ID: 1096230618 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:49894944-49894966 |
Sequence | AGACCCGGATGGAGTCCTCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 82 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 78} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1096230613_1096230618 | 0 | Left | 1096230613 | 12:49894921-49894943 | CCTATTGTTATTCCAAAAGGAAG | 0: 1 1: 0 2: 0 3: 13 4: 200 |
||
Right | 1096230618 | 12:49894944-49894966 | AGACCCGGATGGAGTCCTCAGGG | 0: 1 1: 0 2: 0 3: 3 4: 78 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1096230618 | Original CRISPR | AGACCCGGATGGAGTCCTCA GGG | Intronic | ||