ID: 1096241330

View in Genome Browser
Species Human (GRCh38)
Location 12:49961800-49961822
Sequence CGGGGCCGGCGCGGGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2079
Summary {0: 1, 1: 0, 2: 17, 3: 285, 4: 1776}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096241330_1096241353 29 Left 1096241330 12:49961800-49961822 CCTGCCCCCCCGCGCCGGCCCCG 0: 1
1: 0
2: 17
3: 285
4: 1776
Right 1096241353 12:49961852-49961874 GCCCCAGCAGGGCCCGCGCCAGG 0: 1
1: 0
2: 6
3: 47
4: 413
1096241330_1096241352 18 Left 1096241330 12:49961800-49961822 CCTGCCCCCCCGCGCCGGCCCCG 0: 1
1: 0
2: 17
3: 285
4: 1776
Right 1096241352 12:49961841-49961863 CTATATAGCGCGCCCCAGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1096241330_1096241351 17 Left 1096241330 12:49961800-49961822 CCTGCCCCCCCGCGCCGGCCCCG 0: 1
1: 0
2: 17
3: 285
4: 1776
Right 1096241351 12:49961840-49961862 CCTATATAGCGCGCCCCAGCAGG 0: 1
1: 0
2: 0
3: 0
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096241330 Original CRISPR CGGGGCCGGCGCGGGGGGGC AGG (reversed) Intergenic
Too many off-targets to display for this crispr