ID: 1096239630

View in Genome Browser
Species Human (GRCh38)
Location 12:49952826-49952848
Sequence CAGTGTCCTCAAAGGACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096239630_1096239633 -2 Left 1096239630 12:49952826-49952848 CCAAGTGTCCTTTGAGGACACTG 0: 1
1: 0
2: 0
3: 18
4: 198
Right 1096239633 12:49952847-49952869 TGAGAGCCAGCCTGGCCACCAGG 0: 1
1: 0
2: 3
3: 57
4: 467
1096239630_1096239632 -10 Left 1096239630 12:49952826-49952848 CCAAGTGTCCTTTGAGGACACTG 0: 1
1: 0
2: 0
3: 18
4: 198
Right 1096239632 12:49952839-49952861 GAGGACACTGAGAGCCAGCCTGG 0: 1
1: 0
2: 7
3: 47
4: 638

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096239630 Original CRISPR CAGTGTCCTCAAAGGACACT TGG (reversed) Intronic
900210797 1:1454887-1454909 CAGTGTCTCCACAGGTCACTCGG + Intronic
903009160 1:20318161-20318183 CAGAGCCTTAAAAGGACACTAGG + Intronic
904596757 1:31651540-31651562 CACGGTCCTCAAAGTCCACTGGG - Intergenic
907268286 1:53275874-53275896 AGGAGTCCTCAAAGGACACCTGG + Intronic
908619402 1:65960748-65960770 CAGTGTCTTCTGAGGCCACTGGG + Intronic
914397128 1:147280303-147280325 CAGTGTGCCCAAATGACAATAGG - Intronic
915755176 1:158252466-158252488 CAGACTCCTCAAAGGACAGATGG - Intergenic
916826768 1:168449454-168449476 CAGAGTCCTGAAAGGAAACTAGG - Intergenic
917537967 1:175888131-175888153 CAGTATCTCCAAAGGCCACTAGG - Intergenic
917767607 1:178239657-178239679 TAGTGTCCTCAAAAGTCCCTTGG - Intronic
919006658 1:191908178-191908200 CAGTTTCCTCCCAGGACACATGG + Intergenic
919433207 1:197523147-197523169 GAATGTCCTCAAAGGTCATTGGG - Intronic
920506152 1:206516933-206516955 CCGGGTCCTGAAATGACACTTGG - Intronic
921213406 1:212918361-212918383 GACTGTTCCCAAAGGACACTTGG + Intergenic
922384177 1:225065001-225065023 CAGTTTCCTCAAAGGTAAATTGG + Intronic
922418601 1:225444124-225444146 AAGTGTCCTAAAAGGACAGCTGG - Intergenic
923361101 1:233211869-233211891 CAGTTTTTTCAAAGGACTCTGGG + Intronic
1063074890 10:2705093-2705115 GAGTGTGCTCAGAGGCCACTTGG - Intergenic
1063544063 10:6962746-6962768 CAATGACCTCAAAGGACAGCTGG + Intergenic
1063673787 10:8121551-8121573 CAGTGTCCTAACAGGTCTCTTGG + Intergenic
1064967094 10:21026186-21026208 TACTGTCCTCAGAGGACATTTGG + Intronic
1069847074 10:71379818-71379840 CAGTGTCCACAAAGTGCACTCGG - Intergenic
1070487105 10:76941900-76941922 CAGTGTCCTCACATGACAGAAGG + Intronic
1070766727 10:79061063-79061085 CAGTGTCCACCAGGGACCCTTGG - Intergenic
1071438784 10:85671018-85671040 CAGTGTCCTCATAGGACATAGGG - Intronic
1072630087 10:97139799-97139821 CAGTGTGCACACAGGGCACTGGG + Intronic
1073760045 10:106619537-106619559 CTGAGGCCCCAAAGGACACTGGG - Intronic
1075798873 10:125140077-125140099 AAGTGTCCTCACACTACACTGGG + Intronic
1081941991 11:46951046-46951068 CAGTTTCCTCAAAGAAAAGTGGG - Intronic
1084304749 11:68274507-68274529 CTGTGCCTTCAATGGACACTAGG - Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1086178410 11:83919974-83919996 CAGGTTGCTCAAAGAACACTTGG + Intronic
1086493614 11:87380163-87380185 CTCTGACCTCAAAGGACTCTTGG + Intergenic
1086501349 11:87456888-87456910 CAGAGACATCAAAGGACCCTAGG - Intergenic
1088011391 11:105005562-105005584 CAGTGTACTCAAAGTATTCTGGG + Intronic
1088109833 11:106248465-106248487 CAGTGTCCCTAAATGACCCTGGG - Intergenic
1088597335 11:111450211-111450233 GAGTGTCCTGAAAGGACACAAGG - Intronic
1090300905 11:125638582-125638604 CAGTGTCCTCAGGGGAGAATTGG - Intronic
1090616917 11:128522843-128522865 CCGTGTCCTCAAAGGGCTTTAGG + Intronic
1090890394 11:130917909-130917931 CAGTGTCCACTAAGCAGACTGGG + Intergenic
1090908717 11:131099459-131099481 CCCAGTCCTCAAAGGATACTGGG - Intergenic
1092963502 12:13618554-13618576 CAGTGTCCACAATGGACTCTGGG - Intronic
1095953582 12:47794709-47794731 AAGTGTCCTCAGAAGACTCTGGG - Intronic
1096239630 12:49952826-49952848 CAGTGTCCTCAAAGGACACTTGG - Intronic
1099316001 12:81083083-81083105 AACTATCCTCTAAGGACACTTGG - Intronic
1102053780 12:109880901-109880923 CAGTGTCCACCCAGGTCACTTGG - Intergenic
1102401372 12:112632555-112632577 CACTCTCCTCCAAGGACAGTGGG - Intronic
1102895087 12:116592408-116592430 CAGAGACCTCAGAGGCCACTGGG - Intergenic
1103862496 12:124025986-124026008 CAGTCTCATCCAAGGACAGTGGG + Intronic
1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG + Intergenic
1107559247 13:41545500-41545522 CAAAGTCTCCAAAGGACACTGGG + Intergenic
1108400313 13:50035047-50035069 CAGTGTCCTTAAGTGACATTTGG + Intergenic
1109879440 13:68451555-68451577 CAGTTTCCTCCCAGGACACATGG - Intergenic
1111642872 13:90993358-90993380 AACTGTCCTCCAAGGACAGTTGG - Intergenic
1112528008 13:100171355-100171377 CACTGTCCTGAAAGGTGACTGGG + Intronic
1112953710 13:105034093-105034115 CTGTGTCCTCACAGGACAGAAGG + Intergenic
1113255207 13:108497883-108497905 CAGTCTCCTTCAAGAACACTGGG - Intergenic
1114953158 14:27782336-27782358 AAGTGTTCTTAAAGAACACTTGG - Intergenic
1116145979 14:41069557-41069579 CTGTGTCCTCACAGGACAGAAGG - Intergenic
1119580188 14:75771639-75771661 AAGCATCCTCAAAGGCCACTTGG + Intronic
1120921425 14:89759226-89759248 GAGTGGCCTCAAAAGACACCTGG - Intergenic
1122350695 14:101088325-101088347 CAGATTCCTCAATGGCCACTTGG + Intergenic
1124909348 15:33903587-33903609 AAGTTTCCTCAAAGCACACATGG + Intronic
1125744579 15:41989674-41989696 CAGTTCCCCCAAAGGACACATGG + Intronic
1126117911 15:45225739-45225761 CTGTGTCCTCAAAGGGCAGAGGG + Intergenic
1127454103 15:59142286-59142308 CAGTCTACACTAAGGACACTAGG - Intronic
1128473324 15:67974951-67974973 CAGTGCTCTTCAAGGACACTGGG - Intergenic
1128867195 15:71123154-71123176 CAGTGTCCACAGAGGTCTCTTGG + Intronic
1130557114 15:84930388-84930410 CAGTGTCCACACAGGGCCCTGGG + Intronic
1131537769 15:93251987-93252009 CAGAGTCCTCAAATGAGACATGG + Intergenic
1132908927 16:2298630-2298652 CAGGGTCCTCAGAGGAAATTAGG - Intronic
1133008112 16:2895938-2895960 CAGTGTCCTCAACTGTGACTGGG + Intronic
1135323774 16:21513225-21513247 CAGTGGACTCAAAGGCCAGTTGG - Intergenic
1135742142 16:24985069-24985091 CTGTGTCCCCAGAGGACATTTGG + Intronic
1136091579 16:27923983-27924005 CAGTCTCCTCAAAGTAAAATAGG + Intronic
1136335257 16:29606490-29606512 CAGTGGACTCAAAGGCCAGTTGG - Intergenic
1137860317 16:51840324-51840346 CATTGCCCACAAAGGACACTGGG + Intergenic
1140509741 16:75498541-75498563 CAGTCTCCTCCAAGAACACATGG - Intergenic
1140515535 16:75538749-75538771 CAGTCTCCTCCAAGAACACATGG - Exonic
1141425257 16:83940671-83940693 GCGTGTCCTCAGAGGACAGTGGG + Intronic
1141675555 16:85515552-85515574 CTGTGTCCTCTGAGGACCCTGGG + Intergenic
1141720561 16:85753024-85753046 CAGTTTCCTCAAAGGAGAACTGG + Intergenic
1142035982 16:87862332-87862354 CAGTGGACTCAAAGGCCAGTTGG - Intronic
1142202433 16:88767688-88767710 CAGGGTCCCCAAAGGTCACAGGG + Intronic
1143072766 17:4311167-4311189 CAGTGACCTCAGATGACACCAGG + Intronic
1143388747 17:6547696-6547718 CAGACTCCTCAAAGGACGCTGGG + Intronic
1144253616 17:13443947-13443969 CAGTGTTCTCAGGAGACACTGGG - Intergenic
1145712410 17:26989772-26989794 CAGTGTGCACAAAGGTCACAGGG - Intergenic
1149584543 17:57776799-57776821 CCCTCTCCTCAAAGGACACAAGG + Intergenic
1150233627 17:63574208-63574230 CAGAGTCTTCAAAGGAGAATAGG - Intronic
1151703264 17:75754245-75754267 CAGGGGCCTCAAAGGACAGGAGG + Intronic
1152058628 17:78051896-78051918 TATTGTCCTCACTGGACACTTGG - Intronic
1153962288 18:10149941-10149963 CAGTGGCCTCAGATGACACTGGG - Intergenic
1156738597 18:40295626-40295648 CAGTCTCCTCTAAGAACGCTGGG - Intergenic
1157405278 18:47417588-47417610 CAGTGTGCTGGGAGGACACTGGG + Intergenic
1158115514 18:53991099-53991121 CACTCTCCTCCAAGGTCACTTGG + Intergenic
1158118064 18:54018759-54018781 CAGTTTCCTTAGAGGACACAAGG - Intergenic
1158243612 18:55405807-55405829 CAGAGTCCCCAAAGTACTCTTGG + Intronic
1158891644 18:61877929-61877951 CAGTGTATTCCAATGACACTTGG + Intronic
1159528993 18:69631300-69631322 CAGCAGCCTCAAAAGACACTGGG - Intronic
1161526794 19:4760948-4760970 CAGTGCCATTAAATGACACTTGG - Intergenic
1166895426 19:46019315-46019337 CTATGTGCTCAAAGGACACCGGG - Exonic
1168578664 19:57535146-57535168 CAATATCCTCAAAGGTCACATGG - Exonic
925648844 2:6067299-6067321 CTGTGTCCTGAAAGGACATCAGG - Intergenic
925648848 2:6067328-6067350 CTGTGTCCTGAAAGGACATCAGG - Intergenic
926564392 2:14453861-14453883 CTGTGTCCTAAAATGACACAAGG + Intergenic
926953153 2:18265932-18265954 TAGTGTCCTAAAATCACACTAGG + Intronic
928447746 2:31348054-31348076 CAATGTCCTCAGAGGTCACCTGG + Intronic
930006199 2:46899009-46899031 CAGTTTCCTCATATGACAATAGG - Intergenic
931880672 2:66567258-66567280 CTGTGTACTCAAAGGTCACTGGG + Intronic
931943776 2:67282635-67282657 CAGTAACCACAAAGGACATTTGG - Intergenic
932343499 2:70981091-70981113 CAGTGTCTTCAACTGAAACTTGG + Intronic
934484169 2:94687098-94687120 AAGTGTTCTTAAAGAACACTTGG + Intergenic
935222589 2:101028068-101028090 CAGGGTCCTCCAAGGCCACGAGG - Exonic
935351629 2:102155798-102155820 CAGTGTGCTCAAGGGGCACAAGG - Intronic
940418432 2:153449785-153449807 CAGTGTCCTCACATGACAGAAGG + Intergenic
944781754 2:203025720-203025742 CTGTGAACTCAGAGGACACTTGG + Intronic
1168918411 20:1510596-1510618 CAGTAACCTCAATGGAAACTGGG - Intergenic
1169784745 20:9347647-9347669 AAGTGACTTCAAAGGACACATGG - Intronic
1171104496 20:22419879-22419901 CAGTGTCTTAAAACAACACTGGG + Intergenic
1172636800 20:36415602-36415624 CAGTGTCCTCAAAGGGTTGTTGG - Intronic
1174144546 20:48442276-48442298 CTGTGTCCTCAAACGACAGAAGG + Intergenic
1174641311 20:52046843-52046865 TAGTGTCCCTCAAGGACACTTGG + Intergenic
1174901525 20:54505857-54505879 CAGTGTACTCAAAGCCCGCTGGG + Intronic
1176210060 20:63915301-63915323 CTGTGACCTCAAAGGTGACTTGG + Intronic
1177583440 21:23058146-23058168 CAGTTCCCTCAAAGCACTCTGGG - Intergenic
1178190198 21:30271229-30271251 CAGAGTCGTAAAAGGAGACTGGG - Intergenic
1179164540 21:38925283-38925305 GAGTGTCCTCAGAAGACAGTTGG - Intergenic
1179325405 21:40338215-40338237 CATTGTTCTCAAATGCCACTTGG + Exonic
1179594970 21:42437380-42437402 CAGGGTCCTCAAAGGGCCCCGGG - Intronic
1181360505 22:22330634-22330656 CTGTGTCCTCACAGGAAACTGGG + Intergenic
1181956158 22:26589507-26589529 CAGTGACCTCCAAGTTCACTAGG + Intronic
1182747511 22:32616916-32616938 AAGTGGCCACAAAGGACACAAGG + Intronic
1184168222 22:42743240-42743262 CAGGGTCCTCCCAGGACCCTAGG - Intergenic
1184661791 22:45968880-45968902 CAGTCTCCTCATGGGTCACTTGG - Intronic
1185330238 22:50249096-50249118 CAGTCACCTCAAAGGCCAGTGGG + Exonic
1185380384 22:50505086-50505108 CAGTGCCCACAAGGGACAGTTGG + Exonic
950461033 3:13122345-13122367 CAAAGTCCTCAAGGGGCACTCGG - Intergenic
950567980 3:13782540-13782562 CAGGGGCCTTATAGGACACTAGG - Intergenic
952610176 3:35199224-35199246 CAGTCTCCTAAAAAGAAACTAGG - Intergenic
952993008 3:38848440-38848462 GAGTGTCCTGTAAGGTCACTAGG + Intronic
954983671 3:54769930-54769952 CAGTGTCCCCAGAAAACACTGGG + Intronic
955603274 3:60671109-60671131 CAGTGTCTTCAAGGAACACATGG + Intronic
955711869 3:61788075-61788097 ACCTGTCCTCAAAGGACACACGG + Intronic
956756929 3:72397958-72397980 GAGTCTCTTTAAAGGACACTTGG - Intronic
958162803 3:89837993-89838015 CAGTGTCCTCAAGGAACATATGG - Intergenic
961650212 3:128413404-128413426 CAGGGACCTCAGAGGGCACTGGG + Intergenic
961831042 3:129623181-129623203 CAGTATCCACGAAGGAGACTCGG + Intergenic
967926423 3:194652382-194652404 CAGGGTGCCCAAAGAACACTGGG + Intronic
969571481 4:8011277-8011299 CAGTGTTTGCAAAGGAAACTTGG - Intronic
970426072 4:15947474-15947496 CGGTGCCCTCAAAGCACCCTAGG + Intergenic
970881277 4:20935060-20935082 CTGTGTCCTCAAGGGACATTTGG - Intronic
972012353 4:34200868-34200890 CTGTGTACTCAATGGACAATTGG - Intergenic
974876674 4:67711214-67711236 CAGAGGCCTCACATGACACTGGG - Intergenic
977233950 4:94484694-94484716 TACTGTACTAAAAGGACACTGGG + Intronic
980645982 4:135643066-135643088 CAGTCTCCTCTCACGACACTTGG - Intergenic
981267310 4:142802076-142802098 CATCCTCCTCAAAGGTCACTAGG + Intronic
983952139 4:173654688-173654710 CACTGTCCACAAAGGAGAGTCGG - Intergenic
989270820 5:39530914-39530936 CAGTCTCCTCTGAGGAGACTGGG - Intergenic
989270823 5:39530916-39530938 CAGTCTCCTCAGAGGAGACTGGG + Intergenic
991201887 5:64004287-64004309 CTGTGTCCTCCAAGGACAGTAGG - Intergenic
991256656 5:64621783-64621805 CAGACACCTCAAATGACACTGGG - Intergenic
997403090 5:133617558-133617580 CAGTATCTTCAAAGAAGACTTGG - Intergenic
999100758 5:149024026-149024048 CAGTGTTCTCAAAGGGCTGTTGG + Intronic
1001608156 5:172978777-172978799 CAGTGTGGTCCAAGGACCCTTGG - Intergenic
1002095491 5:176828475-176828497 CCGTGCCCTCAAGGGACTCTTGG - Intronic
1006930028 6:37681937-37681959 AAGTGGCCTCAAGGGATACTAGG - Intronic
1008271089 6:49490905-49490927 CAGTTCCATCAAAGAACACTGGG + Intronic
1010169030 6:72953084-72953106 CAGTGTGCTCAAAATGCACTAGG - Intronic
1011883099 6:92056921-92056943 CATTGTCCTCAAAGAAAACATGG + Intergenic
1013292293 6:108729813-108729835 CAGTGTCCTGAAAGCACAGAGGG + Intergenic
1018710606 6:166495831-166495853 CAGGGTCAGCAAAGGCCACTGGG + Intronic
1018713380 6:166513624-166513646 CACTGTCCTCACTGGACACAGGG + Intronic
1019365706 7:631618-631640 CAGTGTGCTCGGAGGACAGTGGG - Intronic
1019365709 7:631620-631642 CACTGTCCTCCGAGCACACTGGG + Intronic
1021719452 7:23491495-23491517 AAGTGTCATCAAAAAACACTGGG + Intergenic
1022788953 7:33667541-33667563 CTGTGTCTCCATAGGACACTAGG - Intergenic
1025028214 7:55535371-55535393 CAGTGAGCTCAGAGGGCACTGGG + Intronic
1026483879 7:70801146-70801168 CTGTGTCCTCCCAGGACAGTAGG - Intergenic
1027358873 7:77387584-77387606 CAGTCTCCTCACAGGACTCTAGG - Intronic
1030671687 7:112345178-112345200 CTGTGTCCTCACAGGACAAAAGG + Intergenic
1034331578 7:150287758-150287780 CTGTGTCATCAAAGAACACAGGG - Intronic
1034666461 7:152822109-152822131 CTGTGTCATCAAAGAACACAGGG + Intronic
1037287527 8:17317400-17317422 CAGTGTCCTAAGAGGACAGCTGG + Intronic
1037536672 8:19831039-19831061 CAGTATACTCAAAGGAAAATAGG - Intronic
1038611839 8:29065889-29065911 CTGTGTCCTCAGAGCACTCTAGG + Intergenic
1038622601 8:29158009-29158031 CAGTGTGCTCAAAGAACAGATGG - Intronic
1041880562 8:62745231-62745253 CACTGTCCTCAAAGGAACCTTGG + Intronic
1042632733 8:70837762-70837784 CAGTGTCCTCAAAGGATAACTGG + Intergenic
1043836063 8:85047930-85047952 GAGTGTCCTCAATGGAAAATTGG - Intergenic
1047726448 8:127688060-127688082 CAGTGTCTTGAAAAGTCACTAGG + Intergenic
1048197510 8:132344367-132344389 CAGTTTCCTCAAATGGCACCTGG - Intronic
1048337374 8:133513085-133513107 CCGTGTTCTCTGAGGACACTGGG - Intronic
1051891024 9:21943139-21943161 CAGTGTTCTCAAAGGAGAGTTGG + Intronic
1052750889 9:32489218-32489240 CAGTTTTCTCAAAAGACACATGG + Intronic
1053673623 9:40397296-40397318 AAGTGTTCTTAAAGCACACTTGG - Intergenic
1053923425 9:43023654-43023676 AAGTGTTCTTAAAGAACACTTGG - Intergenic
1054384723 9:64537361-64537383 AAGTGTTCTTAAAGCACACTTGG - Intergenic
1054511006 9:65978993-65979015 AAGTGTTCTTAAAGCACACTTGG + Intergenic
1055424699 9:76182060-76182082 CAGAGTCTTCAAAGGAAAATAGG + Intronic
1056900864 9:90598089-90598111 CAGTTTCCTCAACTGTCACTGGG - Intergenic
1057875676 9:98752474-98752496 CACTGTGCCCAATGGACACTAGG + Intronic
1058443620 9:105033577-105033599 CAGTGTCCCCAAAGGACTTCAGG + Intergenic
1059224682 9:112660622-112660644 GAGTATCCTCAAGCGACACTTGG + Exonic
1059357161 9:113708840-113708862 CAGTTTCCTCAATGGCCACATGG + Intergenic
1059535225 9:115074375-115074397 CTGTGTCCTCACAGGACAGAAGG - Intronic
1061206576 9:129167329-129167351 CAGTCTCCTCAAAGGAAGCTGGG - Intergenic
1061626385 9:131842953-131842975 CAGTTTCCTCAGAGGCCTCTGGG - Intergenic
1062090159 9:134671957-134671979 AAGTGTCCTCACAGGGCCCTTGG - Intronic
1062700987 9:137902894-137902916 TCGTCTCCTCAGAGGACACTCGG - Intronic
1185830697 X:3300213-3300235 CATTGTTCTCAAAGGTCCCTTGG + Intergenic
1186837104 X:13449081-13449103 CAGTGACCTCAAAGCACTGTGGG - Intergenic
1187768602 X:22670455-22670477 CTGTGTCCTCAAAGGTAACATGG - Intergenic
1191696442 X:63995506-63995528 CAGATTCCTCCAAGGACACCTGG - Intergenic
1194644304 X:96439934-96439956 AACTGTCTTCAAAGGAGACTAGG + Intergenic
1195869874 X:109474741-109474763 AAGTGTCCCACAAGGACACTGGG + Intronic
1197769301 X:130079959-130079981 CAAAGTGCTCAAAGGCCACTAGG + Intronic