ID: 1096241336

View in Genome Browser
Species Human (GRCh38)
Location 12:49961808-49961830
Sequence GCCGGGCGCGGGGCCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1747
Summary {0: 1, 1: 2, 2: 27, 3: 312, 4: 1405}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096241336_1096241352 10 Left 1096241336 12:49961808-49961830 CCCGCGCCGGCCCCGCGCCCGGC 0: 1
1: 2
2: 27
3: 312
4: 1405
Right 1096241352 12:49961841-49961863 CTATATAGCGCGCCCCAGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1096241336_1096241351 9 Left 1096241336 12:49961808-49961830 CCCGCGCCGGCCCCGCGCCCGGC 0: 1
1: 2
2: 27
3: 312
4: 1405
Right 1096241351 12:49961840-49961862 CCTATATAGCGCGCCCCAGCAGG 0: 1
1: 0
2: 0
3: 0
4: 20
1096241336_1096241353 21 Left 1096241336 12:49961808-49961830 CCCGCGCCGGCCCCGCGCCCGGC 0: 1
1: 2
2: 27
3: 312
4: 1405
Right 1096241353 12:49961852-49961874 GCCCCAGCAGGGCCCGCGCCAGG 0: 1
1: 0
2: 6
3: 47
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096241336 Original CRISPR GCCGGGCGCGGGGCCGGCGC GGG (reversed) Intergenic