ID: 1096230056

View in Genome Browser
Species Human (GRCh38)
Location 12:49891805-49891827
Sequence ACGTCCAGTGGGAGGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096230048_1096230056 8 Left 1096230048 12:49891774-49891796 CCTGTCGGGTGAATTTTTATATC 0: 1
1: 0
2: 3
3: 4
4: 101
Right 1096230056 12:49891805-49891827 ACGTCCAGTGGGAGGCTGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096230056 Original CRISPR ACGTCCAGTGGGAGGCTGGC AGG Intronic
900035329 1:402929-402951 AGGTCCAGTGGCAGCCTGACTGG + Intergenic
900056950 1:638682-638704 AGGTCCAGTGGCAGCCTGACTGG + Intergenic
900688149 1:3962337-3962359 ATGTCCAGTGTTAGGCTGTCTGG - Intergenic
900766909 1:4511978-4512000 TCCTCCAGTGTGAGGCTGGAGGG + Intergenic
901151692 1:7107652-7107674 ACGCTCTGTGGGAGCCTGGCCGG + Intronic
902830466 1:19009191-19009213 AAGGCCAGTGGGAGGGTGGGGGG - Intergenic
902860639 1:19242793-19242815 CTGTCCATTGGGAGGCAGGCAGG - Intronic
902983921 1:20143916-20143938 GCCTCCAGTGTGAGGCAGGCAGG - Intronic
903970633 1:27116665-27116687 ACATCCAGTGTGTAGCTGGCTGG + Intronic
904343497 1:29853191-29853213 CTGTCCCGGGGGAGGCTGGCTGG - Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906701178 1:47859297-47859319 CCAGCCAGTGTGAGGCTGGCTGG - Intronic
908354802 1:63319026-63319048 GCGTCCAGTGGGGGGATGGGGGG - Intergenic
910771333 1:90835580-90835602 ACGTCCAGCAGGAGGCTGAGAGG + Intergenic
915316211 1:155030416-155030438 ACCTCCAGTGAGGGGCTGCCGGG - Exonic
917846959 1:179027085-179027107 ACCTCCAGAGGGAAGCTGGCTGG - Intronic
918041491 1:180916612-180916634 ACGTCCAGGGGCAGGCGGCCTGG - Exonic
920251434 1:204624776-204624798 GGGTCCAGAGGGAGGGTGGCAGG + Intronic
922156874 1:223047494-223047516 AAGTCCCGTGGCAGGCTGTCTGG + Intergenic
924308893 1:242719787-242719809 AAGTCCAGGGGAAGGCAGGCAGG - Intergenic
924855290 1:247869383-247869405 ACACCCAGTGGGAGGCTTTCTGG + Intronic
1064293726 10:14058657-14058679 ATGACCAGAGGGAGGTTGGCTGG + Intronic
1064293894 10:14060310-14060332 ACAACCAGCGGGAGGTTGGCTGG + Intronic
1067838226 10:49654666-49654688 ACCTCCAGAGGGAGGCAGGGAGG - Intronic
1069628701 10:69883854-69883876 GACTGCAGTGGGAGGCTGGCTGG + Intronic
1070288296 10:75099326-75099348 TCACCCAGTGGGAGGCTGTCGGG + Intronic
1073129605 10:101178801-101178823 AAGGCTAATGGGAGGCTGGCAGG - Intergenic
1076880262 10:133236416-133236438 CCCTCAAGGGGGAGGCTGGCGGG - Intergenic
1077068581 11:656605-656627 AGGTGGGGTGGGAGGCTGGCGGG + Intronic
1077097146 11:803891-803913 ACCCCCAGTGTGGGGCTGGCTGG - Intronic
1084661378 11:70548487-70548509 GAGTTTAGTGGGAGGCTGGCCGG + Intronic
1084967784 11:72753410-72753432 ATGGCCAGTGGGGGGCAGGCAGG - Intronic
1086752539 11:90515560-90515582 AAGTGTAGTGGGGGGCTGGCTGG + Intergenic
1091101461 11:132877630-132877652 AAGTCCTATGGGAAGCTGGCTGG + Intronic
1091273371 11:134332940-134332962 ACCTCCAGTGGGAAGCCGACCGG + Intronic
1091847211 12:3666577-3666599 AGTTCCTGTGGGAGGCTGGCAGG - Intronic
1096230056 12:49891805-49891827 ACGTCCAGTGGGAGGCTGGCAGG + Intronic
1102059245 12:109920398-109920420 GCTTACAGTAGGAGGCTGGCGGG + Intronic
1102934039 12:116882015-116882037 GCGCCCGGTGGGAGGCTGGATGG + Intergenic
1104105279 12:125653111-125653133 AGGTGCATTGTGAGGCTGGCTGG - Intronic
1107678823 13:42825966-42825988 ACTGCCTGTGGGAGGGTGGCAGG - Intergenic
1111101774 13:83597666-83597688 AGGTCCAGTGTTAGGCTGACAGG + Intergenic
1112328835 13:98461959-98461981 ACGTTCAGGGGGAGGCCGCCTGG + Intronic
1113681153 13:112246042-112246064 AGGTCCAGTTGGACGCAGGCCGG - Intergenic
1118774788 14:68967026-68967048 GCGTCCAATGGTAGGCTGGTTGG - Intronic
1122228544 14:100293389-100293411 GGGTCCAGTGAGAGGCAGGCAGG + Intronic
1122953743 14:105060431-105060453 AGGCCCAGTGTGAGGCTGGTCGG - Intronic
1123931013 15:25171682-25171704 ACCTCCAGTGGGACACGGGCTGG - Intergenic
1124189881 15:27565494-27565516 ACATCCAGTGGGAGGAAGCCAGG - Intergenic
1124222558 15:27863059-27863081 ACCATCAGCGGGAGGCTGGCAGG + Intronic
1127047601 15:55043412-55043434 AGGTCCTGTGGCAGGCAGGCTGG + Intergenic
1131514035 15:93065769-93065791 ACCTTCCGTGGTAGGCTGGCTGG + Intronic
1132005433 15:98222295-98222317 TCCTTCAATGGGAGGCTGGCAGG + Intergenic
1132099770 15:99015075-99015097 ACGTCGAGTGCGGGGCCGGCGGG + Intergenic
1132775325 16:1590492-1590514 AGGTCCAGAGAGAGCCTGGCAGG - Intronic
1132855310 16:2042312-2042334 GTGTCCACTGAGAGGCTGGCAGG + Intronic
1132869158 16:2108018-2108040 GCCTGCAGAGGGAGGCTGGCGGG - Exonic
1132987795 16:2777123-2777145 ACGTCCTGGGGGCGGCGGGCCGG + Exonic
1134266732 16:12699393-12699415 ACCTGCACTTGGAGGCTGGCAGG + Intronic
1134550210 16:15135415-15135437 GCCTGCAGAGGGAGGCTGGCGGG - Intronic
1134718259 16:16367580-16367602 GCCTGCAGAGGGAGGCTGGCGGG + Intergenic
1134956493 16:18384579-18384601 GCCTGCAGAGGGAGGCTGGCGGG - Intergenic
1136594651 16:31239702-31239724 ACGGGCAGTGAGAGGCTGCCGGG - Intergenic
1137404223 16:48177178-48177200 CCCTACAGCGGGAGGCTGGCAGG - Intronic
1138230120 16:55330534-55330556 AGGCCAAGTGGGAGGCTGGGAGG + Exonic
1139319028 16:66097937-66097959 ACGGGCAGGGGGAGGCTGGTGGG - Intergenic
1141524560 16:84603468-84603490 ACCTCCAGGGGGAGGCTTGCTGG - Intronic
1142137502 16:88458401-88458423 ACCTCCAGGGAGGGGCTGGCGGG - Intronic
1142496619 17:309588-309610 ACCCCCAGCAGGAGGCTGGCAGG - Intronic
1142496659 17:309701-309723 ACCCCCAGCAGGAGGCTGGCAGG - Intronic
1143010846 17:3865484-3865506 GCTTCCTGTAGGAGGCTGGCGGG - Exonic
1147538227 17:41334758-41334780 AGGCCCTGTGGGGGGCTGGCAGG - Intergenic
1147669299 17:42167589-42167611 AGGTCCAGAGAGAGGCTGCCCGG - Intronic
1148177814 17:45583073-45583095 ACTTGCCCTGGGAGGCTGGCTGG - Intergenic
1148459195 17:47828499-47828521 ACCTCCTGTGGGGGGCTGGGAGG + Exonic
1148618420 17:49016759-49016781 CTGTCGAGTGGCAGGCTGGCAGG - Intronic
1149687943 17:58549018-58549040 ACATCCAGTTGGGGGATGGCAGG + Intergenic
1150494556 17:65597341-65597363 ACCTCCAGTGTGAGACTGGACGG - Intronic
1152026876 17:77815675-77815697 GGGGCCAGTGGGAGGCAGGCTGG - Intergenic
1152333025 17:79684658-79684680 ACGTCCATTGTGCCGCTGGCTGG + Intergenic
1152740533 17:82016561-82016583 AGGTCCAGGGACAGGCTGGCTGG - Intronic
1153960268 18:10134402-10134424 AGAGCCACTGGGAGGCTGGCAGG - Intergenic
1154087922 18:11325292-11325314 AAGGACAGTGGGACGCTGGCAGG + Intergenic
1154454724 18:14510404-14510426 AGCTCAAGTGGGGGGCTGGCTGG + Intronic
1159754781 18:72351001-72351023 TGGTCCAGGGGCAGGCTGGCTGG - Intergenic
1161104686 19:2437344-2437366 AGGCCCTGTGGGAGGCTGGACGG + Intronic
1161562552 19:4981552-4981574 ACGTCCAGGTGGAGGCTGCTGGG - Intronic
1161797196 19:6393858-6393880 ACGTCGCGGGGGCGGCTGGCTGG + Intronic
1163123840 19:15233480-15233502 ACGTACAGGGGCGGGCTGGCGGG - Intergenic
1164064800 19:21706594-21706616 TGGTGCAGAGGGAGGCTGGCTGG - Intergenic
1166033724 19:40152234-40152256 AGGTCCAGAGGAAGGCTGCCTGG + Intergenic
1166395830 19:42440474-42440496 ACGTCGAGTGGGTGGCGGCCGGG - Intronic
1167612843 19:50515497-50515519 CGGTTCAGTGGGAGGCTGGAGGG - Intergenic
1167849249 19:52189637-52189659 ACGTCCTGTGGGGAGCTGGAGGG - Intergenic
925341360 2:3140053-3140075 AAGACAACTGGGAGGCTGGCAGG - Intergenic
925375320 2:3379855-3379877 AGCTCCAGTGGGCGGGTGGCAGG + Exonic
925893865 2:8456873-8456895 TCGTCCACTGTGAGGCTGGGGGG + Intergenic
926146510 2:10399805-10399827 ACGTGGAGAGGGAGGCTGGTAGG - Intronic
934097911 2:88624678-88624700 ACATCCAGAGGGAGGTAGGCGGG - Intronic
938139196 2:128782616-128782638 ACATGCAGTGGGAGGGTGACGGG + Intergenic
938802122 2:134773387-134773409 AGCCCCAATGGGAGGCTGGCCGG + Intergenic
940909476 2:159197499-159197521 AATTCGAGTGGGAAGCTGGCTGG + Intronic
943154569 2:184157894-184157916 AAGTATAGTGGGGGGCTGGCAGG - Intergenic
944603762 2:201330912-201330934 ACTTCCTGTGGGAGGGTGGAGGG - Intronic
944686348 2:202121230-202121252 AAGTCCAGAGGTAGGCAGGCAGG - Intronic
948212946 2:236208484-236208506 AGGGCCAGTGGGAGGGTCGCTGG - Intronic
948478340 2:238235474-238235496 ACGTCCAGTTGGAGGGCGGCAGG + Intergenic
948478351 2:238235527-238235549 ACGTCCAGTTGGAGGTCGGCAGG + Intergenic
948679931 2:239626956-239626978 ACTTCCAGAGGGAGGCTGACAGG + Intergenic
949012701 2:241690374-241690396 AAGTCCAGTGTTAGGCAGGCAGG + Intergenic
949086340 2:242158987-242159009 AGGTCCAGTGGCAGCCTGACTGG - Intergenic
1169073811 20:2749764-2749786 AGGCCCAGAGGGAGACTGGCGGG - Intronic
1169197951 20:3693433-3693455 ACGTCCTCTGTGAGTCTGGCTGG - Exonic
1173109557 20:40174037-40174059 AACGCCAGTGGGAGGCTGGTGGG + Intergenic
1175822408 20:61917473-61917495 CCTTCCTGTGGGAGGCTCGCAGG + Intronic
1176039194 20:63055656-63055678 AGCTCCCGTGGGAGGCTGCCAGG - Intergenic
1176145722 20:63564578-63564600 ACGTCCTGGCAGAGGCTGGCCGG + Exonic
1176410206 21:6445691-6445713 AGGTGCCGTGGGAGGCTGGGTGG + Intergenic
1176819440 21:13642904-13642926 AGCTCAAGTGGGGGGCTGGCTGG - Intergenic
1179685699 21:43054013-43054035 AGGTGCCGTGGGAGGCTGGGTGG + Intronic
1180226727 21:46397926-46397948 ACGTGCAGTGGAAGCCTGGGTGG + Intronic
1181009755 22:20033267-20033289 ACCTCCAGTGCCAGGCTGTCCGG + Intronic
1182662901 22:31937476-31937498 AACTCCTGTAGGAGGCTGGCTGG - Intronic
1183074598 22:35419038-35419060 ACTACCAGTGGGGGGCTGGTGGG + Intronic
1183904160 22:41027520-41027542 ATGTCCAGCAGGTGGCTGGCTGG - Intergenic
1184378249 22:44128711-44128733 AGGGACAGTGGGAGGCTGCCAGG - Intronic
950454848 3:13086572-13086594 GAGTGCAGTGGGAAGCTGGCGGG - Intergenic
950484248 3:13263787-13263809 AGGGCAAGGGGGAGGCTGGCAGG - Intergenic
951444376 3:22761273-22761295 ATGTGCAGTGGGAGCGTGGCTGG - Intergenic
953406106 3:42660562-42660584 ACCACCCGTGGGAGCCTGGCTGG - Intronic
953813233 3:46132280-46132302 ACCTCCAGGTGGAGGCTGGTGGG + Intergenic
953863485 3:46564616-46564638 ACTCCCACTGGGAGGCTGGGAGG + Intronic
954130911 3:48560493-48560515 ACGCCCTGTGGCAGGCTGGAAGG - Intronic
954384646 3:50237701-50237723 ACTTCCAGTGGGAAGCTGGATGG - Intronic
954409705 3:50365097-50365119 GCAGCCAGTGCGAGGCTGGCCGG - Exonic
955066470 3:55537407-55537429 TGGTCCAAAGGGAGGCTGGCTGG + Intronic
960141164 3:114152940-114152962 GCGCACAGTGCGAGGCTGGCAGG - Intronic
960801510 3:121545331-121545353 GCGTCCAGGGGAAGGCTGGAAGG - Intronic
960840796 3:121956578-121956600 AAGTCCAGGGGGCGCCTGGCAGG + Intergenic
961795090 3:129403507-129403529 ACACCCAGTGGGCAGCTGGCAGG + Intronic
965038477 3:163473099-163473121 AGGTCCTGTGGGAGGGTGGGAGG + Intergenic
967012824 3:185452669-185452691 AGGTCAGCTGGGAGGCTGGCTGG + Intronic
969060452 4:4429824-4429846 ACTCCCAGTGGCTGGCTGGCAGG - Intronic
970557872 4:17253811-17253833 AAGTCCAGCGGGAAGCTGTCAGG + Intergenic
975752526 4:77538756-77538778 ACGTACAGTGGAAGGCTGCCAGG - Intronic
976733073 4:88283926-88283948 ACGCCCAGAGGGAGGTTGGGAGG - Intronic
981121600 4:141057643-141057665 AGGTCCACTGGGAGGCTAGTAGG - Intronic
982436034 4:155383950-155383972 GGGTCCTGTGGGGGGCTGGCAGG + Intergenic
984387272 4:179077214-179077236 AGATCCAGAGGGAGGCTGTCCGG - Intergenic
985662094 5:1162412-1162434 ACGTGGGGTGGGCGGCTGGCCGG - Intergenic
987638967 5:20586492-20586514 AAGGCCTGTCGGAGGCTGGCGGG + Intergenic
995679323 5:114699523-114699545 ATGTCCAGTGGGAGACTTACTGG - Intergenic
997630044 5:135360414-135360436 ACTTCCACTGGAAGGCTGGGGGG - Intronic
997889255 5:137660407-137660429 CTGTCCTGTGGGAAGCTGGCTGG - Intronic
1000974200 5:167747245-167747267 ACTTAGAGTAGGAGGCTGGCAGG + Intronic
1002561119 5:180083050-180083072 ACGTGCTGTGGGAGGGGGGCGGG - Intergenic
1002661352 5:180792811-180792833 ACTTCCCGGGTGAGGCTGGCGGG + Exonic
1002738490 5:181415942-181415964 AGGTCCAGTGGCAGCCTGACTGG - Intergenic
1003598252 6:7494233-7494255 AGGTGCAGTGGGAGGTTGGTGGG - Intergenic
1007144693 6:39616661-39616683 ATTTTCAGTGGGAGGCAGGCGGG - Intronic
1008434341 6:51457452-51457474 CTTTCCAGAGGGAGGCTGGCTGG + Intergenic
1008836458 6:55837797-55837819 AAGGGTAGTGGGAGGCTGGCAGG - Intronic
1009398857 6:63230783-63230805 AGGCCCAGGGGGAGCCTGGCGGG - Intergenic
1009969841 6:70614785-70614807 ACCTTCAGTGAGAGGCTGGCAGG - Intergenic
1010194608 6:73226500-73226522 ACTTGCAGTGGGAAGCTGACAGG - Intronic
1012237851 6:96838216-96838238 AAATCCAGTGGGAGGCCAGCTGG - Intergenic
1018631573 6:165826785-165826807 ACGCACAGGGGGAGGCTGGGGGG + Intronic
1018669625 6:166167943-166167965 TCGGCCAATGGGAGGCTGCCCGG - Intronic
1018688159 6:166319381-166319403 ACAGCCAGTGGGAGACTTGCAGG + Intergenic
1019243593 6:170691494-170691516 AGGTCCAGTGGCAGCCTGACTGG - Intergenic
1020023710 7:4883883-4883905 CCGTCCATTGGGCGGCCGGCAGG - Intergenic
1022098814 7:27157120-27157142 AGGTCCAGTGGGCGACAGGCCGG + Intronic
1025026685 7:55522105-55522127 TCCTCCGGTGGGAGGGTGGCTGG + Intronic
1026936961 7:74263029-74263051 ACCTCCTGTGTGCGGCTGGCAGG - Intergenic
1026948975 7:74334654-74334676 ACGCACAGTGGGTGCCTGGCAGG - Intronic
1029276607 7:99408804-99408826 ACTTCCGGTGGGTGGCAGGCAGG - Exonic
1030474353 7:110010604-110010626 ACTTGCAATGGGAGGCAGGCAGG - Intergenic
1034433622 7:151052831-151052853 ACGTCCAGCTGGATGATGGCTGG - Intergenic
1035276508 7:157751115-157751137 ACGCCCAGTAGTAGGCTGGGGGG + Intronic
1035504529 8:116666-116688 AGGTCCAGTGGCAGCCTGACTGG + Intergenic
1037087218 8:14867462-14867484 ACGTCCAGTAGCAGGATTGCTGG + Intronic
1039635339 8:39158518-39158540 ACATCGTGTGGGAAGCTGGCCGG - Intronic
1045810264 8:106213153-106213175 ACCTGCAGTGGGAGGGTGGTGGG - Intergenic
1047277505 8:123416886-123416908 GCGTCCCGCGGGGGGCTGGCCGG - Exonic
1048415537 8:134224111-134224133 AAGTGCTGTGGGAGGCTAGCTGG - Intergenic
1048549621 8:135422218-135422240 ACATCCAGAGGGAGGCAGTCAGG - Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049720252 8:144112322-144112344 ACTGCAAGTGGGAGGATGGCAGG - Exonic
1049807618 8:144548072-144548094 ACGTGCAATTCGAGGCTGGCGGG - Exonic
1055924905 9:81499863-81499885 ACCATCAGTGGGAGACTGGCTGG - Intergenic
1057520183 9:95753786-95753808 ACGCCCAGTGGGAAGGAGGCAGG - Intergenic
1058677172 9:107410200-107410222 CAGTCCAGGGAGAGGCTGGCTGG + Intergenic
1059328666 9:113520608-113520630 AGACCCAGAGGGAGGCTGGCAGG - Intronic
1059457847 9:114411088-114411110 ACGTGCATTGGGAGACTGGGAGG + Intronic
1060798165 9:126526610-126526632 ACGGCCAGGGAGAGGCTGCCTGG - Intergenic
1060942289 9:127549919-127549941 ACAGAGAGTGGGAGGCTGGCGGG - Intronic
1061574433 9:131497206-131497228 AGGTCCAGGGTGAGGCTGGGTGG + Exonic
1061729621 9:132603743-132603765 TCGTCCCGGGAGAGGCTGGCTGG + Intronic
1062222501 9:135424974-135424996 ACTTGAAGTGGGAGGCTGGGGGG - Intergenic
1203527918 Un_GL000213v1:106666-106688 AGCTCAAGTGGGGGGCTGGCTGG + Intergenic
1203603782 Un_KI270748v1:40717-40739 AGGTCCAGTGGCAGCCTGACTGG - Intergenic
1191087861 X:56588230-56588252 AAGTCCAGTGGGTGGCCAGCAGG + Intergenic
1199169353 X:144717895-144717917 GTGCCCAGTGGCAGGCTGGCTGG + Intergenic
1199439478 X:147852375-147852397 AAGTACAGTGGAAGGCTGGGGGG - Intergenic