GTGAGGTGAGAAGGCAGTGAGGG - Intronic
1028513634 7:91652163-91652185 GTGAGGTGAGAAGACAGGGAGGG - Intergenic
1031076676 7:117220017-117220039 GGCAGGAGAGAGGACAGAGAAGG - Intronic
1032135428 7:129272535-129272557 GGACCTTGAGAAGACAGTGAAGG + Intronic
1032321199 7:130887994-130888016 GGCAGGGGTGAAGACAGTGGGGG + Intergenic
1032846963 7:135759257-135759279 GGGATGAGAGAAGACAGAGAGGG + Intergenic
1037983954 8:23275052-23275074 GGCAATAGAAAAGACAGTGAAGG - Intronic
1040703403 8:50095160-50095182 GGAAAGTGGGAGGACAGTGAGGG + Intronic
1042309920 8:67369709-67369731 GGCCCTTGAGAAGACAGTTCTGG - Intergenic
1043624423 8:82238195-82238217 GGCAAGACAGAAGAAAGTGATGG - Intergenic
1044124646 8:88442557-88442579 GGTACAAGAGAAGACAGTGTAGG - Intergenic
1048173137 8:132127558-132127580 GGCTCTTGACAAGACTGTGAGGG + Exonic
1049329916 8:142044935-142044957 GGCACGTGAGGAGAGGGGGAGGG - Intergenic
1050362899 9:4847677-4847699 GGAAAGTGAGAAGCCAGTGAAGG - Intronic
1051064311 9:13083729-13083751 GGCAGGGGAGAAGTCTGTGAGGG - Intergenic
1052216575 9:25973138-25973160 GGCACTTTATAAGACAGAGATGG + Intergenic
1055599373 9:77899655-77899677 GGCACGTGCAAAGGCAGTGCAGG + Intronic
1056476109 9:86952659-86952681 AGGACATGAGAAGACAGGGAGGG - Intergenic
1059436328 9:114278774-114278796 GCCAAGTGATAAGGCAGTGAGGG + Intronic
1060417906 9:123445568-123445590 GGGACATAAGAAGACAGAGAGGG + Intronic
1060967495 9:127720115-127720137 AGCATGTGAGAAGACATTCAGGG - Exonic
1061405637 9:130391751-130391773 GGGAGGTGAGAAGAGAGTCAGGG + Intronic
1203791726 EBV:155249-155271 GGCACCTGCGAAGACATAGAGGG - Intergenic
1186445005 X:9619820-9619842 GGCACTGGAGAAGAAACTGAAGG - Intronic
1187275957 X:17816851-17816873 GGAACGTGAGTTGAAAGTGAGGG + Intronic
1187895712 X:23977827-23977849 GGCAAGTGGGAAGGCATTGAAGG - Intergenic
1190492232 X:50993687-50993709 AGCAAGTGAGAAGTCAGTGAGGG + Intergenic
1191048099 X:56161216-56161238 TGCAAGTGAGAAGAGAGTGGGGG - Intergenic
1192919891 X:75695655-75695677 GAGAAGTGAGAAGACATTGAGGG + Intergenic
1195112841 X:101664726-101664748 GGCTAGTGAGAACACATTGAGGG - Intergenic
1197840431 X:130740491-130740513 GGAAAGAGAGAAGTCAGTGAGGG + Intronic
1200160861 X:154008038-154008060 GGCAAGTGAGAAAACAGACAAGG + Intergenic
1200758383 Y:7013315-7013337 GGGAGGTGAGAAGAGAGAGAAGG - Intronic