ID: 1096239774

View in Genome Browser
Species Human (GRCh38)
Location 12:49953612-49953634
Sequence GGTAGATTCCGGACTCATAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096239764_1096239774 24 Left 1096239764 12:49953565-49953587 CCTGAGGCCTGAAAGGCAGTGGG 0: 1
1: 0
2: 2
3: 34
4: 341
Right 1096239774 12:49953612-49953634 GGTAGATTCCGGACTCATAGCGG 0: 1
1: 0
2: 0
3: 3
4: 37
1096239767_1096239774 17 Left 1096239767 12:49953572-49953594 CCTGAAAGGCAGTGGGGAATAGA 0: 1
1: 0
2: 3
3: 24
4: 253
Right 1096239774 12:49953612-49953634 GGTAGATTCCGGACTCATAGCGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096239774 Original CRISPR GGTAGATTCCGGACTCATAG CGG Intronic
908867433 1:68566114-68566136 GGTAGATTCCGCATCCACAGTGG + Intergenic
912647023 1:111402838-111402860 GCTAGTTTCCGGAATCATACAGG - Intergenic
920014389 1:202894615-202894637 GGAAGGTGCCGGACTCGTAGTGG - Exonic
921898963 1:220430283-220430305 TGTACATTCCTGCCTCATAGTGG - Intergenic
923001571 1:230010179-230010201 GGTAGTCACCGTACTCATAGAGG + Intergenic
1068211314 10:53924256-53924278 GGTGGACTCCGCACTCAGAGCGG + Intronic
1074047283 10:109850525-109850547 GGTAGCTTCTGGACTCTGAGAGG - Intergenic
1080302861 11:30804002-30804024 TGTAGTTTCCTGACTAATAGGGG + Intergenic
1093709422 12:22313045-22313067 GGTAGAGTCCGAGCTCATGGAGG + Intronic
1096239774 12:49953612-49953634 GGTAGATTCCGGACTCATAGCGG + Intronic
1109628704 13:65014524-65014546 GGTAGATTGCTTACTCATAATGG + Intergenic
1155622926 18:27801450-27801472 GGAAGATTCCAGACTCAAAGGGG + Intergenic
1156897309 18:42260819-42260841 TGTAGATTCCTGTCTCGTAGAGG - Intergenic
1163505558 19:17704004-17704026 GCGAGGTTCCGGACTCAGAGAGG + Intergenic
929783714 2:44974253-44974275 GGTAGATAAGGGACCCATAGAGG - Intergenic
948663631 2:239521424-239521446 GGTGGATTCCAGAATCACAGGGG - Intergenic
1173148322 20:40544490-40544512 GGTCCATTCCAGACTCAAAGGGG - Intergenic
1174282187 20:49447279-49447301 GGAAGATTCGAGACTCTTAGTGG + Intronic
1179232214 21:39514703-39514725 GGTAGAATCCAGTCTCATATTGG - Intronic
1181087893 22:20451365-20451387 GGAAGGTGCCGGACTCGTAGTGG + Intronic
949994045 3:9602359-9602381 GGGAGATTCCAGCCTCACAGTGG - Intergenic
952662560 3:35869295-35869317 GGTACCTTCCGCACTCTTAGTGG + Intergenic
976854510 4:89587531-89587553 GGTAGATTCCCAGCACATAGTGG + Intergenic
981260536 4:142713351-142713373 GGTAGAATACAGAATCATAGAGG + Intronic
997212873 5:132087792-132087814 AACAGAGTCCGGACTCATAGTGG - Intergenic
998342631 5:141431683-141431705 GGTAGAATCCTGACTCCTCGTGG - Exonic
1002464147 5:179397037-179397059 GGTAGATTGCTGGCTCATAGAGG - Intergenic
1011167971 6:84471546-84471568 GGTAGATGACTGACTCATGGGGG + Intergenic
1011355849 6:86472734-86472756 TGTAAATTCAGGACTCAGAGAGG + Intergenic
1013875966 6:114828766-114828788 GATATATGCTGGACTCATAGAGG + Intergenic
1017541300 6:155405728-155405750 GTTAGATTCCGGAGTCTTTGCGG - Intronic
1018704889 6:166456616-166456638 GTTAGATCCTGGACTCACAGTGG - Intronic
1033135214 7:138778533-138778555 TGTATATTCCGGACTCAGTGCGG + Intronic
1033967658 7:146996855-146996877 GGGAGATAACGGAATCATAGGGG + Intronic
1034950753 7:155295839-155295861 GGAAGATCCTGGAGTCATAGAGG - Intergenic
1042051212 8:64710120-64710142 GATAGATTCCAGAATCACAGGGG - Intronic
1050053934 9:1632296-1632318 GGCAGATTCAGGACTCACTGAGG - Intergenic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1193576471 X:83203973-83203995 AGTAGACTGCGGACTCACAGAGG - Intergenic
1196963054 X:121025006-121025028 GGTAGATTCTGCATTCATAGAGG + Intergenic
1201969792 Y:19779627-19779649 GGATGATTCTGGACTCACAGAGG - Intergenic