ID: 1096230618

View in Genome Browser
Species Human (GRCh38)
Location 12:49894944-49894966
Sequence AGACCCGGATGGAGTCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096230613_1096230618 0 Left 1096230613 12:49894921-49894943 CCTATTGTTATTCCAAAAGGAAG 0: 1
1: 0
2: 0
3: 13
4: 200
Right 1096230618 12:49894944-49894966 AGACCCGGATGGAGTCCTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096230618 Original CRISPR AGACCCGGATGGAGTCCTCA GGG Intronic