ID: 1096231320

View in Genome Browser
Species Human (GRCh38)
Location 12:49898343-49898365
Sequence GGTCCCCAGGGAGCCCCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 2, 2: 7, 3: 86, 4: 448}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096231320 Original CRISPR GGTCCCCAGGGAGCCCCAGC CGG (reversed) Intronic
900176500 1:1293634-1293656 GGTCCCCCGGGCGCCCTGGCGGG - Exonic
900207408 1:1437501-1437523 AGGGCCCAGGGAGCCCTAGCTGG + Intronic
900365530 1:2310594-2310616 GGCCCCCGTGGAGGCCCAGCCGG - Intergenic
900371861 1:2335789-2335811 GGTCCCCAGGGCACATCAGCGGG + Intronic
900391809 1:2436919-2436941 GCTCCCCAGGAGGCCTCAGCTGG - Intronic
900400526 1:2471158-2471180 CGTCCCCAGCCATCCCCAGCTGG - Intronic
900898188 1:5498444-5498466 GGTCCCCAGGAAGCCAAACCAGG + Intergenic
901016845 1:6236654-6236676 GGTTTCCAGGGAGCCGCAGAGGG - Intergenic
901188382 1:7389315-7389337 GAGCTCCAGGGAGACCCAGCAGG - Intronic
901405123 1:9040157-9040179 GGACCCCGGTCAGCCCCAGCAGG + Exonic
901740642 1:11339575-11339597 GTTCCCCACCCAGCCCCAGCTGG - Intergenic
902460759 1:16574744-16574766 GGACCCCAGGGAGTCCTAGCTGG + Intronic
902461522 1:16581008-16581030 GGACCCCAGGGAGTCCTAGCTGG + Intronic
902462306 1:16587313-16587335 GGACCCCAGGGAGTCCTAGCTGG + Intronic
902581284 1:17409397-17409419 GCTGCCCTGGGAGACCCAGCTGG + Intronic
902656061 1:17869127-17869149 TGTGTCCAGGGAGCCCAAGCTGG - Intergenic
902754902 1:18542506-18542528 GGTCTCAAGGGAGCCCCACGGGG + Intergenic
902983528 1:20141913-20141935 GAGCCCCAGGGAGTCCCAGCTGG + Intronic
903007946 1:20310750-20310772 GGTCCCGGGGAGGCCCCAGCAGG - Intronic
903034357 1:20485001-20485023 CGCCCCCAGGGTGACCCAGCCGG + Intronic
903179441 1:21597916-21597938 GGTGCTGAGGGAGCCCCACCCGG - Intronic
903295689 1:22341950-22341972 GGTCCCGGGGGAGGCCCATCAGG - Intergenic
903810003 1:26029850-26029872 GATCCTCTGGGAGCCCCAGAGGG - Intronic
904398764 1:30241878-30241900 GGTCAGCAGGGAGGCCCAGGTGG + Intergenic
904439645 1:30521975-30521997 GGTTAACAGGGAGCCCCAGCAGG + Intergenic
904587674 1:31588984-31589006 GGTCCCCAGGGAGCCAAGGCCGG + Intergenic
905169040 1:36099026-36099048 GGGCCCCAGGCAGCCCGGGCTGG + Exonic
905473106 1:38207666-38207688 GGTTCCCAGGGAGGGCCAGGGGG + Intergenic
905648350 1:39639912-39639934 GGTGCCCTGGGAGGCCCCGCGGG + Exonic
906531060 1:46524300-46524322 TCTGCCCAGGGAGCCCCATCTGG - Intergenic
906961634 1:50422695-50422717 GGTCCCCTGGGACCCCAAGACGG - Intronic
909442922 1:75717805-75717827 GGACCAAAGGGAGCCCCTGCTGG + Intergenic
912679698 1:111721278-111721300 AGTCCCCAGGCAGCCTCAGATGG + Intronic
913445212 1:118943813-118943835 GGCTCCCAGGGAGCACGAGCAGG + Intronic
913603164 1:120441204-120441226 GGACCCCAGGGAGTCCTAGCTGG - Intergenic
913603912 1:120447556-120447578 GGACCCCAGGGAGTCCTAGCTGG - Intergenic
913604661 1:120453835-120453857 GGACCCCAGGGAGTCCTAGCTGG - Intergenic
913640777 1:120810273-120810295 GGACCCCATGGAGTCCTAGCTGG - Intronic
913641533 1:120816548-120816570 GGACCCCAGGGAGTCCTAGCTGG - Intronic
913975291 1:143450702-143450724 GACCCCCAGGCAGCCCCATCGGG + Intergenic
913990412 1:143606768-143606790 GGACCCCAGGGAGTCCTAGCTGG + Intergenic
914069684 1:144276318-144276340 GACCCCCAGGCAGCCCCATCGGG + Intergenic
914083880 1:144435368-144435390 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914109471 1:144690036-144690058 GACCCCCAGGCAGCCCCATCGGG - Intergenic
914189900 1:145400646-145400668 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914211753 1:145586348-145586370 GGACCCCAGGGAGTCCTAGCTGG + Intergenic
914276949 1:146133780-146133802 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914277700 1:146140072-146140094 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914364341 1:146964819-146964841 GGACCCCAGGGAGTCCTAGCTGG - Intronic
914365110 1:146971109-146971131 GGACCCCAAGGAGTCCTAGCTGG - Intronic
914365860 1:146977392-146977414 GGACCCCAGGGAGTCCTAGCTGG - Intronic
914486583 1:148116050-148116072 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914487340 1:148122318-148122340 GGACCCCAAGGAGTCCTAGCTGG + Intronic
914537993 1:148584728-148584750 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914538746 1:148591020-148591042 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914586912 1:149071191-149071213 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914587682 1:149077471-149077493 GGACCCCAGGGAGTACTAGCTGG + Intronic
914627928 1:149480605-149480627 GGACCCCAGGGAGTCCTAGCTGG - Intergenic
915340209 1:155173182-155173204 GGTCCCCAGGAAGTCCTAGAGGG - Intronic
915931483 1:160063137-160063159 CCTGCCCAGGGAACCCCAGCAGG + Intronic
915980312 1:160416131-160416153 GGCTCCCGGGGAGCCCCTGCTGG + Exonic
916667438 1:166978908-166978930 GATTCCCAGGAAGCCACAGCTGG + Intronic
917523538 1:175767641-175767663 GATCCTCAGGGAGCCCCCGGTGG - Intergenic
920179197 1:204122218-204122240 GCTCCTGAGGGAGACCCAGCAGG - Exonic
920513684 1:206568603-206568625 GTCCTCCAGGGAGCTCCAGCTGG + Intronic
920693558 1:208164756-208164778 TGCCCCCAGGGAGCCGCTGCCGG - Intronic
922280014 1:224114481-224114503 AGCCCCCCGCGAGCCCCAGCCGG + Intronic
922697564 1:227738974-227738996 GGTCCGCAGGGTGCCCCCTCGGG + Intronic
922955673 1:229597360-229597382 GATCCCTGGGGAGCACCAGCTGG - Intronic
924571566 1:245241705-245241727 GGGCCCATGGCAGCCCCAGCTGG + Intronic
1063049623 10:2432984-2433006 AGTCCCTAGGGAGACCCAGTGGG - Intergenic
1063121169 10:3106487-3106509 GGCCCCCAGTCAGCCCCAGGTGG - Intronic
1063283284 10:4655099-4655121 AGTCCCTAGGGAGCCCAAGGAGG + Intergenic
1063612670 10:7576371-7576393 CCTCCACAGGAAGCCCCAGCAGG - Intronic
1064359990 10:14655784-14655806 GGCTCCCAGGGATCCCCAGGAGG - Intronic
1067235076 10:44440056-44440078 GATGAGCAGGGAGCCCCAGCTGG - Intergenic
1067439431 10:46300340-46300362 GGTCTCCAGGGAGCCCAGGAAGG + Intronic
1067556745 10:47278150-47278172 GGTCCCCAGGGTGACCCCGCCGG + Intergenic
1069307032 10:66983410-66983432 GGTGCCCAGGCATCCCCAGATGG + Intronic
1069445703 10:68471659-68471681 GGTGCCCAGGGAGCTGCACCGGG + Intronic
1069713787 10:70507961-70507983 GGTCCCCAGGGAGACCCCTGTGG + Intronic
1069734944 10:70647969-70647991 AGGCCCCAGGGAACTCCAGCTGG - Intergenic
1069948136 10:72001378-72001400 GGCCCCCAGTGGGCCCAAGCAGG + Intronic
1070247138 10:74743489-74743511 GGTCACCTGGGAGGCCCAGGTGG - Intergenic
1072503774 10:96044023-96044045 CGGACGCAGGGAGCCCCAGCCGG + Intronic
1072549108 10:96463690-96463712 GGTCCCAAGGGAGCTGGAGCTGG - Intronic
1073042253 10:100615624-100615646 TCCCCCCAGGGTGCCCCAGCGGG - Intergenic
1073133429 10:101205553-101205575 GGCCCTCAGGGAGTCCCAGGTGG - Intergenic
1073491475 10:103855691-103855713 GATCCCCCCGGAGCCCGAGCCGG - Intergenic
1074085657 10:110207724-110207746 GGCCCCCAGGGAGACCCGGCCGG - Exonic
1074974631 10:118570007-118570029 TGTCCCCATGGAGAACCAGCTGG - Intergenic
1075398509 10:122144514-122144536 GGTCCTCAGGGAGCTCCTGCTGG + Intronic
1075522063 10:123148847-123148869 CTTCCCCAGGAAGCCCAAGCCGG - Intronic
1075705430 10:124497511-124497533 GGACCCAGGGGAGCCCCACCCGG - Intronic
1075806423 10:125192294-125192316 GGTCCCCCTGGGGCCCCACCAGG + Intergenic
1076114846 10:127888170-127888192 GGTCACCAGGGAGCCTGAACAGG + Intronic
1076291776 10:129350949-129350971 GGTCCTCAGAGAGCCCCACGGGG - Intergenic
1076377885 10:130003590-130003612 GGGCCCAAGGGTGACCCAGCAGG + Intergenic
1076504551 10:130963201-130963223 GGTCCCCAGCAGGGCCCAGCAGG + Intergenic
1076533367 10:131160196-131160218 ATTCTCCAGGGAGCCCCAGGTGG - Intronic
1076853549 10:133104573-133104595 GGTCTCCAGGCAGCCCCAGGAGG - Intronic
1077049144 11:558940-558962 GGTCACCTGGGACCTCCAGCAGG - Exonic
1077230375 11:1455899-1455921 GAGTCCCAGGAAGCCCCAGCAGG + Intronic
1077235488 11:1480177-1480199 GGTCCCCAGTGGGGCCCAGAAGG - Intronic
1077298175 11:1835652-1835674 GGGCCCGAGGGAGCCACAGCGGG + Intronic
1077334730 11:1998199-1998221 AGTCCCCAGGGACCCGCAGCTGG - Intergenic
1077342692 11:2033070-2033092 GCCCATCAGGGAGCCCCAGCAGG + Intergenic
1077410723 11:2402783-2402805 CCTCCCCAGGCAGCCCCATCGGG - Exonic
1077462051 11:2715582-2715604 GGGTCCCAGGGGACCCCAGCAGG - Intronic
1078011591 11:7576693-7576715 GGCCCCCAGGGTGCCCTGGCTGG + Intronic
1078084582 11:8225959-8225981 GGTCCCCAGGGACTCCCACAGGG + Intronic
1078479119 11:11660759-11660781 GGTCTCCAGGCCTCCCCAGCTGG - Intergenic
1080347008 11:31336288-31336310 GATACCCAGGGAGACCCAGGAGG + Intronic
1080741140 11:35065289-35065311 GGGCACCAGGGATCCTCAGCAGG + Intergenic
1081488263 11:43547907-43547929 GGAGCCCAGGGAGCCCGAGCTGG - Intergenic
1081701018 11:45152899-45152921 GGGCCACAGGGAGCCTCAGAGGG + Intronic
1081834641 11:46143693-46143715 GGTCCCCATGGAGGCTCAGAAGG - Intergenic
1081877063 11:46415810-46415832 GTTCCCCAGGCAGCCCAAGATGG + Intronic
1082884178 11:58066460-58066482 GGTCCCATGGAAGCCCCAGCAGG - Intronic
1083255326 11:61491851-61491873 AGCCCACATGGAGCCCCAGCCGG - Intergenic
1083778885 11:64907872-64907894 GGTCTCCAGGGATCACCATCTGG + Exonic
1083955828 11:65982311-65982333 GGTCCACAGGGAGCCCATGCTGG - Intergenic
1084029705 11:66474021-66474043 CTGCCCCAGGGAGCCCCAACAGG + Intronic
1084219488 11:67668362-67668384 GGGCCCAAGGGAACCCCAGTGGG + Intronic
1084274990 11:68046777-68046799 GAGCCACAGGCAGCCCCAGCTGG - Intronic
1084336623 11:68461232-68461254 AGGCCCCCGGGAGGCCCAGCGGG - Intronic
1085316484 11:75548206-75548228 GGGTCTCAGGGAGCCCCAGGAGG + Intergenic
1085461304 11:76695526-76695548 TGTACCCAGTGAGCTCCAGCAGG + Intergenic
1085523510 11:77151554-77151576 GGTCCCTAGGGGTCCCCAGGCGG - Intronic
1089131710 11:116217602-116217624 GGTCCCCAGGGAGCCCTTGTGGG - Intergenic
1089166644 11:116482591-116482613 GGTCTCCAGGGTCCCCCAGTTGG - Intergenic
1089352397 11:117828963-117828985 GAGCCACAGGGAGCCCCACCAGG + Intronic
1089362634 11:117901194-117901216 GGGCCCCAGGGAGGTCCAGGTGG - Intronic
1089570183 11:119402652-119402674 GGTCCCCAAGTACCCCCAGCTGG + Intergenic
1090423320 11:126590532-126590554 TGTCCACAGTGAGCCACAGCAGG - Intronic
1091079724 11:132654992-132655014 GGTCCACAGGGAGACCCCACAGG + Intronic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1202817713 11_KI270721v1_random:53381-53403 AGTCCCCAGGGACCCGCAGCTGG - Intergenic
1202825678 11_KI270721v1_random:88259-88281 GCCCATCAGGGAGCCCCAGCAGG + Intergenic
1091390755 12:124894-124916 TGTTCCCCGGGAGCCACAGCAGG - Intronic
1095388914 12:41682061-41682083 GGCCTTCAGGGAGCCCCTGCTGG - Intergenic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1096494663 12:52033121-52033143 AGTCCGGAGGGAGCCGCAGCAGG - Intronic
1096524298 12:52201338-52201360 CATCCTCAGGAAGCCCCAGCTGG + Intergenic
1096719252 12:53508841-53508863 AGTCTCCAGGGAGTCCCAGAAGG + Intronic
1097174330 12:57134085-57134107 GGTCCCCAGGGCCACCAAGCTGG - Intronic
1098607112 12:72404399-72404421 GTTCCCCAGGCTGCCCAAGCTGG - Intronic
1098790486 12:74816550-74816572 GGGGCCCAGGAAGCCCCTGCAGG + Intergenic
1100855325 12:98752650-98752672 GATCCCCAGTTAGCCCCAGGAGG + Intronic
1101678577 12:106942553-106942575 GGACCAAAGGGAGCCCCTGCTGG - Intergenic
1102346015 12:112161905-112161927 GCTCCAGAGGCAGCCCCAGCAGG - Exonic
1102504446 12:113374793-113374815 GGTCCCCAGAGAGCTGCAGCAGG - Exonic
1102624415 12:114223324-114223346 GTACCCCAGGGAGTCCCAGGTGG + Intergenic
1102682963 12:114702948-114702970 GGTTTCCAGGGGCCCCCAGCAGG + Intergenic
1103041938 12:117702947-117702969 GCTCCTCAGGGAGCCCAAGGGGG + Intronic
1103415463 12:120739533-120739555 GGTCCCCAGGGAGCCCCCGCCGG - Exonic
1103949710 12:124544091-124544113 CCTGCCCGGGGAGCCCCAGCGGG + Intronic
1103966961 12:124646136-124646158 GGTCCCCACCCAGCCCCAGGGGG + Intergenic
1104688450 12:130806265-130806287 GGCCCCCACGGAGCCCTGGCAGG - Intronic
1107464349 13:40635853-40635875 GGTCCCCAGGGAGGGGCAGCAGG - Intronic
1107988402 13:45796085-45796107 GGACCCGAGGGAGCCCCTGAGGG + Intronic
1108855311 13:54786249-54786271 GGTTCCCTGGGAGCCCAAGCAGG - Intergenic
1111232527 13:85363046-85363068 GGCCCCCACGGAGCAGCAGCGGG - Intergenic
1113246512 13:108402748-108402770 GGTCCCCAGTGTCACCCAGCAGG - Intergenic
1113582158 13:111437488-111437510 GGTGCCCTGGGAGCTCCATCTGG - Intergenic
1113654745 13:112061116-112061138 GGTCCCCCGGGAGCCGCGCCTGG - Intergenic
1113763972 13:112869395-112869417 TAAACCCAGGGAGCCCCAGCTGG + Intronic
1113808407 13:113123097-113123119 CAGCCCCAGGGAGCCACAGCTGG - Intronic
1113939175 13:114009783-114009805 GGTTCCCAGGCAGCCACATCTGG - Intronic
1113941127 13:114019090-114019112 GGTCACCGGGGATCCCCAGGAGG + Intronic
1113961514 13:114128787-114128809 GAGCCACAGGAAGCCCCAGCGGG + Intronic
1117546442 14:56797924-56797946 GGGCCCGAGGCAGGCCCAGCTGG + Intergenic
1117875611 14:60248548-60248570 TGACCCCAGGAAGCCCAAGCAGG - Intronic
1118258507 14:64225659-64225681 GGGCTCCAGGGAGCCCGTGCTGG - Exonic
1120882953 14:89428811-89428833 GGTCCTCAGGTAGCCTCTGCAGG - Intronic
1120949286 14:90026292-90026314 GGTCCCCAGGGTTTCCCAGGAGG + Intronic
1121422347 14:93824596-93824618 TGCTCCCAGGGAGCCCCAGCAGG + Intergenic
1121558127 14:94854004-94854026 GATGCCCAGGTAACCCCAGCTGG + Intergenic
1121595104 14:95156807-95156829 GGGCCCCAGGGTGCTCCGGCAGG + Intronic
1121709433 14:96026708-96026730 AGTACCCACTGAGCCCCAGCAGG + Intergenic
1122297326 14:100712833-100712855 GGTCCCCAGGGCCACCCAGCAGG + Intergenic
1122558419 14:102593375-102593397 GGTCCCCGGCGAGCCCGAGGGGG + Intronic
1122784627 14:104157992-104158014 GGTCCCCAGGGGCCCACAGCCGG - Intronic
1122793423 14:104193943-104193965 GGGCCCCAGGAAACCCCACCAGG - Intergenic
1122971246 14:105153082-105153104 GGCCCCCCGGGAGTCCCGGCAGG - Intronic
1123451051 15:20358797-20358819 GGACCCCAGGAAGCCCCTCCAGG - Intergenic
1124619562 15:31266035-31266057 GCTACCCAGGGAGTCCCTGCAGG - Intergenic
1124626052 15:31308138-31308160 GGACTTCAGGGAGTCCCAGCAGG - Intergenic
1128232741 15:66046932-66046954 GGTCCCCAGGTTCCCCCTGCAGG + Intronic
1128349968 15:66882029-66882051 GGGTCCCAGGAAGCCCCAGTAGG + Intergenic
1128509990 15:68307498-68307520 CCTCCCCAGGCAGCCCCAGGTGG + Intronic
1128546835 15:68574055-68574077 GGACACCAGGGAGCCCCTGATGG + Intergenic
1128713993 15:69893708-69893730 AGTCCCCATGGAACCCAAGCAGG + Intergenic
1128766175 15:70252536-70252558 GGGCTCCAGGGAGGCCCGGCAGG - Intergenic
1129152100 15:73695836-73695858 GTTGCCCAAGGAGCCCCTGCGGG + Intronic
1129229530 15:74189088-74189110 GGCCTCCAGGGAGCCCCTGAGGG - Intronic
1129384511 15:75188544-75188566 GGGCCCCAGGGATCCTGAGCAGG + Intergenic
1129676879 15:77636535-77636557 GCTCCACAGGGCCCCCCAGCTGG - Intronic
1129824335 15:78624921-78624943 GGATCCCAGGAAGCCCCAGTAGG - Exonic
1131250655 15:90828089-90828111 GACACCCAGGGCGCCCCAGCAGG + Intergenic
1131265087 15:90910969-90910991 GGTCCCCATGCAGACCCAGGAGG - Intronic
1131332538 15:91515078-91515100 TGGCCACAGGGAGCCCCAGCAGG - Intergenic
1132576911 16:668448-668470 GCTCACCAGGGACCCCCGGCTGG - Intronic
1132657740 16:1048412-1048434 GCTCCCCAGGGACCCCCACTAGG - Intergenic
1132692979 16:1189895-1189917 GTTCCCCAGGCAGCCCCCACTGG - Intronic
1132940330 16:2503127-2503149 TGCCCCCAGGGGGCCCCACCCGG + Exonic
1132973175 16:2698772-2698794 GGCACCAAGGGAGCTCCAGCAGG - Intronic
1133099373 16:3469993-3470015 GGCCCCAGGGCAGCCCCAGCAGG - Intronic
1133239078 16:4403983-4404005 GGCCCCCAGGGAGCCCCTTCTGG - Intronic
1133428080 16:5710752-5710774 GGTCCCCAGGGACACAGAGCCGG - Intergenic
1134056016 16:11170346-11170368 GGACCCCAGGGAGCCCACGTGGG + Intronic
1134094702 16:11411715-11411737 GGTCCCATGGGAGTCCCAGCAGG + Intronic
1135040843 16:19115460-19115482 GGCCCTCAGGGAGCTCCAACAGG - Exonic
1136878891 16:33886219-33886241 GGTCCCCAGGGGGCCCCCTGGGG + Intergenic
1137001740 16:35235237-35235259 GTGCCCCAGGGAACCCCAGGTGG + Intergenic
1137468486 16:48732870-48732892 GAGCCCCAGGGAGCCCCCACAGG - Intergenic
1137469292 16:48740302-48740324 GAGCCCCAGGGAGCCCCCACAGG - Intergenic
1137476127 16:48811275-48811297 GCTCCCAAGGCAGCCTCAGCCGG + Intergenic
1137609179 16:49807685-49807707 GGACCCCAGGCAGCTCCACCTGG + Intronic
1138530501 16:57631826-57631848 GGGCCTCAAGGAGCCCCAGATGG - Intronic
1140469692 16:75207097-75207119 GGTACCCAGGAGGGCCCAGCAGG + Exonic
1141196896 16:81866956-81866978 TGTGCCCAGCCAGCCCCAGCTGG + Intronic
1141480065 16:84300440-84300462 GGATCCCAGGAAGCCCCAGCTGG - Intronic
1141636353 16:85315975-85315997 GGTGCCCATGGTGCCCCTGCTGG + Intergenic
1142130909 16:88431061-88431083 GGCCCCCAAGGATCCCCTGCAGG + Exonic
1142137485 16:88458348-88458370 GGTCCCCTGGGAGGCTCATCCGG + Intronic
1142254281 16:89006499-89006521 GTTCCCCAGAGACCCCCACCTGG - Intergenic
1142256159 16:89014810-89014832 GGGCCCTGGGGAGCCCCAGCAGG - Intergenic
1142278977 16:89137928-89137950 GGGACACATGGAGCCCCAGCTGG - Intronic
1203093129 16_KI270728v1_random:1229170-1229192 GGTCCCCAGGGGGCCCCCTGGGG - Intergenic
1142501674 17:336578-336600 GGGCAACGGGGAGCCCCAGCAGG - Intronic
1142707871 17:1708049-1708071 GGTGGCCAAGGAGGCCCAGCTGG + Exonic
1142711082 17:1724525-1724547 GGTCTCCAGCCAGCTCCAGCCGG - Intronic
1143202362 17:5121770-5121792 GGCCCCCAGCCCGCCCCAGCAGG - Intronic
1143658941 17:8313019-8313041 GGTCCCCAGGGTCCCCCGTCGGG + Exonic
1144627011 17:16849159-16849181 GGCCCCCAGCCCGCCCCAGCAGG + Intergenic
1144879429 17:18423553-18423575 GGCCCCCAGCCCGCCCCAGCAGG - Intergenic
1145059167 17:19721377-19721399 GGTGCCCAGGGAGACCTTGCGGG - Intergenic
1145152812 17:20520834-20520856 GGCCCCCAGCCCGCCCCAGCAGG + Intergenic
1145258784 17:21342537-21342559 GGTTCCCAGAGAGGCCCAGGAGG - Intergenic
1145317840 17:21745467-21745489 GGTTCCCAGAGAGGCCCAGGAGG + Intergenic
1145936637 17:28718094-28718116 GGTCCCCATGAAGGCGCAGCCGG - Intronic
1146164152 17:30575006-30575028 GGTCCCCAGGCCGCCCCAGCAGG + Intergenic
1146369527 17:32256789-32256811 GCTCCCCAAGGAGCCACAACAGG + Intergenic
1147153192 17:38530285-38530307 GGTCCCCAGGGGGCCCCCCGGGG - Exonic
1147265537 17:39232187-39232209 GGTCCCCAGGCTGCTTCAGCTGG - Intergenic
1147686203 17:42288264-42288286 GGTCCCCCGGGAGTCCCAGCAGG - Exonic
1147980790 17:44272792-44272814 GGTCCCCAGGGAGACCATGCTGG + Intergenic
1148485757 17:47989967-47989989 GGTTCCCAGGCCACCCCAGCTGG + Intergenic
1148687033 17:49506757-49506779 GGTCACCAAGCTGCCCCAGCAGG - Intronic
1148690192 17:49522724-49522746 GGACCGCAGGGAGGCCCAGGAGG + Intergenic
1148850449 17:50551977-50551999 GTCCTCCAGGAAGCCCCAGCAGG - Exonic
1148894251 17:50830918-50830940 GGTCTCCAAGGAGGCCTAGCTGG + Intergenic
1150696654 17:67411386-67411408 GGTCACCAGGGATGGCCAGCAGG + Intronic
1151293316 17:73165683-73165705 GCTCCCGCAGGAGCCCCAGCTGG - Intronic
1151455949 17:74225905-74225927 GGCCATCAGGGAGGCCCAGCTGG + Intronic
1151662646 17:75526678-75526700 GGGCTCCAGGGACCCCCTGCTGG + Intronic
1151948027 17:77330016-77330038 TGAGCACAGGGAGCCCCAGCTGG - Intronic
1152073649 17:78146230-78146252 GGGGCCCAGAGAGCCCCGGCAGG - Intergenic
1152337395 17:79706549-79706571 GGGCCCCAGGCAGCCCCTCCAGG + Intergenic
1152797234 17:82314437-82314459 GGCCCCGGGGGAGACCCAGCTGG - Intergenic
1152899830 17:82934129-82934151 GGCCCCCAGGAAGCCCCCTCTGG + Intronic
1153746504 18:8185332-8185354 GGCCCCCCAGGAGCCCCACCAGG + Intronic
1153799366 18:8656026-8656048 GGGCCCCTGGGAGCCACAGCTGG - Intergenic
1155264785 18:24080850-24080872 GGTCTCCAGGAAAACCCAGCAGG - Exonic
1157449079 18:47772179-47772201 TGACCCCAGGCAGCCCAAGCGGG + Intergenic
1157476780 18:48028889-48028911 GGTGCCCAGCCAGCCACAGCAGG - Exonic
1158267582 18:55677262-55677284 TGTCCCCAGGGACCCAGAGCAGG - Intergenic
1160764959 19:803462-803484 GGACCCCAGGCAGCCCAAGTGGG + Intronic
1160843869 19:1158198-1158220 GGTGCTCAGGGACCCCCAGGGGG - Intronic
1160933658 19:1582778-1582800 GGGCTCCAGGGAGGCCCACCTGG + Intronic
1161238308 19:3208610-3208632 GTTCCCCAGGGAGGACCAACTGG - Exonic
1161291619 19:3496748-3496770 GGACCCCAAGCAGCCCCTGCAGG - Exonic
1161449760 19:4338604-4338626 GCTCCCCACGGTGGCCCAGCAGG + Intronic
1161515450 19:4693765-4693787 AGTCCTCCTGGAGCCCCAGCAGG + Intronic
1161569661 19:5023582-5023604 CGGCCCCAGTGAGTCCCAGCCGG - Intronic
1161961067 19:7523358-7523380 GGTCCCCAGCTAGCTCCAGAAGG - Intronic
1161991006 19:7684197-7684219 GGTCCCCAGGAATCCCCTGGGGG - Exonic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1162698657 19:12496788-12496810 GCTCCCCAGGAAGACCCATCTGG - Intronic
1162803040 19:13121484-13121506 GGGCAGCAGGGAGCCCCAGCAGG + Intronic
1163215236 19:15871558-15871580 AGTCCCCAAGCAGCCCCTGCTGG + Intergenic
1163288850 19:16365578-16365600 GTCCCCCAGGGTGCCCCTGCCGG - Intronic
1163371443 19:16903466-16903488 GAACCCCAGGGACCCCCAGAGGG - Intronic
1163427717 19:17248172-17248194 GGTTCCCAGGCTGCCCCAGCAGG - Intronic
1163529738 19:17842393-17842415 GGGCCCCAGGGAGGCCCACGTGG + Exonic
1163799658 19:19356795-19356817 AGGCCCCAGGGAGCCTCCGCTGG + Exonic
1164591595 19:29510647-29510669 CCTGCCCAGGGAGCCACAGCTGG + Intergenic
1164728037 19:30479949-30479971 GGTTCCAAGGGAGCCCGCGCTGG + Intronic
1164857870 19:31538964-31538986 GGTCCCTAGGGTCCCCCAGAAGG - Intergenic
1165346965 19:35254543-35254565 GGACCCCAAGGAGCCCGAGGAGG - Intronic
1165446298 19:35858576-35858598 TGTCCCCTGGGAGCCCAAGAGGG + Intronic
1166194891 19:41198946-41198968 GGTCCCCAGGGACACCTGGCTGG - Intronic
1166353988 19:42216606-42216628 GGGCACCAGGGAGGCCCAGCGGG + Intronic
1166572063 19:43803348-43803370 GGTCCAGAGGAGGCCCCAGCAGG + Intronic
1166975934 19:46605028-46605050 AGTCCCCAGAGTGCCCAAGCTGG + Intronic
1167249748 19:48393595-48393617 GGTCCCCAGGGAGGCCAGGAGGG + Intergenic
1168310074 19:55455767-55455789 GGGCCCCACGGTGCCCGAGCTGG - Exonic
1202677191 1_KI270711v1_random:18484-18506 GGACCCCATGGAGTCCTAGCTGG + Intergenic
1202677959 1_KI270711v1_random:24755-24777 GGACCCCAGGGAGTCCTAGCTGG + Intergenic
925058870 2:875920-875942 GGTGACGGGGGAGCCCCAGCAGG + Intergenic
925160617 2:1681119-1681141 GGTCCCCAGGCCCCTCCAGCCGG + Intronic
925181949 2:1823198-1823220 CCTCCCCAGGCAGACCCAGCAGG + Intronic
925590329 2:5502970-5502992 GGTCCCCAGAAAGCACCAGAAGG - Intergenic
926796649 2:16625219-16625241 GGGGGCCTGGGAGCCCCAGCTGG - Intronic
927277722 2:21275724-21275746 TGGCCCCAGGGAGCTCCATCAGG - Intergenic
930198384 2:48530378-48530400 GGGCCCCAGGGCGCCCCTGGGGG - Intronic
931321368 2:61177364-61177386 GCGCGCCCGGGAGCCCCAGCCGG - Intergenic
933648708 2:84831991-84832013 GGTGCCCAGGCAGCCCCATGAGG + Intronic
934179991 2:89611675-89611697 GACCCCCAGGCAGCCCCATCGGG + Intergenic
934290286 2:91685936-91685958 GACCCCCAGGCAGCCCCATCGGG + Intergenic
934650545 2:96089158-96089180 GGACCCCAGTGAGCTCCAGCGGG + Intergenic
934662477 2:96150471-96150493 GGTCACAGGGGAGCCCCAGGAGG - Intergenic
936007991 2:108907044-108907066 GGTCTACAGGGAGCCCAAGAGGG + Intronic
936153823 2:110035743-110035765 TCTCCCCTGGGATCCCCAGCTGG - Intergenic
936190862 2:110335672-110335694 TCTCCCCTGGGATCCCCAGCTGG + Intergenic
937293020 2:120793414-120793436 TGTCCCCAGGCAGCCCCTGGAGG + Intronic
938278757 2:130050354-130050376 GGTCCCCAGGGAGGATCAGGGGG + Intergenic
938329731 2:130441213-130441235 GGTCCCCAGGGAGGATCAGGGGG + Intergenic
938360215 2:130680290-130680312 GGTCCCCAGGGAGGATCAGGGGG - Intergenic
938595304 2:132782749-132782771 GCTCCCCAGGGAGCCCTTCCCGG + Exonic
940887048 2:158999233-158999255 GGGCCCCAGGGAGCTGCAGATGG - Intronic
942188678 2:173449192-173449214 AGTTCTCAGAGAGCCCCAGCCGG - Intergenic
943646124 2:190408837-190408859 GCTGCCCAGGGAGCCCTCGCCGG + Intronic
945465963 2:210171148-210171170 GGGAGCCAGGGCGCCCCAGCAGG - Exonic
945993183 2:216413174-216413196 TGGCCAAAGGGAGCCCCAGCAGG + Intronic
946110732 2:217413019-217413041 GTTCCTCAGTTAGCCCCAGCTGG - Intronic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
946363378 2:219233233-219233255 GTTAGCCAGGGAGCACCAGCTGG + Intronic
946646894 2:221846962-221846984 GCTTCCCAGGGAACCCAAGCTGG + Intergenic
947668009 2:231919159-231919181 GGACTCCAGCGAGCCCCACCTGG + Intergenic
947727667 2:232410008-232410030 GGTCCCCAGGGTGCACCGGGAGG - Exonic
948587455 2:239028208-239028230 GGTCCCCTGGGCTGCCCAGCAGG - Intergenic
948799780 2:240427288-240427310 GGGACCCAGGGAAACCCAGCAGG + Intergenic
1168949948 20:1790682-1790704 GGTCCCCACGTGGCCCGAGCAGG + Intergenic
1169357261 20:4917671-4917693 GGTCCCCAGGGACAGACAGCTGG - Intronic
1169373021 20:5043193-5043215 GCTCCCCAGGAATCCTCAGCTGG + Intergenic
1170034628 20:11977118-11977140 GCTGCCCAGGCAACCCCAGCTGG + Intergenic
1170613709 20:17933348-17933370 TGGCCCCAGGAAGCCCCAGTAGG + Intergenic
1170693192 20:18633641-18633663 GGTCCCCTGGGAGGCCCACTCGG - Intronic
1170722887 20:18899983-18900005 GTTTCCCAGAGAGTCCCAGCAGG + Intergenic
1172039969 20:32036847-32036869 CGTCCCCAGGGCCCCCCACCTGG + Intergenic
1172226915 20:33311257-33311279 GACCCCCAGGAAGCCCCAGAGGG - Intergenic
1173649786 20:44655839-44655861 TGTCAACAGGGAGCACCAGCAGG + Intergenic
1173659638 20:44724553-44724575 GGGATCCAGGGTGCCCCAGCAGG + Intronic
1173795173 20:45854947-45854969 GGTACCCAGTGAGTCCCAGCAGG + Intronic
1174645196 20:52079649-52079671 GGCCCCCAGGGGACCGCAGCAGG + Intronic
1175256641 20:57652030-57652052 GGTCCCCAGGGGGGCCGGGCTGG - Exonic
1175824330 20:61928471-61928493 AGGCCCCTGGGAGACCCAGCTGG + Intronic
1175900955 20:62359745-62359767 GGGCCCCCGGGAGTGCCAGCTGG - Intronic
1175945424 20:62556377-62556399 GATCCCCAGGGAGCACCATCAGG - Intronic
1175995427 20:62810126-62810148 CGTCCACAGGGAGCCTCTGCTGG + Intronic
1176121841 20:63457610-63457632 GTTCCCGAGGGAGCCACAGCTGG - Intronic
1177775591 21:25562419-25562441 AGTCCCCAGGGGGCACCCGCAGG - Intergenic
1178119677 21:29456283-29456305 GGTCCCCATGGGGTCCCTGCAGG - Intronic
1179805691 21:43835659-43835681 GGCCCACAGGGAGCCCCTGGAGG + Intergenic
1180698511 22:17769362-17769384 GGTCCTCAGGGATACCCAGAGGG + Intronic
1180842977 22:18967858-18967880 AGTTCCTAGGAAGCCCCAGCAGG - Intergenic
1181161612 22:20963186-20963208 GGGCCCCAGGAAGACCCAGGAGG - Intergenic
1181597590 22:23926717-23926739 AGTCCTCAGGTAGCCCCAGAGGG - Intergenic
1181931853 22:26408268-26408290 GGTCCCCTGGGGTCCCCAGAGGG - Intergenic
1182083100 22:27543100-27543122 GGCCTCCAGGGACCCCCACCTGG + Intergenic
1182283740 22:29232265-29232287 GCCCCCCAGGGAGCCCTGGCCGG + Exonic
1183418498 22:37696787-37696809 GCTCCCTGGGGACCCCCAGCGGG + Intronic
1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG + Intronic
1183964087 22:41430919-41430941 ACTCCCCAGGGAGCCCCATCAGG - Intergenic
1184228335 22:43143433-43143455 GGTGCCCCGGAAGCCCCGGCAGG - Intergenic
1184273956 22:43399872-43399894 GGTCCCCATGTGGCCCCAGCAGG + Intergenic
1185205451 22:49535630-49535652 GGTGGCCAGGGAGCCCCAGGAGG + Intronic
1185233151 22:49694753-49694775 GGTGCTCAGGGAGCTCCAGGGGG + Intergenic
1185276088 22:49950712-49950734 GGACCCCCGGCAGCTCCAGCAGG - Intergenic
949720993 3:6990105-6990127 CATCCACAGGGAGCCCCTGCTGG - Intronic
950520007 3:13492518-13492540 GGGCTCCAGGGGGCCCCAGGTGG + Intronic
950895827 3:16449964-16449986 AGGCCCCAGGGAGGCGCAGCAGG + Intronic
951526350 3:23656767-23656789 GGTTCCCAGGGATACACAGCTGG + Intergenic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
953223822 3:40998580-40998602 GGTTCCCAGAGGGCCCCAGCGGG + Intergenic
953462608 3:43093716-43093738 GGTTCCCAGGGTTCCCCAGTGGG + Intronic
953872966 3:46643588-46643610 GGTCCCCAGGGAGGCCTCTCAGG + Intergenic
954301016 3:49700798-49700820 GGTCCCCTGGGAGCATCAGGAGG + Intronic
954325992 3:49864346-49864368 GGTCCCCTGTGGGCCCCAGTGGG - Intronic
954331955 3:49895929-49895951 GTTTCCCAGGGAGGTCCAGCTGG + Intronic
954438343 3:50507946-50507968 GGTCCCCAAGGGCCCCCAGCTGG + Intergenic
954460472 3:50623868-50623890 GGAGCCCTGGCAGCCCCAGCTGG + Intronic
955911516 3:63863710-63863732 GGTCTCAGGGGAGGCCCAGCGGG + Intronic
956036159 3:65094545-65094567 AGTCCCCAGGGAGACACAACAGG + Intergenic
960942314 3:122943060-122943082 GGTGCCCAGGGGCCCCCTGCCGG - Intronic
960971978 3:123146295-123146317 GGTCTCCAGGGGCCGCCAGCTGG - Intronic
961093818 3:124138033-124138055 GATCCCCAGTGGCCCCCAGCAGG + Intronic
961433220 3:126897975-126897997 GGTCCTCATGGAGACCCTGCAGG - Intronic
963647380 3:147932386-147932408 GTTTTCCAGGGAGGCCCAGCAGG + Intergenic
967524981 3:190481971-190481993 TCTGCTCAGGGAGCCCCAGCTGG - Intergenic
968646957 4:1745992-1746014 GGTTCCCGGGATGCCCCAGCTGG - Intergenic
968816480 4:2824263-2824285 GTACCCCAGGGAGGCCAAGCAGG + Intronic
969117176 4:4877982-4878004 GGAACCCAGGGAGGCCCAGGAGG + Intergenic
969268830 4:6085172-6085194 GGGCCCCAGGGAGCCACGGAAGG - Intronic
969373875 4:6750493-6750515 CTTCCCCAGGGAGCCACTGCAGG + Intergenic
969829288 4:9781955-9781977 GACCCCCAGGCAGCCCCATCGGG - Exonic
975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG + Exonic
976155914 4:82144699-82144721 GGCTCCCAGAGATCCCCAGCAGG + Intergenic
977340338 4:95749818-95749840 GTTCTCCAGGGAGCACCAGAAGG - Intergenic
978379403 4:108111351-108111373 GGTCCCCAGGTACACTCAGCAGG - Intronic
979188165 4:117824605-117824627 GGTCACCAGGCACCCCCACCCGG + Intergenic
984626155 4:182009705-182009727 AGACCCCAGGCAGCCACAGCTGG + Intergenic
985512544 5:320879-320901 TGTCCCCAGGGATCCCCTGAGGG + Intronic
985634948 5:1031267-1031289 GGACCCCAGGGCTGCCCAGCTGG - Intronic
985666275 5:1183023-1183045 GGTGCCCAGGGAGTCCACGCTGG + Intergenic
985760531 5:1746479-1746501 GGTCCCCGGGCAGCCCAGGCAGG - Intergenic
985832183 5:2242022-2242044 GGTCCCCGGGGAGCCAGGGCAGG - Intergenic
985949952 5:3215411-3215433 GTTCCCCAGAGGGCCCCAGGAGG + Intergenic
986136450 5:4984026-4984048 GTTCCCCCAGCAGCCCCAGCAGG + Intergenic
991544385 5:67765294-67765316 GGCCTCCAGTGAGCCCCAGATGG - Intergenic
993272287 5:85811459-85811481 GGACCACAGGGAACCCCAGCTGG - Intergenic
997588587 5:135059271-135059293 GGACCTCAGGGAGCCCCTGATGG + Intronic
998092666 5:139380320-139380342 GGGCCCCAGGCAGCCCCAGCAGG + Exonic
998137829 5:139683749-139683771 GGTCCCCAGGGGGCCCCCTGCGG + Exonic
1000888282 5:166773504-166773526 GGTTCCCATGGAGCTCCAGGAGG + Intergenic
1001221210 5:169902595-169902617 TGGCCCCAGGGAGCCTCAGCGGG - Intronic
1001406528 5:171481003-171481025 GGTCCCAGTGGAGCCCCAGGTGG - Intergenic
1001526600 5:172433579-172433601 GGCCACCAAGGAGCCCCTGCCGG + Intronic
1001848369 5:174941314-174941336 GGTCCCCAGGCAAGCCCTGCTGG + Intergenic
1001960762 5:175879151-175879173 GGATCCAGGGGAGCCCCAGCAGG - Intronic
1003054170 6:2803999-2804021 GGGTCCCAGGTAGCCCCAGGAGG + Intergenic
1004570939 6:16844285-16844307 GGGACCCAGGGAGCACCCGCTGG + Intergenic
1005806631 6:29479359-29479381 GTTCCCAAGGTAGCCCCAGTGGG - Intergenic
1005947098 6:30602670-30602692 GGTCCCCATGGAGGCCCTGGTGG - Exonic
1005963135 6:30707576-30707598 GATCCCCAGTGAGCCCCAGGAGG - Exonic
1006110339 6:31740559-31740581 GGGCCCCAGGGAGGCCGAGGAGG + Exonic
1006375908 6:33671483-33671505 GGTCTCCAGGGAGTCCGGGCAGG - Intronic
1006592792 6:35170434-35170456 GGTCCCCTGGGGCCCCCAGCAGG - Intergenic
1006615171 6:35321271-35321293 GTTGCCCTGGGATCCCCAGCGGG - Exonic
1007112985 6:39324173-39324195 GCACCCCAGTGAGTCCCAGCAGG + Intergenic
1007243298 6:40442477-40442499 TGTCCTCAGGGAGCCCCAGTTGG - Intronic
1007284600 6:40738399-40738421 TGTCCCCAGGGAGCCCCAGCCGG - Intergenic
1007285443 6:40744221-40744243 GGGCCCCAGGCCTCCCCAGCAGG - Intergenic
1007339846 6:41184310-41184332 GATCCCCTGGGAGCCCCAAATGG - Intergenic
1007738207 6:43994865-43994887 TGTCCTCAGGGACCCCCAGTCGG + Intergenic
1007740008 6:44004468-44004490 CATCCTCAGGGAGCCCCAGTCGG - Exonic
1007740021 6:44004507-44004529 TGTCCTCAGGGAGCCCCAGTCGG - Exonic
1008900303 6:56606598-56606620 GTTCCCCAGGGGGCACCAGTTGG - Intronic
1013080066 6:106804713-106804735 GGTCACCATGGAGCCACAGAGGG - Intergenic
1013300867 6:108803854-108803876 GGTCACCAGGGACCTCCATCTGG - Intergenic
1013836719 6:114342882-114342904 GGCCCCCAGAGCGCCCGAGCCGG + Exonic
1015796401 6:137016241-137016263 TGTCCCCATGGAGCCCCAGCTGG - Intronic
1017812604 6:157994870-157994892 AGACCCCAGGGAGTCCCAGGGGG + Intronic
1019064789 6:169287974-169287996 TGTCCCCAGGGAGCCTCTGAAGG - Intergenic
1019542758 7:1558987-1559009 GGTCCCCAGGGAGGGGCAGTCGG + Intronic
1019639512 7:2095952-2095974 GGTCCGCGGGGAGACACAGCAGG + Intronic
1019747655 7:2709562-2709584 GATCCCCAGGCAGCCCCAGCAGG - Intronic
1020418300 7:7969739-7969761 GGTCCCCAGAGAGCCACCGGAGG + Exonic
1021531126 7:21646636-21646658 GGTGCCCAGTGAGCTCCAGCAGG + Intronic
1021629437 7:22629958-22629980 TGCCCCCATGGATCCCCAGCAGG - Intronic
1021826538 7:24558398-24558420 GGTACCCAAGGAGTGCCAGCAGG + Intergenic
1022138256 7:27469100-27469122 AGTTCCCAGGGAGCATCAGCTGG + Intergenic
1023869276 7:44254238-44254260 GGTCCACGGGAAGCCCCACCTGG + Intronic
1023899895 7:44467575-44467597 GGTCCCCATTGAGGCCCGGCAGG + Intronic
1024619688 7:51146917-51146939 GATCCCCTGGCAGCCCCAGGAGG + Intronic
1024634520 7:51276316-51276338 GGCTCCCAGGAAGCCACAGCAGG - Intronic
1025052613 7:55742750-55742772 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1025083923 7:56007369-56007391 GGTACCCAGGGAGGCCCACTGGG - Intergenic
1025129897 7:56369757-56369779 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1025130195 7:56370986-56371008 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1025130515 7:56372284-56372306 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1025130833 7:56373578-56373600 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1027151758 7:75738611-75738633 GGACCCCAGGGTACCCCAGCTGG - Intronic
1027165306 7:75829971-75829993 AATCCCCAGGGAGCCCCAGGGGG + Intergenic
1027165837 7:75833773-75833795 AATCCCCAGGGAGCCCCAGGGGG - Intergenic
1027187393 7:75980525-75980547 AGTCCCCAGGGAGGCACCGCAGG - Intronic
1029653007 7:101906533-101906555 GGCCCCCAGGAAGCCACAGAAGG + Intronic
1029927091 7:104329256-104329278 GGACCCCGGGGCGCCCGAGCCGG + Intronic
1030100495 7:105941256-105941278 TGTCCCCAGGGAGCCCTGTCAGG - Intronic
1032086815 7:128888812-128888834 GGCACCCCGGGAGCCCCAGCAGG + Intronic
1032780586 7:135162315-135162337 GGCCTCCTGGAAGCCCCAGCAGG - Intronic
1032793798 7:135261518-135261540 TGTCCCCAGGCAGCCAAAGCAGG - Intergenic
1033241035 7:139680321-139680343 GGTGCCCAAGCAGCCCCAGTAGG + Intronic
1033607260 7:142936460-142936482 TGTCCCCCGGCAGTCCCAGCTGG + Intergenic
1034469969 7:151249774-151249796 GGTGGCAAGGGAGCCCCAGAAGG + Intronic
1034899223 7:154897201-154897223 GACCCCTGGGGAGCCCCAGCAGG - Intergenic
1034969490 7:155410252-155410274 GGTCCTCAGGGAGTCCCAAAGGG - Intergenic
1035093202 7:156331330-156331352 GGTCTCAAAGGAGTCCCAGCAGG + Intergenic
1035167421 7:157000005-157000027 GGTCCTCAGGAAGCCTCGGCCGG + Intronic
1035234012 7:157484581-157484603 GATCCCCAGGGAGCTGCCGCGGG - Intergenic
1036641687 8:10588615-10588637 GGTCCCCAGAGAGTGCCTGCAGG - Intergenic
1036828414 8:11999108-11999130 GGTCTCAAGTGAGCCCCAGCTGG + Intergenic
1037876546 8:22551603-22551625 GGTCCCCGGGGAGCCCTCTCTGG - Intronic
1037915981 8:22773751-22773773 GTTCCCTTGGGAGCCTCAGCCGG + Intronic
1038062519 8:23928751-23928773 GATCCTCAGAGAGCCTCAGCAGG - Intergenic
1039419660 8:37425551-37425573 GATCCACAGAGAGTCCCAGCAGG + Intergenic
1039568791 8:38570089-38570111 GCTCCCCAGGCAGCCCCCACTGG - Intergenic
1039835543 8:41253610-41253632 TTTCCCCAGGGAGCCCCACCAGG + Intergenic
1043384246 8:79732392-79732414 GGGCCCCTTTGAGCCCCAGCTGG + Intergenic
1043483972 8:80680594-80680616 GGTCCACACAGATCCCCAGCAGG + Intronic
1044013686 8:87025291-87025313 GGGACCCAGGTTGCCCCAGCTGG - Intronic
1045060061 8:98403395-98403417 TGATCCCAGGAAGCCCCAGCAGG + Intronic
1046239689 8:111475012-111475034 AGTCATCAGGGACCCCCAGCCGG + Intergenic
1047942371 8:129837709-129837731 GGGCACCAGGGAGCCACAGAAGG - Intergenic
1048432286 8:134381657-134381679 GGTTCCCGGGGGTCCCCAGCTGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049512751 8:143037999-143038021 GACCAACAGGGAGCCCCAGCAGG + Intergenic
1049542112 8:143213380-143213402 GACCTCCAGGGACCCCCAGCAGG + Intergenic
1049653379 8:143787061-143787083 GGGCACCAGGGAGCTCCAGAGGG + Intergenic
1049926979 9:418957-418979 GGACCCCAGGGAGCCTAAGGAGG + Intronic
1053353923 9:37430917-37430939 TGTTCCCAGGGAGCCTCTGCAGG + Intronic
1053391869 9:37741662-37741684 GCTCCTCTGGGAGCCCCATCAGG + Intronic
1056216278 9:84408638-84408660 GGTGCGCAGGGTCCCCCAGCAGG + Intergenic
1057200715 9:93138340-93138362 TGGCCCCTGGGAGCCCCAGTGGG - Intergenic
1057314795 9:93961272-93961294 GCTCCCCAGGCTGCCCAAGCTGG - Intergenic
1057551491 9:96054011-96054033 GGGGCCGGGGGAGCCCCAGCAGG - Intergenic
1057953120 9:99385801-99385823 GGTCCCCAGGGTCCCCAGGCTGG - Intergenic
1058229781 9:102411276-102411298 GGTCCAAAGGGAGCCCCTGCTGG - Intergenic
1058404588 9:104657656-104657678 GGTAGCCAGAAAGCCCCAGCAGG + Intergenic
1059757927 9:117311042-117311064 TGGTCCCAGGGAGCCCCAGTAGG - Intronic
1060553471 9:124496562-124496584 GGACCCCAGGGGGCTCCAGAGGG - Intronic
1060594916 9:124841878-124841900 GGTCCCCCTAGAGCCCCAGGAGG + Intergenic
1060789481 9:126476315-126476337 ACTCCCCAGGGTGCCCCAGAAGG + Intronic
1060932060 9:127495441-127495463 GGTCCCCAGGGCTCCCTGGCCGG - Intronic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1061511939 9:131067000-131067022 GGTGCCCAAAGAGCCCCAGCGGG - Exonic
1061682742 9:132250941-132250963 TGGCCCCAGGGGGCCCCAGGAGG - Intergenic
1061747925 9:132753646-132753668 CATCCCCAGGGTGGCCCAGCTGG + Intronic
1062324026 9:136004010-136004032 GTTCCCCAGGGAGCCCCAAGGGG + Intergenic
1062348084 9:136124701-136124723 GGGCCCCTCGGAGCCCCTGCGGG + Intergenic
1062450051 9:136611362-136611384 GGGACCCAGGGAGCTCCAGGAGG + Intergenic
1062516456 9:136939420-136939442 GGTCCCCAGGGCTTCCCAGCTGG + Intronic
1062656413 9:137606241-137606263 GGGGCGCAGGGAGCCGCAGCAGG - Intronic
1062690264 9:137837914-137837936 GGAGCCCAGGGGGCCCCAGCCGG + Intronic
1185805128 X:3050166-3050188 GGGCCACAGGGAGCCCCAACTGG + Intronic
1187611822 X:20951638-20951660 GGCCCCCAGTGAGCTCAAGCTGG - Intergenic
1188005347 X:25012853-25012875 GGGCCCCAGGGAGGGACAGCGGG - Intronic
1190298593 X:49043061-49043083 AGGCCCCTGGGAGCCCCAGTCGG + Intronic
1190322429 X:49186839-49186861 GGTTCCCAGCGAGCACCAGCTGG - Intergenic
1190707732 X:53044640-53044662 GGTCCCCAGGGTGCATCAGCAGG - Intergenic
1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG + Intronic
1190918342 X:54826525-54826547 GGTGCTCAGTGAGCCCCAGCGGG - Intergenic
1191875208 X:65788500-65788522 GGGGCAGAGGGAGCCCCAGCCGG - Intergenic
1195154980 X:102113780-102113802 AGTCCCCAGGCTGCCCCAGCTGG + Intergenic
1196031542 X:111098794-111098816 GGTCCCCAGGGATCCTGAGAAGG - Intronic
1198147908 X:133876577-133876599 GGTCACCAGGGAGCCCTGTCTGG - Intronic
1198533676 X:137567243-137567265 GCTCCCCACGCAGCCCCAGGTGG - Exonic
1199673521 X:150165984-150166006 GGCCCCCTTGGAACCCCAGCTGG + Intergenic
1200065553 X:153502719-153502741 GGTCACCAGGAGGCCCCTGCTGG - Intronic
1200137292 X:153881371-153881393 GGTTCCCTGGGAAGCCCAGCAGG - Intronic
1202176675 Y:22104832-22104854 GGTCTGCAGGGAGCCCCACCTGG + Intergenic
1202214686 Y:22481552-22481574 GGTCTGCAGGGAGCCCCACCTGG - Intergenic