ID: 1096240436

View in Genome Browser
Species Human (GRCh38)
Location 12:49956937-49956959
Sequence GACTCAGATCTGCCTCTGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 2, 1: 0, 2: 1, 3: 21, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096240436_1096240438 4 Left 1096240436 12:49956937-49956959 CCAGGCAGAGGCAGATCTGAGTC 0: 2
1: 0
2: 1
3: 21
4: 260
Right 1096240438 12:49956964-49956986 ACCCAGGCTTCTAAATTTCTAGG 0: 1
1: 0
2: 2
3: 22
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096240436 Original CRISPR GACTCAGATCTGCCTCTGCC TGG (reversed) Exonic
900418187 1:2544551-2544573 GACTCTGAGCAGCTTCTGCCTGG + Intergenic
901768661 1:11519543-11519565 GACCCAGCGCTGCCTCTGCCAGG + Intronic
903250567 1:22050417-22050439 GTCTCAGCTCTGCCACTGCTTGG + Intergenic
905257066 1:36691647-36691669 GACTCAGATCCGGCCCTACCTGG - Intergenic
905264591 1:36742739-36742761 GACCCAGAGCTGGCCCTGCCTGG - Intergenic
905940986 1:41863198-41863220 GGGTCAGATCTGCTTCTGCTGGG + Intronic
906543157 1:46603674-46603696 GCCTCTGATCTGCCACTGTCAGG + Intronic
907424700 1:54372349-54372371 GACAAAGATCTGCACCTGCCTGG + Intronic
910128892 1:83879532-83879554 GATTCTGATCTGCCTTTGACTGG + Intronic
911575740 1:99575512-99575534 CACTCAGATCTTCCTCTGAAGGG - Intergenic
912245099 1:107953645-107953667 GTCCCAGATCTGTCTCTGACAGG - Intronic
912877807 1:113379939-113379961 GCCTAAGCTCTCCCTCTGCCTGG - Intergenic
913091563 1:115479713-115479735 GACTCAGAGCTGCCCCAGCCCGG + Intergenic
913717240 1:121548653-121548675 GACTCAGATCAGCCAGTCCCTGG - Intergenic
919392723 1:197007225-197007247 GACTCTAATCTATCTCTGCCAGG - Intronic
920085050 1:203409222-203409244 AACCCAGCTGTGCCTCTGCCTGG - Intergenic
920264378 1:204710876-204710898 GACTGAGATCTGGCTCTGGGTGG + Intergenic
921936570 1:220801718-220801740 GATACACATTTGCCTCTGCCAGG + Intronic
923039164 1:230307503-230307525 CAATCATTTCTGCCTCTGCCTGG + Intergenic
923534802 1:234840898-234840920 AACTCAGCACTGGCTCTGCCTGG + Intergenic
1062950920 10:1502608-1502630 GCCTCAGTCCTGCCTCTGTCAGG + Intronic
1063331262 10:5161738-5161760 CACTCAAATCTGCCTCTCTCAGG + Intergenic
1063993711 10:11595597-11595619 GATTCATATTTGTCTCTGCCTGG - Intronic
1066001978 10:31113146-31113168 GACTCAGAGCTGCCTGGGCTTGG - Intergenic
1066457798 10:35586802-35586824 GACTCAGAGCTGCCTCTTCCAGG - Intergenic
1067146063 10:43694767-43694789 CATTCAGGGCTGCCTCTGCCTGG + Intergenic
1067695990 10:48536025-48536047 GACCCAGGCCAGCCTCTGCCGGG - Intronic
1069825263 10:71251015-71251037 GACTCAGATCTGGCTCAGTTGGG + Intronic
1070159194 10:73855465-73855487 CACTCAGCTCTGCCTGGGCCTGG + Intronic
1070673424 10:78394347-78394369 GACTTAGTTTTTCCTCTGCCAGG + Intergenic
1070981564 10:80652589-80652611 GATTCAGTTCTGACACTGCCTGG + Intergenic
1071320801 10:84455110-84455132 GACTCACATCTGCATGTGGCTGG - Intronic
1072522696 10:96242479-96242501 GCCTCAGATCTGTGTGTGCCTGG + Intronic
1072905593 10:99450430-99450452 GACTTGGATCTGCCTCAACCTGG - Intergenic
1073216302 10:101838598-101838620 GACTGAGAGCTGGCCCTGCCTGG + Intronic
1073789843 10:106928593-106928615 CTCTCAGCGCTGCCTCTGCCTGG - Intronic
1073957311 10:108888356-108888378 TACTCAGCTTTGCCTTTGCCTGG - Intergenic
1074039217 10:109771612-109771634 GACTCAGAGCTGCCTCTGTGTGG - Intergenic
1075562147 10:123475742-123475764 TACTCAGTTCTGCCACTGGCTGG - Intergenic
1075667968 10:124244377-124244399 GATTCAGGTCCGGCTCTGCCCGG + Intergenic
1076637618 10:131892465-131892487 GCCTCAGCACTGGCTCTGCCTGG - Intergenic
1076809461 10:132879067-132879089 CACCCAAAACTGCCTCTGCCTGG - Intronic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1078913518 11:15756067-15756089 GCTGCAGCTCTGCCTCTGCCAGG - Intergenic
1079375197 11:19886317-19886339 GACCCAGGTCAGGCTCTGCCTGG + Intronic
1081620751 11:44618049-44618071 GACTGAGATATGCCACTTCCAGG - Intronic
1083417362 11:62534363-62534385 GATTCAAATCAGCCTGTGCCAGG + Intronic
1083732466 11:64660260-64660282 GACCCACACCTGCCTCTGTCTGG - Intronic
1084013462 11:66365375-66365397 GGCTCACCTCTGCCTCTCCCAGG + Intronic
1084128865 11:67118733-67118755 GACGCAGATCTCCCACTGCTTGG + Intergenic
1084170288 11:67397608-67397630 GACCCAGTTCTGCCACTGGCTGG - Exonic
1086159231 11:83702689-83702711 GACACTGATCTGTCTCTTCCTGG + Intronic
1087861654 11:103165422-103165444 AACTAAGATCTGCCTTGGCCGGG - Intronic
1090036719 11:123255660-123255682 GACTCAGGCCTGCCTGGGCCAGG - Intergenic
1091117232 11:133024801-133024823 GACTCAGTTCTATCACTGCCTGG + Intronic
1095883608 12:47165230-47165252 AACTCAGATATGCCTCTGGTGGG - Intronic
1095939288 12:47715741-47715763 GACTCAAATGTGTCTCTACCTGG + Intronic
1096240436 12:49956937-49956959 GACTCAGATCTGCCTCTGCCTGG - Exonic
1097138505 12:56879440-56879462 AACTCAGGAGTGCCTCTGCCCGG + Intergenic
1097781667 12:63713858-63713880 GTCTCACCTCTGCCTCTTCCTGG - Intergenic
1101310483 12:103574301-103574323 GTCTCAGCTCTGCTTCTTCCAGG - Intergenic
1101695893 12:107126191-107126213 GGTTCAGAGCTGCCCCTGCCTGG + Intergenic
1104352552 12:128057479-128057501 CACTCAGCTCTGCCTCTACATGG + Intergenic
1106104239 13:26719729-26719751 GCCTCAGCTCTGGCCCTGCCGGG + Intergenic
1106422234 13:29594560-29594582 GACTCTGACCTGCCCATGCCTGG + Intronic
1106814162 13:33388450-33388472 CACACAGAGCTGCCTCTGCAGGG - Intergenic
1108721593 13:53138271-53138293 CTCTCAGATCTGCCCCGGCCTGG + Intergenic
1111897946 13:94164632-94164654 TACTGAGATCTTCCTCTTCCTGG + Intronic
1112389452 13:98969768-98969790 GGCACAGCTCTGCCTTTGCCTGG - Intronic
1116300580 14:43176180-43176202 GACAAAGAGCTGCCTCTGCGGGG - Intergenic
1117339528 14:54781631-54781653 GACTCACATCTCCATCTGCCTGG + Intronic
1118600708 14:67469978-67470000 GCCTGAGATCCCCCTCTGCCTGG + Intronic
1119625777 14:76174109-76174131 TATTCAGTTCTGCCTTTGCCAGG + Intronic
1119786828 14:77320636-77320658 GACGCAGCTCGGACTCTGCCAGG + Exonic
1121277863 14:92679849-92679871 GGCCCAGTTCTGCCTCTGACTGG + Intronic
1122150765 14:99725007-99725029 AACTCAGATCTGACTCTGTGAGG - Intronic
1122239029 14:100349647-100349669 GACCCAGCTCTGCCCCTGCCTGG - Intronic
1123105033 14:105837324-105837346 CCCTCAGCCCTGCCTCTGCCTGG + Intergenic
1124252227 15:28114243-28114265 GACACAGAGCAGCCTTTGCCAGG - Intronic
1124349221 15:28943264-28943286 AGCTCAGACCTGCCTCTGCCTGG + Intronic
1125067092 15:35500415-35500437 TTCTCAGAACTGCATCTGCCTGG + Intronic
1125482243 15:40088842-40088864 GACTCAGCCTGGCCTCTGCCTGG - Exonic
1126348166 15:47718086-47718108 GACGCCGAGCTGGCTCTGCCTGG - Intronic
1126669368 15:51102174-51102196 GTCTCAGCTCTGCCACTCCCAGG - Intronic
1128865695 15:71114119-71114141 CAATCAGAACTGGCTCTGCCAGG + Intronic
1129266415 15:74395801-74395823 GACTCAGCTCTGCCTCTGTGAGG - Intergenic
1129869490 15:78931581-78931603 GCCTCAGATGTGGCTCAGCCAGG - Intronic
1130439030 15:83932576-83932598 GTCTCAGGTCTGCCTCTGAATGG + Intronic
1132576302 16:665943-665965 TCCCCAGAGCTGCCTCTGCCTGG + Exonic
1133769349 16:8858797-8858819 GCCTGAGACCTGCATCTGCCAGG + Intronic
1134389644 16:13807694-13807716 GTCTCAGCTCTGCCTCTTCCAGG - Intergenic
1136103227 16:28010640-28010662 CATTCACATCTGCCTCTGACAGG + Intronic
1138246035 16:55467916-55467938 CACCCAGATCTGCCTCTGATTGG - Intronic
1138396600 16:56709422-56709444 GACTCAAATGATCCTCTGCCAGG - Intronic
1138449066 16:57082286-57082308 GTCTAACACCTGCCTCTGCCAGG + Intronic
1139699776 16:68700954-68700976 GCCTCAGATTCCCCTCTGCCAGG + Intronic
1140454814 16:75098826-75098848 GACACAGATCTGCACCTGGCTGG - Intronic
1141785540 16:86198173-86198195 CCCACAGATCAGCCTCTGCCGGG - Intergenic
1141813880 16:86396111-86396133 GTCTCAGCTCTACCTCTGACTGG + Intergenic
1141831520 16:86512065-86512087 GACTCAGCTGTGGGTCTGCCAGG - Intronic
1142697321 17:1640610-1640632 GACTCACAGCTGCCTGTGTCTGG + Exonic
1143538677 17:7557212-7557234 GCCCCAGCTCCGCCTCTGCCAGG + Exonic
1143666286 17:8363250-8363272 GACTCACTTATGCCTCTTCCAGG - Intergenic
1144387277 17:14760606-14760628 GACCCATTTCTGCCTGTGCCTGG + Intergenic
1145235962 17:21208640-21208662 CACTCAGATTTGCCTCTGCTGGG - Intronic
1146667212 17:34713131-34713153 GGCTCAGTTCAGCCCCTGCCAGG + Intergenic
1147320561 17:39643369-39643391 GGCTCCGCTCTGCCTCTTCCTGG + Intronic
1147557545 17:41488962-41488984 AACTCAGGTCTGCCTCACCCTGG - Intronic
1148187342 17:45654240-45654262 GAGTCAGATGTGCTTCTCCCTGG - Intergenic
1148440797 17:47710793-47710815 CACTCAGCTCTGGCTCTTCCTGG + Exonic
1148791132 17:50173614-50173636 GACTGAGGCCTTCCTCTGCCAGG + Intronic
1148877275 17:50697288-50697310 GGCCCAGCTCTGCCTCTGCTGGG + Intronic
1149107462 17:52986436-52986458 GACTCTGTTGTGCCTCTTCCTGG - Exonic
1150007656 17:61479664-61479686 GCCCCAGTTCTGCCTGTGCCTGG + Intronic
1151678672 17:75613008-75613030 GCCCATGATCTGCCTCTGCCAGG - Intergenic
1151679504 17:75616047-75616069 CACTCATTTCTGCTTCTGCCAGG + Intergenic
1154350278 18:13577348-13577370 GACTCAGGACTGCCGCTGCAGGG - Intronic
1155045888 18:22102713-22102735 CACTCAGATCTGCCTGTCACTGG - Intergenic
1158655181 18:59324422-59324444 AACACTGATCTTCCTCTGCCCGG + Intergenic
1160672349 19:371802-371824 GTCTCAGCTATGCCTCTGCTCGG + Intronic
1161062644 19:2222829-2222851 AACTGAGATCGGCCACTGCCTGG + Intronic
1161221465 19:3120039-3120061 CACTCAGAGCTGTCCCTGCCAGG + Intronic
1162788528 19:13051249-13051271 CACTCAGCTCTGGCTTTGCCAGG + Intronic
1164120829 19:22263183-22263205 GGCTCAGCTCTGACTCTTCCTGG + Intergenic
1164203449 19:23038457-23038479 GGCTCAGCTCTGGCTCTCCCTGG - Intergenic
1164446445 19:28321644-28321666 TATTCAGCTCTGCCTCTTCCAGG + Intergenic
1164861454 19:31565229-31565251 AGCTCAGCTCTGCCTCTGACTGG + Intergenic
1165314803 19:35048285-35048307 GACGCTGCTCTGCCTCTTCCAGG + Intronic
1165416828 19:35699600-35699622 GACCCAGATCTGCCTGACCCAGG - Intergenic
1166609778 19:44180807-44180829 GACTTAGACCTGCTTCTGTCAGG + Intergenic
1167049198 19:47068347-47068369 GACTCAGTTCTGGCTGGGCCTGG + Intronic
1168137405 19:54360645-54360667 GGCTCAGAGCTGGCTCTGCTTGG - Intronic
1168160672 19:54508437-54508459 GGCTCAGAGCTGGCTCTGCTTGG + Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
1168413602 19:56155395-56155417 GCATCAGCTCGGCCTCTGCCAGG - Intronic
924969241 2:109123-109145 ACCTCAGATCTGCCACTGCTGGG + Intergenic
925532481 2:4880092-4880114 GACACAGCTCTGCCTCTCTCAGG + Intergenic
926105191 2:10145572-10145594 GACTCACAGCAGCCTCTGCCTGG - Intronic
926109283 2:10171709-10171731 GATTCATTCCTGCCTCTGCCCGG - Intronic
926529018 2:14018568-14018590 GACACAAATCTCCCTCTGACAGG + Intergenic
926965805 2:18409378-18409400 TCCTCAGATCTGCCTTTGGCAGG - Intergenic
927289964 2:21395541-21395563 GTCCCAGAGCTGCCTCTTCCTGG - Intergenic
929454032 2:42054029-42054051 CCCTCAGATCTGCCTGAGCCTGG + Exonic
930871928 2:56179596-56179618 CACTCACCTTTGCCTCTGCCAGG + Intergenic
931379974 2:61743606-61743628 AAGTCATATCTGCCTCTGTCTGG + Intergenic
932092263 2:68816787-68816809 GACCCAGATCTGGCTCGGCTGGG + Intronic
933984685 2:87580812-87580834 GACTCAGTTCTGCCACTGTCTGG + Intergenic
936309166 2:111369988-111370010 GACTCAGTTCTGCCACTGTCTGG - Intergenic
937921912 2:127137040-127137062 GCCTCAGACCTGCCTGTCCCTGG + Intergenic
938093027 2:128445655-128445677 GACTCAGCTACGCCCCTGCCAGG - Intergenic
938225419 2:129611702-129611724 GACACAGATGTGCATCTGGCGGG - Intergenic
938930403 2:136081784-136081806 GACACAGAGCAGCCTCTTCCTGG - Intergenic
939099585 2:137880617-137880639 GACTGAGAGCCGCCTGTGCCAGG + Intergenic
941258252 2:163261727-163261749 CATTCTAATCTGCCTCTGCCTGG + Intergenic
941383543 2:164824979-164825001 GGCTCATATCTACCACTGCCTGG + Intronic
941764885 2:169285773-169285795 GCCTCAGAGCTTCCACTGCCAGG + Intronic
948261606 2:236607978-236608000 GACTCAGCTCTGCCACTTCTTGG + Intergenic
1168857403 20:1018439-1018461 GACTCAGATGTCCCTTTGCCAGG + Intergenic
1169406628 20:5326687-5326709 GGCTCAGGGCTGCATCTGCCTGG - Intergenic
1170624558 20:18021385-18021407 GTCTCATACCTGCCTCTGCATGG + Intronic
1171163629 20:22951535-22951557 GACACAGCTCAACCTCTGCCAGG - Intergenic
1171300934 20:24059739-24059761 GATTCAGGTCTGACTCTACCTGG - Intergenic
1171344457 20:24455393-24455415 AACTCAGATCTCCCTTTTCCAGG + Intergenic
1172617722 20:36300217-36300239 GGCTCAGATGTGCCCCAGCCTGG + Intergenic
1173565597 20:44036131-44036153 GACTCAGTTCTCCAGCTGCCGGG - Intronic
1174087223 20:48018068-48018090 GACCCAGATCTGGTGCTGCCTGG - Intergenic
1175800849 20:61800306-61800328 TACGCAGAACTGCCCCTGCCCGG - Intronic
1176002652 20:62839918-62839940 GACCTAGCTCTGCCTCTACCTGG + Intronic
1176364864 21:6026676-6026698 CACTCAGCTCTGCCTCTTCTGGG + Intergenic
1178672590 21:34604908-34604930 GATTCAAATCTGGGTCTGCCTGG + Intronic
1178917286 21:36713311-36713333 GACTCAGCTTTGTCTCTCCCTGG + Intronic
1179579428 21:42331422-42331444 GACTCTGAATTGGCTCTGCCAGG + Intergenic
1179758654 21:43511869-43511891 CACTCAGCTCTGCCTCTTCTGGG - Intergenic
1180092450 21:45540017-45540039 CCGTCAGATCTGCCTCGGCCTGG - Intronic
1184653338 22:45929267-45929289 GACTGTGATCTGCCTGTACCTGG + Intronic
1184689220 22:46109951-46109973 GAGTCACATCTGCTTCTCCCAGG + Intronic
1184993846 22:48188282-48188304 GAGTCATCTCTGCCTCTGCTGGG - Intergenic
1185065779 22:48631097-48631119 GAAGGAGCTCTGCCTCTGCCTGG - Intronic
953957597 3:47243774-47243796 TCCTCAGATCTGCCTCTTCTCGG - Intronic
955530069 3:59863765-59863787 GGCTCAGAGCTTCATCTGCCTGG - Intronic
956292539 3:67676576-67676598 GCCTCAGTTCAGCCTCTACCAGG + Intergenic
957947953 3:87088938-87088960 GAATCAGAAATTCCTCTGCCTGG - Intergenic
958801816 3:98764635-98764657 GACTCAAATCTGTCTCTATCAGG - Intronic
960916103 3:122696548-122696570 TATTCAAATCTCCCTCTGCCTGG + Intronic
962317299 3:134366941-134366963 CAGGCAGAGCTGCCTCTGCCTGG + Intronic
964435164 3:156643641-156643663 TTCTCAGTACTGCCTCTGCCTGG + Intergenic
964933624 3:162054991-162055013 CACTCAAATCTACCTCTGACTGG - Intergenic
967868904 3:194213293-194213315 GACTGAGGTCTGACTCTGTCAGG - Intergenic
968973022 4:3805952-3805974 GACGCTGAGCAGCCTCTGCCTGG + Intergenic
969042144 4:4307401-4307423 AACTGAGCTCTGCCTCTGTCAGG + Intronic
974738478 4:65973080-65973102 GACTGAGTCCTGCCTCTGGCAGG - Intergenic
975759659 4:77606671-77606693 TACTAAGAGCTACCTCTGCCGGG - Intronic
976833073 4:89337216-89337238 GACTCAGATCTATCTCTCTCTGG - Intergenic
978404459 4:108364574-108364596 ACCTCAGATATGCCTATGCCTGG - Intergenic
978661269 4:111129253-111129275 GACTCAAATCCTCCTGTGCCTGG + Intergenic
981337956 4:143588086-143588108 AACTGGGATCTGGCTCTGCCTGG - Intronic
983972686 4:173893848-173893870 GGCCCAGGTCTGCATCTGCCTGG + Intergenic
986769161 5:10956175-10956197 GACTCAGCTGTGTCTCTGCTGGG - Intergenic
987737174 5:21861023-21861045 CACCCAGAGCTGCCTCTGCATGG - Intronic
989961322 5:50419129-50419151 GACTCAGATCAGCCAGTCCCTGG + Intronic
990726038 5:58755678-58755700 GACTCTGACCTGCCCCTGCCTGG - Intronic
992008429 5:72502409-72502431 GACACAGATCTCCCTCTGACAGG - Intronic
992086598 5:73283388-73283410 GACCCAGACCTGCCTATACCTGG - Intergenic
992168973 5:74083596-74083618 GACTCAGATCTTGCCCTGCAAGG - Intergenic
992482838 5:77168446-77168468 GACCCAGAACTGCCTGTGCAGGG + Intergenic
992826102 5:80551550-80551572 GACTCAGATCTTCCTAGGACAGG + Intergenic
994733522 5:103523319-103523341 CACTAAGTTCTTCCTCTGCCAGG - Intergenic
999801393 5:155041128-155041150 GACACAGCTCTGCCACTTCCTGG + Intergenic
1000046260 5:157524248-157524270 GGCTGAGTTCTGCCTTTGCCAGG - Intronic
1000071883 5:157748063-157748085 GACACTGATGTGCCTTTGCCGGG + Intronic
1000128844 5:158275016-158275038 TACTCACATGTACCTCTGCCTGG - Intergenic
1001307279 5:170584632-170584654 CACTGTGACCTGCCTCTGCCGGG - Intronic
1001585380 5:172830672-172830694 GACTCAGATCACTCTCTGCTGGG - Intergenic
1002184665 5:177448490-177448512 GACTCAGCTCTGCCACTTACTGG - Intronic
1002460827 5:179372894-179372916 GACTCAGCTATAGCTCTGCCAGG + Intergenic
1004456459 6:15796278-15796300 GACTCTGAGCTCCCTCTGCCTGG - Intergenic
1005881097 6:30061594-30061616 GGCTCGGTCCTGCCTCTGCCCGG + Exonic
1006440987 6:34053499-34053521 GACTCTGACCTGTCTCTGCTGGG + Intronic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1007387252 6:41528303-41528325 TCCTCAGATCTGCCTCCTCCGGG + Intergenic
1007396943 6:41583336-41583358 GGCTGAGTCCTGCCTCTGCCAGG + Intronic
1007736949 6:43987730-43987752 GACTCAGCTCTGCCCCTTCAGGG + Intergenic
1007782308 6:44261655-44261677 GAGTGAGATGTTCCTCTGCCTGG + Exonic
1010448409 6:75975057-75975079 GACTTGGATGTGCCTGTGCCAGG + Intronic
1010570744 6:77471226-77471248 GACTCAGCTCAGTCTCTGACCGG + Intergenic
1012381963 6:98630818-98630840 GCCTTAGGTCTGCCTCTGCCTGG - Intergenic
1012489521 6:99765464-99765486 GACTCAATTCTGCCTCTGAGTGG - Intergenic
1013676640 6:112471265-112471287 GACTCTGGTCTGCATCTACCTGG - Intergenic
1015132579 6:129830761-129830783 GAGTCTGCTCTGTCTCTGCCAGG + Intergenic
1016269746 6:142274778-142274800 GACTTAGATCTGCCACTTACAGG - Intergenic
1017782220 6:157724375-157724397 GACTCAGGTCTCCCTGGGCCTGG - Intronic
1017917516 6:158843297-158843319 GAGGCAGTTATGCCTCTGCCTGG - Intergenic
1018729933 6:166641076-166641098 TACTTACATTTGCCTCTGCCTGG - Intronic
1018889088 6:167968830-167968852 GGCCCAGCTCTGCCTCTGACTGG - Intronic
1019884632 7:3893227-3893249 GCCCCGGTTCTGCCTCTGCCTGG + Intronic
1021584762 7:22196048-22196070 GATTCAGCTCTTCCCCTGCCTGG - Intronic
1021613775 7:22482050-22482072 GACCCAGACATGGCTCTGCCTGG - Intronic
1023244302 7:38184263-38184285 GCCCCAGTTCTCCCTCTGCCTGG - Intronic
1023874580 7:44279959-44279981 GCCTCAGGACTGCCTCTCCCAGG + Intronic
1024542322 7:50487072-50487094 ATATAAGATCTGCCTCTGCCTGG + Intronic
1025205843 7:56992972-56992994 TGCTCAGATCTGCCTCCCCCAGG - Intergenic
1025666097 7:63583966-63583988 TGCTCAGATCTGCCTCCCCCAGG + Intergenic
1026163323 7:67889283-67889305 AACTGAGAAGTGCCTCTGCCCGG + Intergenic
1027829796 7:83162867-83162889 CGCTCAGATCTGCTTCTCCCCGG - Exonic
1032745052 7:134778086-134778108 GGCTCATCTCTCCCTCTGCCTGG + Intronic
1034752888 7:153587367-153587389 GGCACAGATGTGCCTCTGGCTGG + Intergenic
1035285662 7:157805040-157805062 GACTCAGTCCTCTCTCTGCCTGG + Intronic
1036286018 8:7444821-7444843 GTCTGAGCTCTGCATCTGCCTGG + Intronic
1036335455 8:7866708-7866730 GTCTGAGCTCTGCATCTGCCTGG - Intronic
1037468480 8:19184198-19184220 GACTCATATCTGCCCTTGGCTGG - Intergenic
1039295952 8:36155117-36155139 GACTCAGATCTATTTCTGACTGG - Intergenic
1040586693 8:48750121-48750143 GACTCAGATCTGCCTCTGCCTGG - Intergenic
1041321768 8:56621253-56621275 TGCTCACATCTGCTTCTGCCAGG - Intergenic
1041716455 8:60936823-60936845 AACTCAGATCAGTCTTTGCCAGG - Intergenic
1041780105 8:61568564-61568586 GACTCATATATGCCCCTTCCTGG - Intronic
1042326394 8:67533211-67533233 GAGTCAGATCATCATCTGCCTGG + Intronic
1045862502 8:106828911-106828933 GATTAAGATCTGCCTCTGCTGGG + Intergenic
1049311734 8:141937201-141937223 GACTCAGCTCCGCCTCTTCCGGG - Intergenic
1049939647 9:533113-533135 CACTCAGCTTTGCCTCTGACTGG - Intronic
1052351958 9:27467215-27467237 GACTCAGACCTGCATCTTTCTGG - Intronic
1052764223 9:32624399-32624421 GACTAGGCTCTGGCTCTGCCAGG + Intergenic
1054702475 9:68427151-68427173 GACTAAGCTCTTCCACTGCCAGG - Intronic
1055717977 9:79139361-79139383 GACTCAACTCAGCCTCTGGCTGG - Intergenic
1055759688 9:79593692-79593714 GACACAGGGATGCCTCTGCCTGG - Intronic
1055796993 9:79985519-79985541 GAGGCAGACTTGCCTCTGCCAGG + Intergenic
1056073140 9:83009786-83009808 GATTCAGATTTTCCTCTGCCTGG + Intronic
1057639810 9:96808030-96808052 GACTCAGAAATCCCTCTGCTTGG + Intergenic
1059327181 9:113511187-113511209 GCCTCAGATTCGCCACTGCCAGG + Intronic
1059395095 9:114029108-114029130 GTCCCAGCTCTGCCTCTGGCTGG + Intronic
1060066653 9:120507858-120507880 GGCTGAGAGCTGCCTCTGCATGG + Intronic
1060490655 9:124081771-124081793 GGCTAAGAGCTGCCTGTGCCAGG - Intergenic
1060748702 9:126154798-126154820 CACACAGACATGCCTCTGCCAGG - Intergenic
1061320100 9:129823422-129823444 GACTCAGCTCTGCCCAGGCCCGG + Intronic
1062409163 9:136413619-136413641 GACTCCCAGCTGCCCCTGCCAGG + Intronic
1062465063 9:136677315-136677337 GACACAGGGCTGCCTGTGCCTGG - Intronic
1186558018 X:10581353-10581375 GGCTCCGATCTGCCTTTGCAAGG - Intronic
1188643563 X:32536298-32536320 GGCTGAGAACTGCCTCTGCAAGG + Intronic
1190054949 X:47175931-47175953 GCCCCAGGGCTGCCTCTGCCGGG - Intronic
1190121598 X:47664473-47664495 GACTCTGATGTGCCTCAGCATGG + Intergenic
1191159373 X:57311824-57311846 GACTCAGTTCTGCCTGTGCTAGG - Intronic
1191813637 X:65218671-65218693 GTCTCAGATCAGACTCTGCTTGG - Intergenic
1192965392 X:76171988-76172010 TGATCAGATCTCCCTCTGCCTGG + Intergenic
1195026459 X:100882504-100882526 GATTAAGCTCTGCCTCTTCCAGG + Intergenic
1195852061 X:109294525-109294547 GCTTCAGATCTGCCCCTGCTTGG - Intergenic