ID: 1096242677

View in Genome Browser
Species Human (GRCh38)
Location 12:49967674-49967696
Sequence GTGTGTGCGCGCGTGTGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1077
Summary {0: 1, 1: 1, 2: 21, 3: 160, 4: 894}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096242677_1096242684 6 Left 1096242677 12:49967674-49967696 CCCGTGCACACGCGCGCACACAC 0: 1
1: 1
2: 21
3: 160
4: 894
Right 1096242684 12:49967703-49967725 CCCACACAGTCCGGGGCTCGCGG 0: 1
1: 0
2: 0
3: 13
4: 165
1096242677_1096242679 -3 Left 1096242677 12:49967674-49967696 CCCGTGCACACGCGCGCACACAC 0: 1
1: 1
2: 21
3: 160
4: 894
Right 1096242679 12:49967694-49967716 CACACTGACCCCACACAGTCCGG 0: 1
1: 0
2: 1
3: 18
4: 158
1096242677_1096242681 -1 Left 1096242677 12:49967674-49967696 CCCGTGCACACGCGCGCACACAC 0: 1
1: 1
2: 21
3: 160
4: 894
Right 1096242681 12:49967696-49967718 CACTGACCCCACACAGTCCGGGG 0: 1
1: 0
2: 2
3: 15
4: 151
1096242677_1096242680 -2 Left 1096242677 12:49967674-49967696 CCCGTGCACACGCGCGCACACAC 0: 1
1: 1
2: 21
3: 160
4: 894
Right 1096242680 12:49967695-49967717 ACACTGACCCCACACAGTCCGGG 0: 1
1: 0
2: 1
3: 15
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096242677 Original CRISPR GTGTGTGCGCGCGTGTGCAC GGG (reversed) Intronic
900101921 1:965642-965664 GTGGGTGCACACGCGTGCACTGG + Exonic
900122047 1:1052643-1052665 GTGTGTCCGTGTGTGTGCATGGG + Intronic
900122077 1:1052886-1052908 GTGTGTCCGAGTGTGTGCATGGG + Intronic
900137372 1:1123535-1123557 GTGTGTGCAGGAGTGTGCGCAGG - Intergenic
900137380 1:1123625-1123647 GTGTGTGTGCAGGTGTGCTCAGG - Intergenic
900137385 1:1123691-1123713 GTGTGTGTAGGTGTGTGCACAGG - Intergenic
900137404 1:1123861-1123883 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137409 1:1123918-1123940 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900137410 1:1123930-1123952 GTGTGTGCGCAGGTGTGTGCAGG - Intergenic
900137411 1:1123940-1123962 GTGTGTGCAGGTGTGTGCGCAGG - Intergenic
900137421 1:1124052-1124074 GTGTGCGCAGGTGTGTGCACAGG - Intergenic
900137425 1:1124102-1124124 GTGTGCGCAGGTGTGTGCACAGG - Intergenic
900137428 1:1124138-1124160 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137437 1:1124188-1124210 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900177398 1:1297016-1297038 GGGTGTGTGCTGGTGTGCACTGG - Intronic
900215478 1:1479381-1479403 GTGTGTGCCCATGTGTGCAGGGG - Intronic
900215483 1:1479407-1479429 GTGTGGGCCCGTGTGTGCAGGGG - Intronic
900215485 1:1479409-1479431 GTGTGTGGGCCCGTGTGTGCAGG - Intronic
900222743 1:1518080-1518102 GTGTGGGCCCGTGTGTGCAGGGG - Intronic
900222745 1:1518082-1518104 GTGTGTGGGCCCGTGTGTGCAGG - Intronic
900222793 1:1518338-1518360 GTGTGTGTGCCCGAGTGCGCGGG - Intronic
900299796 1:1970975-1970997 GTGTGTGTGCACGTGTGTGCAGG - Intronic
900353221 1:2247255-2247277 GTGTGTGCACAGGTGTGCATGGG + Intronic
900358764 1:2277948-2277970 GTGTGCGTGCACGTGTCCACGGG - Intronic
900533272 1:3165142-3165164 GTGTGAGCGCCCGTGGGCTCAGG + Intronic
900544629 1:3221704-3221726 GTGTGTGCATGCGTGTACATGGG - Intronic
900580927 1:3408490-3408512 GTGAGTGTGGGCGCGTGCACCGG + Intronic
900818955 1:4871568-4871590 GTGTGTGCATGTGTGTGTACAGG - Intergenic
901005352 1:6169206-6169228 CTGTGTGCCTGTGTGTGCACAGG - Intronic
901443876 1:9295236-9295258 GTGTGTGCGCGCGTGCGGTTGGG + Intronic
901771257 1:11531477-11531499 GTATGTGAGTGCGTGGGCACAGG + Intronic
901880716 1:12192250-12192272 GTGTGTGTGCATGTGTGTACAGG + Intronic
902237349 1:15065891-15065913 GTGCGTGTGCACGTGTGCGCTGG + Intronic
902402456 1:16165710-16165732 GTGTGTGTGTGTGTGTGCACAGG - Intergenic
902489584 1:16771477-16771499 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
902538310 1:17134643-17134665 GTGTGTGGGCGTGTGTGCACAGG - Intergenic
902538334 1:17134772-17134794 GTGTGTAAGTGTGTGTGCACAGG - Intergenic
902538377 1:17135104-17135126 GGGTGTGTGAGTGTGTGCACAGG - Intergenic
902629788 1:17697732-17697754 GTGTGTGCGAGTGTGTGGGCTGG + Exonic
902669598 1:17963863-17963885 ATGTGTGTGCACGTGTGCAAGGG - Intergenic
902690318 1:18107012-18107034 GTGTGTGCTCGCGTGTGTGTTGG + Intergenic
903324747 1:22563477-22563499 GCGGGTGCCCGCGTGTGCGCTGG + Intergenic
903977960 1:27163804-27163826 GTGTGTGTGTGTGTGTGTACTGG + Intronic
904048554 1:27623979-27624001 GTGCATGCGCGTGTGTGCACAGG - Intronic
904172415 1:28600576-28600598 GTGTGTGTGTGTGTGTGCAGTGG + Intronic
904339540 1:29825417-29825439 GTGTGTGAGTGTGTGTGCATGGG - Intergenic
904450106 1:30605607-30605629 GTGTGTGAGGGCGAGTGCACAGG - Intergenic
904697529 1:32338599-32338621 GTGTGTGTGCGCGTGTGCCCAGG + Intergenic
904698119 1:32341876-32341898 GTGTGTATGCACTTGTGCACAGG + Intergenic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
905215001 1:36400740-36400762 ATGTGTGAGCGAGTGAGCACAGG + Intergenic
905232487 1:36522866-36522888 GTGTGTGTGCACATGTGCACAGG + Intergenic
905238826 1:36569530-36569552 GTGTGTGTGTGTGTGCGCACAGG - Intergenic
905296010 1:36954908-36954930 GTGTGAACGTGCATGTGCACAGG - Intronic
905296136 1:36955537-36955559 GTGTGTGCATGCGTGTTCTCCGG - Intronic
905347270 1:37319536-37319558 GTGTGTGCGCGTGTGTGCCTGGG + Intergenic
905788974 1:40780114-40780136 GTGTGTGTGTGTGTGTGTACTGG - Intergenic
906150162 1:43582920-43582942 GTGTGTGTGCGAGGGGGCACAGG + Intronic
906798655 1:48717528-48717550 GTGTGTGCGCGCGTGCATGCAGG + Intronic
907118314 1:51989092-51989114 GTGTGTGTGTGCGCGCGCACAGG - Intronic
907450642 1:54543617-54543639 GTGTGTGTCTGTGTGTGCACAGG + Intronic
907526692 1:55057946-55057968 ATGTGTGTGCGTGTGTGCACTGG + Intronic
908481495 1:64544583-64544605 GTTTGTGCGCACGTGTGCATGGG - Intronic
908612901 1:65882690-65882712 GTGTGTGTGTGTGTGTGTACAGG + Intronic
909281791 1:73765307-73765329 GTGTGTGTGTGTGTGTACACAGG + Intergenic
909622375 1:77683047-77683069 GTGCGCGCGCACGTGTGCGCGGG - Intronic
910024126 1:82628589-82628611 GTGTGTGTGTGTGTGTGTACTGG + Intergenic
910105164 1:83624309-83624331 GTGTGTGTGCGCGTGCCCAGAGG + Intergenic
910437325 1:87218539-87218561 GTGTGTACACGTGTGTGCACGGG - Intergenic
910739869 1:90503408-90503430 GTGTGTGTGTGCGTGTGTATAGG - Intergenic
910846043 1:91605676-91605698 GTGTGTGTGTGTGTGTGTACTGG - Intergenic
911282953 1:95954126-95954148 GTGTGTGTGTGTGTGTGGACAGG + Intergenic
913091367 1:115478867-115478889 GTGTGAGTGCCCGTGTGCATAGG - Intergenic
913425087 1:118719940-118719962 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
913546426 1:119873184-119873206 GTGTGTGTGTGTGTGTGCATAGG - Intergenic
914732934 1:150388492-150388514 GTGTGTGTGTGTGTGTGCGCGGG - Intronic
915586976 1:156849203-156849225 GTGTGTGGCCGCGTGTCCACCGG + Intronic
915835453 1:159172069-159172091 GCGTGTGTCTGCGTGTGCACCGG + Intronic
915977795 1:160401832-160401854 GTGTGTGTGCACCTGTGTACTGG + Intronic
915984503 1:160450628-160450650 GTGTGTGTGTGTGTGTTCACAGG + Intergenic
916312044 1:163408565-163408587 GTGTGTGCGTGCGTGTGTGTGGG - Intergenic
916510659 1:165469846-165469868 GTGTGTGTGTGTGTGTACACGGG - Intergenic
916754986 1:167760777-167760799 GTGTGTGTGTGTGTGTGTACAGG + Intronic
917916159 1:179704323-179704345 GTGTGTGCTGGTGTGAGCACTGG + Intergenic
918238971 1:182605140-182605162 GTGTGTGTGTGTGTGTGCAATGG - Intergenic
918995793 1:191757538-191757560 GTGTGTGCGCGCGCGTGGGTGGG - Intergenic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920198678 1:204245841-204245863 GTGTGTGTGTGTGTGTACACAGG - Intronic
920504090 1:206504563-206504585 GTGTGTGTGTGTGTGTGCATGGG + Intergenic
920524997 1:206659793-206659815 GTGTGTGCGCGCGCACGCACCGG - Intronic
920710201 1:208287602-208287624 GTGTGTGCACATGTCTGCACAGG - Intergenic
921945479 1:220883280-220883302 GTGTGTGTGTGTGTGTGTACTGG - Intronic
922437288 1:225619088-225619110 GTGTGTGTGTGTGTGTGTACTGG - Intronic
922501571 1:226100698-226100720 GTGGGTGGGCGCATGCGCACAGG + Intergenic
922648720 1:227318511-227318533 GTGTGCGCGCGCGTGTGCCGGGG - Intergenic
922648722 1:227318513-227318535 GCGTGTGCGCGCGCGTGTGCCGG - Intergenic
922648924 1:227319346-227319368 GTGTGTGTGCGCATGCACACAGG - Intergenic
922719081 1:227891232-227891254 GTGTGCTCACACGTGTGCACGGG - Intergenic
922739416 1:228006995-228007017 GCGGGTGCGCGGGTGTGCGCGGG - Intergenic
922817256 1:228458676-228458698 GTGTGTGTGCGCGCGCGCGCCGG + Exonic
923530853 1:234811048-234811070 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
923649233 1:235857671-235857693 GTGTGTGCGCGTGTGCACACAGG + Intronic
924245659 1:242081622-242081644 GTGTGTGTGTGTGTGTACACTGG - Intergenic
1062794922 10:337622-337644 GTGTGTGCGCACGTGTGTTGTGG + Intronic
1062802835 10:392723-392745 GTGTGTGCGCGTGTGTACCTGGG - Intronic
1062802846 10:392891-392913 GTGTGTGCGCGCCTGTGTGTGGG - Intronic
1063159630 10:3409825-3409847 GTGTGTGCACAGGTGTGCACAGG - Intergenic
1063346490 10:5316878-5316900 GTGTGTGTGTGTGTGTGCATTGG - Intergenic
1063541645 10:6940017-6940039 GTGTGTGCGCGTGTGTGTAAGGG - Intergenic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1063956242 10:11270267-11270289 GTGTGTCTGCCCGTGTCCACAGG - Intronic
1064180290 10:13108867-13108889 GTGTGTGCGTGTGTGTGTATGGG - Intronic
1064266648 10:13830749-13830771 GTGTGTGTGTATGTGTGCACAGG + Intronic
1064809289 10:19176872-19176894 GTGTGTGTGTGTGTGTGCATGGG + Intronic
1065369351 10:24968017-24968039 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
1065482618 10:26210969-26210991 GTGTGTGTGCATGTGTGTACAGG - Intronic
1065667356 10:28076526-28076548 GTGTGTGCGCGCATGTGTGTGGG - Intronic
1066022875 10:31319936-31319958 GTTTGTGCGCGCGTGTGCGCGGG + Intronic
1066500210 10:35986095-35986117 GTGTGTGTGCGTGTGTGTGCAGG + Intergenic
1066628102 10:37430381-37430403 GTGTGTGCATGCGTGTGTGCAGG + Intergenic
1067202459 10:44185099-44185121 GTGTGTGTGTGTGTGTGCATGGG + Intergenic
1067650712 10:48152943-48152965 GTGTGCGCGCGCGTGTGGGAAGG - Intergenic
1067783939 10:49229024-49229046 GTGTGTGTGTGTGTGTGCGCGGG + Intergenic
1068519797 10:58065621-58065643 GTGTGTGCGCGCGCGTGTTTAGG + Intergenic
1068703912 10:60051789-60051811 GTGTGTGTGTGTGTGTGTACAGG + Intronic
1068875443 10:61991037-61991059 GTGTGTGTGTGTGTGTGTACAGG - Intronic
1068950132 10:62768489-62768511 GTGTGTGTGCGTGCGTGCGCTGG - Intergenic
1069603136 10:69722160-69722182 GTGTGTGTGAGTGTGTGGACAGG + Intergenic
1069653691 10:70071087-70071109 GTGTGTGTGCGCGTGTGCACAGG + Intronic
1069653693 10:70071089-70071111 GTGTGTGCGCGTGTGCACAGGGG + Intronic
1069709789 10:70480829-70480851 GTGAGTGCGTGTGTGTGCTCAGG + Intronic
1070610657 10:77930104-77930126 GTGTGAGTGCGTGTGTGCAGGGG - Intergenic
1070610659 10:77930106-77930128 GTGTGTGAGTGCGTGTGTGCAGG - Intergenic
1070796726 10:79221276-79221298 GTGTGTGCGTGTGTGTGTCCTGG + Intronic
1070958599 10:80482613-80482635 ATGTGAGTGTGCGTGTGCACTGG + Intronic
1071584368 10:86805373-86805395 GTGTGTGTGTGTGTGTGTACAGG - Intronic
1071602816 10:86967183-86967205 GTGTGTGTGTGTGTGTGTACAGG + Intronic
1071649143 10:87378717-87378739 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
1072129450 10:92479635-92479657 GTGCGTGTGTGCGTGCGCACTGG + Intronic
1072492961 10:95926868-95926890 GTGTGTGCGCGCGCCTGAACAGG + Intronic
1072610096 10:97012071-97012093 GTGTGTGTGTGTGTGTGTACTGG - Intronic
1072816167 10:98511606-98511628 GTGTGTGCGCACGTGTGTGTTGG + Intronic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073205852 10:101768967-101768989 GTGTGTGTTTGCGTGTGGACTGG - Intergenic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1073392586 10:103192263-103192285 GTGTGTGCGCGCCCGTCCAGGGG - Intronic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1073760678 10:106625232-106625254 GTGTGTGTGTGTGTGTACACTGG + Intronic
1074181763 10:111071525-111071547 GTGTGTGTGTGTGTGTGCATGGG + Intergenic
1074245485 10:111687049-111687071 GTGTGTGTGTGCACGTGCACAGG + Intergenic
1074886100 10:117695020-117695042 GTGTGTGAGCCAGAGTGCACTGG + Intergenic
1075508102 10:123043931-123043953 GTGTGTGCATGTGTGTACACAGG - Intronic
1075806101 10:125190111-125190133 GTGTATGTGCGAGTGTGCATAGG + Intergenic
1075831530 10:125416069-125416091 GTGTGTGCACACGTGTGTATGGG - Intergenic
1076120595 10:127934019-127934041 GTGTGTGTGTGTGTGTGCGCGGG - Intronic
1076519532 10:131072444-131072466 GTGTGTGTGTGTGTGTGTACTGG - Intergenic
1076568821 10:131417916-131417938 GTGTGTGTGTGCGCGTGCACAGG - Intergenic
1077009423 11:373588-373610 GAGTGTGCGCAAGTGTGCACAGG - Intronic
1077091289 11:779501-779523 GTGTGTGCACCTGTGTCCACAGG + Intronic
1077167040 11:1147360-1147382 GTGTGTGTGTGTGTGTTCACAGG + Intergenic
1077223741 11:1428781-1428803 GGGTGTGTGTGCATGTGCACTGG + Intronic
1077223762 11:1428933-1428955 CTGGGTGCGTGTGTGTGCACGGG + Intronic
1077223792 11:1429130-1429152 GTGTGTGTGCACGTGTGCATGGG + Intronic
1077223817 11:1429307-1429329 GTGTGTGTGCGTGTGCGCACAGG + Intronic
1077227240 11:1443692-1443714 GCGTGTGCCTGTGTGTGCACAGG + Intronic
1077425057 11:2471570-2471592 GTGTGTGTGCACGTGTGTATGGG + Intronic
1077459830 11:2703474-2703496 GTGCGTGCTCTCGGGTGCACAGG - Intronic
1077459831 11:2703482-2703504 GTGTGTGCGTGCGTGCTCTCGGG - Intronic
1077868865 11:6244581-6244603 GTGTGTGTGTGTGTGTGTACTGG - Intergenic
1078063174 11:8061349-8061371 GTGTGTGGGGGCGTGTGCTGTGG + Intronic
1078188731 11:9074408-9074430 GTGTGTGTGTGCGCGTGCAAGGG + Intronic
1078391181 11:10936900-10936922 GTGTGTGTGTGCTTGTGCATAGG + Intergenic
1079737907 11:24020396-24020418 TTGTGTGTGCATGTGTGCACTGG + Intergenic
1080139040 11:28892344-28892366 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
1081804140 11:45881027-45881049 GTGTGTGTGCGCGTGTGCAGAGG + Exonic
1081994980 11:47358558-47358580 GTGTGTGAGCAAGTGTGCAGAGG - Intronic
1082226165 11:49710209-49710231 GTGTGTGTGTTCGTGTGTACTGG + Intergenic
1082969793 11:59007794-59007816 GTGTGTGCACGTGTGTCCCCAGG + Intronic
1085204007 11:74719377-74719399 GTGTGTGTGTGTGTGTGTACAGG - Intronic
1085418563 11:76336330-76336352 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
1085450298 11:76627958-76627980 GTGTGTGTGCCTGTGTGAACAGG - Intergenic
1085571279 11:77559846-77559868 GTGTGTGTGGGTGTGTGTACGGG + Intronic
1086622921 11:88909541-88909563 GTGTGTGTGTGTGTGTGTACTGG - Intronic
1086924818 11:92628858-92628880 GTGCATGCACGTGTGTGCACAGG + Intronic
1087251511 11:95905326-95905348 GTGTGTGTGTGTGTGTGCGCAGG - Intronic
1087631927 11:100660596-100660618 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
1088901257 11:114119378-114119400 GTGTGTGCACATGTGTGTACAGG + Intronic
1088990586 11:114950142-114950164 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
1089153769 11:116385197-116385219 GTGTGTGCCTGCATGTGCATGGG - Intergenic
1089281940 11:117380877-117380899 GTGTGTGCACGTGTGTGTACTGG + Intronic
1089291852 11:117442510-117442532 GTGTGTGCGTGTGTGTGTATGGG + Intronic
1089398479 11:118151109-118151131 GTGTGTGTGCACGTGTGTAAGGG - Intronic
1089500028 11:118926242-118926264 GTGTGCGCGCGCGTGTGTCCAGG - Intronic
1089584497 11:119501917-119501939 GTGGGTGTGCGCGTCTGCACCGG - Intergenic
1089611604 11:119672464-119672486 GTGTGTGCTTCCGTGGGCACAGG - Intronic
1089881558 11:121778467-121778489 GTGTGTGTGTGTGTCTGCACAGG - Intergenic
1090482588 11:127081278-127081300 GTGTGTGTGCGTGTGTGCACAGG + Intergenic
1090990026 11:131808822-131808844 GTGTGTTTGTGCGTGTGCACGGG - Intronic
1091023852 11:132124617-132124639 GTGTGTGCGCGCGCACGCGCAGG + Intronic
1091301879 11:134513198-134513220 GTGTGTGCGGGTGTGTGTGCAGG - Intergenic
1091584922 12:1810681-1810703 GTGTGTGTGCATGTGTGCATGGG + Intronic
1092045805 12:5431374-5431396 GTGTGCGCGCGCGTGTTTGCGGG - Intergenic
1092144531 12:6205323-6205345 GTGAGTGTGAGCGTGTGCAGAGG - Intronic
1092312563 12:7374394-7374416 GTGTGTGCACGTGTGTGTAGAGG + Intronic
1092677642 12:10940203-10940225 GTGTGTGCGCGCATGTTTGCTGG - Intronic
1092853481 12:12651655-12651677 GTGGGAGCGGGCCTGTGCACAGG + Intergenic
1092954918 12:13541001-13541023 GTGTGAGCGCACGTGTGTAAGGG - Exonic
1093108366 12:15117662-15117684 GTGTGTGTGCGCGTGTGTGATGG - Intronic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1093757133 12:22865356-22865378 GTGTGTGTGCGTGCATGCACAGG - Intergenic
1094133989 12:27104764-27104786 GTGTGTGTGTGTGTCTGCACAGG - Intergenic
1095129338 12:38520238-38520260 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
1095953149 12:47792186-47792208 GTGTCTGGGCGTGTGTGGACAGG - Intronic
1096242677 12:49967674-49967696 GTGTGTGCGCGCGTGTGCACGGG - Intronic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1096750633 12:53756734-53756756 GTGTGTGTGTGTGTGTGTACTGG + Intergenic
1096859360 12:54512812-54512834 GTGTGTGTGTGCCTGTGCATTGG + Intronic
1096931899 12:55220514-55220536 GTGTGTGTGTGTGTGTGTACTGG + Intergenic
1097489398 12:60246507-60246529 GTGTGTGTGTGTGTGTACACAGG - Intergenic
1097764730 12:63512528-63512550 GTGTGTGTGTGCGTGTGTGCAGG + Intergenic
1098636252 12:72787434-72787456 GTGTGTGTGCACGTGTGCAGAGG + Intergenic
1098919180 12:76287244-76287266 GTGTGTGCGTGTGTGTGCAGAGG + Intergenic
1099924433 12:89000248-89000270 GTGTGCCCGCGTGTGTGCACTGG + Intergenic
1099933783 12:89102131-89102153 GTGTGTGTGTGTGTGCGCACAGG - Intergenic
1100150453 12:91730360-91730382 GTGTGCGCGCACGTGTGCATGGG + Intergenic
1100278119 12:93091073-93091095 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
1100394765 12:94175103-94175125 GTGTGTGTGCACGCATGCACAGG + Intronic
1100615258 12:96226429-96226451 GTGTGTGTGTGCATGTGGACAGG - Intronic
1100807902 12:98307060-98307082 GTGTGTGTGTGTGTGTGTACTGG + Intergenic
1101683577 12:106993954-106993976 GTGTGTGTGCACATGTGCTCAGG - Intronic
1101966389 12:109285168-109285190 GTGTGCGCGTGCGTATGCATCGG + Intronic
1102419412 12:112792064-112792086 GTGTGTCTACGTGTGTGCACTGG + Intronic
1102530843 12:113545517-113545539 GTGTGTGTGCACGCGTGCTCTGG + Intergenic
1102661762 12:114535075-114535097 GTGTGTACACGCATATGCACAGG + Intergenic
1102695847 12:114798799-114798821 GTGTGTGCACGTGTGTGTAAGGG + Intergenic
1102743610 12:115230520-115230542 GTGTCTGCGCGTGTGTGCAAGGG - Intergenic
1103188553 12:118981528-118981550 GTGCGTGCGCGTGTGAGCTCCGG - Exonic
1103651603 12:122437270-122437292 GTGTGTGTGTGTGTGTGAACAGG - Intergenic
1103744859 12:123115538-123115560 GTGTGTGCGTGTGTGTGTGCGGG - Intronic
1103907213 12:124333858-124333880 GTGTGTGTGCGCATGTGTGCGGG + Intronic
1103907215 12:124333892-124333914 GTGTGCGCGCGCATGTGTGCGGG + Intronic
1103910771 12:124350835-124350857 GTGTGGACACGCGTGTGCATCGG - Intronic
1103971045 12:124672194-124672216 GTGTGTGTGTGCGTGTGCGCAGG - Intergenic
1103971718 12:124676692-124676714 GTGTGTGCGTGTGTGTGCGCGGG + Intergenic
1103971734 12:124676888-124676910 GTGTGTGTGCGTGCGTGCGCGGG + Intergenic
1104406169 12:128518761-128518783 GTGTGTGTGTGTGTATGCACAGG + Intronic
1104598354 12:130135113-130135135 TTGTGTGTGCCTGTGTGCACAGG + Intergenic
1104807630 12:131599628-131599650 GTGTGTGTATGTGTGTGCACAGG - Intergenic
1104916545 12:132268264-132268286 GTGTGTGCGTGCGTGTGTAGGGG - Intronic
1104944917 12:132411252-132411274 GTGTGTGTGCACATGTGCACGGG - Intergenic
1104944933 12:132411334-132411356 CTGTGTGTGCACGTGTGCACGGG - Intergenic
1104981432 12:132574649-132574671 GTGTTCACACGCGTGTGCACGGG + Intronic
1105209311 13:18248323-18248345 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1106217467 13:27716152-27716174 GTGTGTGTGTGTGTGTGTACTGG + Intergenic
1106375395 13:29181806-29181828 GTGTGTGTGTGTGTGTGTACTGG + Intronic
1106585660 13:31054304-31054326 GTCTGTGTGTGTGTGTGCACAGG - Intergenic
1106585737 13:31054829-31054851 GTCTGTGCGTGTGCGTGCACAGG - Intergenic
1106585746 13:31054880-31054902 GTGTGTGTATGCATGTGCACAGG - Intergenic
1107459236 13:40585330-40585352 GTGTGTGTGCGCGCGCGCAGAGG - Intronic
1107517533 13:41145705-41145727 GTCTGTACTCGCCTGTGCACTGG + Intergenic
1107625572 13:42279242-42279264 GGGTGTGCACGTGCGTGCACTGG - Intronic
1107842032 13:44467987-44468009 GTGTGTGCGCGTGTGTGTATAGG - Intronic
1108104687 13:46996484-46996506 GTGTGTGCACCCATGTGCAGAGG + Intergenic
1108249720 13:48551953-48551975 GTGTGTGGGTGAGTGAGCACAGG - Intergenic
1108537457 13:51399724-51399746 GTGTGTGTGCGTGTGTGTAGTGG + Intronic
1109063406 13:57651115-57651137 GTGTTTGTGTGCATGTGCACAGG - Intronic
1109351720 13:61191043-61191065 GTGTGTGCCTGTGTGTGTACAGG - Intergenic
1109760535 13:66822123-66822145 GTGTGTGTGCGCGTGTGTGATGG - Intronic
1110432995 13:75447518-75447540 GTGTGTGTGTGTGTGTGTACAGG + Intronic
1110922491 13:81106116-81106138 GTGTGCGCGCGTGCGCGCACAGG - Intergenic
1111487682 13:88926161-88926183 GTGTGTGAGCGAGTGAGTACAGG + Intergenic
1112095925 13:96132117-96132139 GTGTGTGTGTGTGTGTGTACTGG - Intronic
1112508764 13:99990827-99990849 GTGTGTGTGCGCGCGCGCAAAGG - Intergenic
1112877786 13:104066702-104066724 GTGTATGTGTGCATGTGCACGGG - Intergenic
1113057552 13:106285589-106285611 GTGTGTGTGTGTGTGTACACAGG - Intergenic
1113186144 13:107687491-107687513 GTGTGTGTGTGCATGTGCACTGG - Intronic
1113459941 13:110474939-110474961 GTGTGTGATCGTGTGTGCACAGG - Intronic
1113483057 13:110635673-110635695 GTGTGAACACGGGTGTGCACGGG - Intronic
1113799851 13:113080687-113080709 GTGTGTGAGGGCGTGGGCAGGGG + Intronic
1113870578 13:113557328-113557350 GTGCGTGGGTGTGTGTGCACAGG + Intergenic
1113893854 13:113751273-113751295 GTGTGTGCGTGTGTGTGCATGGG + Intergenic
1113909467 13:113835326-113835348 GTGTGTGCTCACGTGTGTGCGGG + Intronic
1113964814 13:114146878-114146900 GTGTGTTCGTGTGTGTGCAAGGG - Intergenic
1114612752 14:24053045-24053067 GTGTGCACGCGCGTGTGCTGGGG - Intronic
1114612754 14:24053047-24053069 GTGTGTGCACGCGCGTGTGCTGG - Intronic
1114924243 14:27374255-27374277 GTGTGTGTGCTCATGTGCATAGG + Intergenic
1115138076 14:30135515-30135537 GTGTGTGTGTGTGTGTGCATGGG + Intronic
1115545688 14:34462889-34462911 GTGTGTGTGTGTGTGTGCATGGG - Intergenic
1115870251 14:37792802-37792824 GTGTGTGTGTGTGTGTGTACAGG + Intronic
1116167123 14:41349107-41349129 GTGTGTGTGCGTGTGTGTAAGGG - Intergenic
1116530354 14:45965255-45965277 GTGTGTGCGCGTGTGTGTGCTGG + Intergenic
1118199992 14:63662953-63662975 GTGTGTGAGCAAGTGAGCACGGG + Intergenic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1118358099 14:65032002-65032024 GTGTGTGTGTGTGTGTGTACTGG + Intronic
1118362868 14:65070623-65070645 GTGTGTGCGAGCGTGCACATGGG + Intronic
1118379450 14:65205625-65205647 GTGTGTGTGCGCGTGCTGACTGG + Intergenic
1118384907 14:65247917-65247939 GCGTGTGCGTGTGTGTGCAAGGG - Intergenic
1118442601 14:65825893-65825915 GTGTGCCCGTGCGTGTGCACGGG - Intergenic
1118755792 14:68843058-68843080 GTGTGTGTGCACTTGTACACTGG + Intergenic
1119778699 14:77264274-77264296 GTGTGAGTGCGTGTGTGCATGGG - Intergenic
1119889361 14:78171344-78171366 GTGTGTGTGTGTGTGTGCGCGGG + Intergenic
1120594356 14:86415694-86415716 GTGTGTGTGTGTGTGTGCATAGG + Intergenic
1120834582 14:89028021-89028043 GTGTGCGCGCGCGCGCGGACAGG - Intergenic
1120850014 14:89161589-89161611 GTGTGTGTGCGTGCGTGCACAGG + Exonic
1121270806 14:92636927-92636949 GTGTGTGTGCGTGTGTGCTTGGG + Intronic
1122088232 14:99321486-99321508 GTGTGTGAGCGCATGTGTATAGG - Intergenic
1122544375 14:102514127-102514149 GTGTGTGCATGCGTGTGCGTGGG + Intergenic
1122855978 14:104560317-104560339 GTGTGCGTGTGTGTGTGCACCGG - Intronic
1123007874 14:105333146-105333168 GTGTGTGCACACGCGTGCATGGG - Intronic
1123054867 14:105564551-105564573 GTGTGAGCGGCTGTGTGCACTGG + Intergenic
1123056002 14:105571201-105571223 GTGTGTGAGCGTGTGAGCATGGG - Intergenic
1123079311 14:105684130-105684152 GTGTGAGCGGCTGTGTGCACTGG + Intergenic
1124542571 15:30601147-30601169 GTGTGTGTGCGCGTGCTAACTGG + Intergenic
1125333482 15:38604853-38604875 GTGTGTGCGTGCGTGTGTGTCGG + Intergenic
1125476394 15:40050744-40050766 GTGTGTGTGCGCGTGTGAGGGGG + Intergenic
1125482831 15:40092426-40092448 GTGTGTGTGCGTGTTTGCACTGG - Intronic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1125917604 15:43503153-43503175 GTGTGTGTGCGCGCATGCGCGGG + Intronic
1127638223 15:60891310-60891332 GTGTGTGTGCATGTGTGCAGTGG + Intronic
1128347388 15:66863104-66863126 GTGTGAGCGTGCCTGTGTACTGG + Intergenic
1128767424 15:70259697-70259719 GTGTGTGCCCGCATGTGCACGGG + Intergenic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129460151 15:75696510-75696532 GTGTGTGCGCGTGTGTGGGCCGG + Intronic
1129687151 15:77693061-77693083 GTGTGTGCACGCGTGCACATGGG - Intronic
1130371062 15:83285242-83285264 GTGTGTGTGTGCGTGTGCGGTGG - Intergenic
1130550399 15:84886869-84886891 GTGTGTGCACGCACATGCACGGG + Intronic
1130639568 15:85658980-85659002 ATGTGTGTGTGCTTGTGCACAGG + Intronic
1131346147 15:91650321-91650343 GTGTGTGCACACATGTGCATGGG - Intergenic
1131713750 15:95085567-95085589 GTGTGTGTGTGCGCGTGCGCAGG + Intergenic
1132124657 15:99212286-99212308 GTGTGTGCATGCATGTGCAATGG + Intronic
1132261971 15:100433708-100433730 GTGTGTGCACATGTGTGCATGGG - Intronic
1132353316 15:101154063-101154085 GTGTGTGTGTGTGGGTGCACAGG - Intergenic
1132505933 16:308726-308748 GTGTGTGCGTGCTTGTGCTGTGG - Intronic
1132565106 16:618597-618619 GTGTGTGCAGCCATGTGCACAGG + Intronic
1132565127 16:618720-618742 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565143 16:618841-618863 GTATGTGCAGGCATGTGCACAGG + Intronic
1132565162 16:618961-618983 GTGTGTGCAGGCATTTGCACAGG + Intronic
1132565178 16:619082-619104 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565198 16:619207-619229 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565217 16:619332-619354 GTGTGTGCAGCCATGTGCACAGG + Intronic
1132692183 16:1186561-1186583 GTGTGTGGGCACGTGTGCAGAGG - Intronic
1132830514 16:1925787-1925809 GTGAGTGTGCACGTGGGCACAGG + Intergenic
1133020201 16:2963807-2963829 GTGCGAGCGCGTGCGTGCACTGG + Intergenic
1133328834 16:4958618-4958640 GTGTGTGTGCATGTGCGCACGGG + Intronic
1133708008 16:8373894-8373916 GTGTGTGTGTGTGTGTGCACAGG - Intergenic
1133770367 16:8864119-8864141 ATGTGTGCTCGTTTGTGCACAGG + Intronic
1133973205 16:10581286-10581308 GTGTGTGTGTGTGTGTGTACTGG - Intergenic
1134203658 16:12219915-12219937 GTGTGTACACGTGTGTGCGCTGG - Intronic
1134218120 16:12332248-12332270 GTGTTTGTGTGTGTGTGCACGGG + Intronic
1134782367 16:16909830-16909852 GTGTGTGCGCGTGTGTGGCTGGG + Intergenic
1134828469 16:17303999-17304021 GTGTGTGTGTGTGTGTGTACAGG + Intronic
1135037738 16:19092171-19092193 GTGTGTGTGCGCGCGCGCATTGG + Intergenic
1135265689 16:21023803-21023825 GTGTGTGTGTGTGTGTGGACTGG + Intronic
1135551101 16:23398922-23398944 GTCTGTGAGCACATGTGCACAGG - Intronic
1135656685 16:24256282-24256304 GTGTGCGAGCGCGTGTGCTGGGG - Exonic
1135656687 16:24256284-24256306 GTGTGTGCGAGCGCGTGTGCTGG - Exonic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136938142 16:34495260-34495282 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
1136961672 16:34853297-34853319 GTGTGTGTGTGTGTGTGCAGAGG - Intergenic
1137365313 16:47854742-47854764 GGCTGTGCGTGTGTGTGCACTGG - Intergenic
1137365478 16:47855895-47855917 GTGTGTGTGCGCGTGTTCAGAGG + Intergenic
1137561102 16:49502960-49502982 GTGTGTGTGTGAGTGTGCATGGG - Intronic
1137592608 16:49702896-49702918 GTGTGTGTGCGTGTGCACACAGG - Intronic
1137720303 16:50623749-50623771 GTGTGTGTGTGTGTGTACACAGG + Intronic
1137731375 16:50693230-50693252 GTGTGTGTGCGCGTGTGTGCTGG + Intergenic
1137849515 16:51725241-51725263 GTGTGTGTGTGTGTGTGCAGTGG - Intergenic
1138149121 16:54638622-54638644 GTGTGTACGCGTGTGTGTGCTGG - Intergenic
1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG + Exonic
1138708858 16:58946180-58946202 GTGTGTGCGTGTGTGTGCATGGG + Intergenic
1139199425 16:64957595-64957617 GTGTGTGTGTGTGTGTGCACGGG - Intronic
1139350679 16:66333206-66333228 GTGTGTGTGTGTGTGTGCCCAGG - Intergenic
1139420439 16:66846187-66846209 GTGTGTGTGTGTGTGTGCATGGG + Intronic
1139429215 16:66902095-66902117 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
1139458975 16:67107278-67107300 GTGTGTGTGTGTGTGTGTACGGG + Intergenic
1139968777 16:70761003-70761025 GTGTGTGTGTGTGTGTGCATGGG + Intronic
1141216452 16:82029562-82029584 GTATGTGTGTGCTTGTGCACAGG - Intergenic
1141567511 16:84913057-84913079 GTGTGTGTGTGTGTGTGCAGTGG + Intronic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1141698396 16:85631417-85631439 GTGTGTGGGCTCGTGGGCCCAGG + Intronic
1141945204 16:87304951-87304973 GTGTGTGTGCGTTTGTTCACAGG + Intronic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983429 16:87563992-87564014 GTGTGTGTGCGCGTGTGTTGGGG + Intergenic
1141983431 16:87564012-87564034 GGGTGTGTGCGTGTGTGCACGGG + Intergenic
1141983457 16:87564356-87564378 GTGTGTGCGTGTGTGCGCATTGG + Intergenic
1141983690 16:87565849-87565871 GTGTGTGCGTGTGTGTGTAGGGG + Intergenic
1142255109 16:89010087-89010109 GTGTGTGCAGGCTTGTGCATGGG - Intergenic
1142351330 16:89582069-89582091 GTGTGTGAGCACGTGTGCTGTGG + Intronic
1142355657 16:89600539-89600561 GGGTGCGCGTGTGTGTGCACAGG - Intergenic
1142363631 16:89638687-89638709 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
1142474750 17:182116-182138 AGGTGTGCGCGCCTGTGCATTGG - Intergenic
1142500879 17:332286-332308 GTGTGCGCGTGTGTGTGTACAGG + Intronic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1142686688 17:1581195-1581217 GTGTGTGTGTGTGTGGGCACTGG - Intronic
1142812102 17:2400249-2400271 GTGTGCGTGCGTGTGTGCACGGG - Intronic
1143102603 17:4512638-4512660 GTGTGTGCGTGCGCGCGCACGGG + Intronic
1143390018 17:6554964-6554986 GTGTGAGTGTGTGTGTGCACTGG - Intronic
1143433991 17:6909134-6909156 GGGTGTGCACACATGTGCACTGG + Intronic
1143535057 17:7533423-7533445 GTGTGTGCGTGTGTGTGTGCAGG + Intergenic
1143911582 17:10254539-10254561 GTGTGTGTGTGTGTGTACACAGG - Intergenic
1144172835 17:12676230-12676252 GTGTGTGCGTGCGCGCGCAGGGG - Intronic
1144754085 17:17668999-17669021 GCGTGTGCGTGTGTGTGCGCAGG - Intergenic
1144958733 17:19032971-19032993 GTGTGTGCGCTTGTGTGTACTGG - Intronic
1144976426 17:19141553-19141575 GTGTGTGCGCTTGTGTGTGCTGG + Intronic
1145253674 17:21311036-21311058 ATGTGTGCATGCGTGTTCACAGG - Intronic
1145265071 17:21376108-21376130 GTGTGTGCGCGCATGTCCCCGGG + Intergenic
1145322912 17:21776925-21776947 ATGTGTGCACGCGTGTTCACAGG + Intergenic
1146059556 17:29597279-29597301 GTGTGTGTGCGTATTTGCACAGG - Intronic
1146219966 17:31009256-31009278 GTGTGTGCGTGTGTGTTCCCGGG + Intergenic
1146275587 17:31513792-31513814 GTGTGTGCGCATGTGTGGCCAGG + Intronic
1146566537 17:33917851-33917873 GTGTGTGTGTGTGTGTGTACCGG - Intronic
1146681712 17:34813155-34813177 GTGTGTTCGTGCATGTGCACAGG - Intergenic
1147139487 17:38453453-38453475 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1147177008 17:38662227-38662249 GTGTGTGTGTGCATGTGCATAGG + Intergenic
1147924859 17:43940048-43940070 GTGTGTACGCGCATGTGTAAAGG - Intergenic
1148331461 17:46816464-46816486 GTGTGTGTGTGCGTGTGTTCTGG - Intronic
1148563406 17:48619262-48619284 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
1148859214 17:50595376-50595398 GTGTGTGCGTGCCTGTGCTGAGG + Intronic
1149347738 17:55754835-55754857 GTGTGCGCGCGTGTGTGTATTGG + Intronic
1149614581 17:57987821-57987843 GTGTGTGTGCGTGTGTGTGCTGG + Intronic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1149992685 17:61391644-61391666 GTGTGTGCAGGCGTGGGTACGGG + Intronic
1151212306 17:72553775-72553797 GTGTGTGTGCGTGTGTGCCCAGG - Intergenic
1151212330 17:72553985-72554007 GTGTGTGTGTGTGTGTGCCCAGG - Intergenic
1151212368 17:72554278-72554300 GTGTGTGTGCATGTGTGCCCAGG - Intergenic
1151212381 17:72554358-72554380 GTGTGTGTGCATGTGTGCCCAGG - Intergenic
1151509830 17:74551437-74551459 GTGTGTGCGCACGCATGCACAGG - Intergenic
1151817702 17:76479358-76479380 GTGTGTGCCCGCGTGCCTACAGG + Intronic
1151828729 17:76537710-76537732 GTGTGTGCGTGCGTGTGTGCAGG + Exonic
1151851841 17:76695362-76695384 GTGTGTGTGTGTGTGTGCAACGG + Intronic
1151868933 17:76823450-76823472 GTGTGTGTGTATGTGTGCACAGG - Intergenic
1151933401 17:77247205-77247227 GAGTGTGCGCGTCTGCGCACCGG + Intergenic
1152062669 17:78090130-78090152 GTGTGTGTGTGCATGTGCATAGG + Intronic
1152148683 17:78585156-78585178 GTGTGTGTGTGCGCGTGCATAGG - Intergenic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152205211 17:78971016-78971038 GTGTGTGATTGCATGTGCACAGG - Intergenic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152258745 17:79255235-79255257 GTGTGTGTGTGTGTGTGTACTGG + Intronic
1152273678 17:79341244-79341266 GTGTGTACATGTGTGTGCACAGG + Intronic
1152282228 17:79391698-79391720 GTGTGAGCGTGTGTGGGCACAGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152293447 17:79453690-79453712 GTGTGTGCCGGTGTGTGCAGAGG + Intronic
1152387308 17:79982516-79982538 CTGTGTGTGCACGTGTGTACAGG + Intronic
1152466691 17:80470679-80470701 GTGTGCGTGTGCGTGTGCAGGGG + Exonic
1152737865 17:82006158-82006180 GTGGGTGCACGTGTGTGCACGGG + Intronic
1152815181 17:82403748-82403770 GGGTGAGCGCGCATGTGGACAGG - Intronic
1152855059 17:82660610-82660632 GTGTGTGTGCACGTGTGTGCAGG - Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1152903661 17:82958861-82958883 GTGTGTGTGTGTGTGTACACTGG + Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1153579376 18:6557003-6557025 GTGTGTGTGTGTGTGTGTACGGG + Intronic
1153646716 18:7202537-7202559 GTGTGTGTGTGCGTGCGCGCGGG - Intergenic
1153953918 18:10080239-10080261 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154285388 18:13051371-13051393 GTGTGTGTGTGCGTGTGTGCGGG + Intronic
1154300824 18:13190926-13190948 GTGTGTGTGTGCGTGTGTGCGGG + Intergenic
1154805661 18:19182711-19182733 GTGTGTGTGTGTGTGTGCATGGG + Intergenic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1155830755 18:30513011-30513033 GTGTGTGAGCGAGTGAGCATGGG + Intergenic
1155874815 18:31073358-31073380 GTGTGTGCGTGTGTGTGTATCGG - Intronic
1156000353 18:32378052-32378074 GTGTGTGCGCGCGGGCGCTTTGG + Intronic
1156089270 18:33445326-33445348 GTGTGTGCACACATGTGCATGGG + Intergenic
1156687494 18:39667697-39667719 GTGTGTGTGTGCGTGTGTGCAGG - Intergenic
1157108970 18:44801564-44801586 GTATGTGTGTGCATGTGCACAGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1157314568 18:46576829-46576851 GTGTGTGCGCCTGTAGGCACAGG + Intronic
1158109124 18:53920420-53920442 GTGTGTGCACGTGTGTGTATGGG + Intergenic
1158400924 18:57121187-57121209 GTGTGTGCACGCGAGTGCGCAGG + Intergenic
1159774180 18:72584952-72584974 GTGTGTGAGCAAGTGAGCACAGG + Intronic
1159944739 18:74435922-74435944 GTGTGTGCACATGAGTGCACGGG - Exonic
1159963649 18:74575739-74575761 GTGTGTGCGCGTGTGTGAAGGGG + Intronic
1159982147 18:74795939-74795961 GTGTGTGCGCGTGTGCACAGCGG - Intronic
1159991638 18:74915417-74915439 GTGTGTGTGCATGTGTGTACTGG + Intronic
1160001608 18:75029585-75029607 GTGTGTGCGTATGTGTGCATGGG + Intronic
1160035529 18:75298228-75298250 GTGTGTGTGTGTGTATGCACAGG + Intergenic
1160334602 18:78027481-78027503 GTGTGTGCGTGCGTGCGCCTGGG - Intergenic
1160357892 18:78244193-78244215 GTGTGTGCGCGTGTGTGAAGTGG - Intergenic
1160429132 18:78799603-78799625 GTGCGCGCGCGCGTGTGCAGTGG - Intergenic
1160992953 19:1867958-1867980 GTGTGCGTGCGCGCATGCACTGG + Intergenic
1161086215 19:2336173-2336195 GTGTGTGGGGGCATGTGCATGGG + Intronic
1161086255 19:2336865-2336887 GTGGGTGTGTGCGTGTGCACTGG + Intronic
1161114957 19:2491409-2491431 GTGTGTGCGCACAGGTTCACCGG - Intergenic
1161251673 19:3284181-3284203 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1161839585 19:6671265-6671287 GTGTGTGTGCGCACTTGCACGGG + Intergenic
1161978016 19:7616758-7616780 GCGTGTGGGCACGTGTGCATGGG + Intronic
1162129532 19:8517564-8517586 GTGTGTGTGTGCGTGTGTGCAGG + Intergenic
1162129534 19:8517566-8517588 GTGTGTGTGCGTGTGTGCAGGGG + Intergenic
1162308388 19:9889725-9889747 GTGTGTGTGCGCCAATGCACTGG + Intronic
1162393827 19:10404892-10404914 GTCCGTGCGCGCGCGTGCCCGGG - Intronic
1162778549 19:12995105-12995127 GTGTGTGTGCCCGTGTGTAGGGG + Intergenic
1164938828 19:32235663-32235685 GTGTGTGCGTGTGGGTGCATAGG - Intergenic
1165060574 19:33203154-33203176 GTGTGAGCACTCGTGTGAACAGG + Intronic
1165211136 19:34236755-34236777 GGGTGTGGGCGAGTGTGCAGAGG - Intergenic
1165320987 19:35084967-35084989 GTGTGTGTGTGTGTGTGCGCTGG - Intergenic
1165362759 19:35346785-35346807 GTGTGTGCGCACATGCGCGCAGG - Exonic
1165531903 19:36409978-36410000 GTGTGTGCGCGCGTGTGTGTTGG - Intronic
1165716190 19:38047223-38047245 GTGTGTGCGTGCGTGTGTGTCGG - Intronic
1166222953 19:41377239-41377261 GCATGTGTGCGTGTGTGCACAGG + Intronic
1166302195 19:41917637-41917659 GTGCGTGCGTGCGTGTGCTTTGG - Intronic
924991800 2:318869-318891 GTGTGCGGGTGTGTGTGCACGGG + Intergenic
924991816 2:318996-319018 GTGTGTGCGGGCGTGTGTGTGGG + Intergenic
924991868 2:319375-319397 GTGTGTGCGTGGGTGTGTGCAGG + Intergenic
924991869 2:319387-319409 GTGTGTGCAGGCGTGTGTGCAGG + Intergenic
924991877 2:319423-319445 GTGTGTGGGGGTGTGTGCGCGGG + Intergenic
924991878 2:319433-319455 GTGTGTGCGCGGGTGTGTGCAGG + Intergenic
924991880 2:319445-319467 GTGTGTGCAGGCGTGTGTGCGGG + Intergenic
924991883 2:319473-319495 GTGTGTGTGGGCGTGTGTGCAGG + Intergenic
925040401 2:728851-728873 CTGTGTGTGCGTGTGTGCAAGGG + Intergenic
925088913 2:1137185-1137207 GTGTGTGTGCATGTGTCCACAGG - Intronic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
925801629 2:7607768-7607790 GTGTGTGTGCACGCGTGCACAGG + Intergenic
925827870 2:7867924-7867946 GTGTGTGTGTGTGTGTGTACGGG - Intergenic
926285374 2:11483201-11483223 GTGTGGGCGCGCGTGTGTGTGGG + Intergenic
926356987 2:12049493-12049515 GTGTGTGTGTGTGTGTGCATGGG - Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927018172 2:18989776-18989798 GTGTGTGTGCGTGTGTGTGCAGG + Intergenic
927018173 2:18989786-18989808 GTGTGTGTGCAGGTGTGTACTGG + Intergenic
927155777 2:20220350-20220372 GTGTGTGTGCGCATGTGTATGGG - Intronic
927408901 2:22803006-22803028 GTGTGTGTGTGTGTGTGCATAGG - Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927779607 2:25928854-25928876 GTGCGTGTGCGTGTGTGCAGGGG - Exonic
927845771 2:26471727-26471749 GTGGGTGTGTGCATGTGCACTGG - Intronic
927848244 2:26483063-26483085 GTGTGTGTGCGTGTGTGAATGGG + Intronic
927979586 2:27366244-27366266 GTGTGTGTGTGTGTGTGTACAGG + Intronic
928171344 2:29006493-29006515 GAGTGTGTGTGCGTGTGCTCAGG + Intronic
928269664 2:29844854-29844876 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
928276770 2:29908275-29908297 GTGTGTGTGTGTGTGTGCTCTGG - Intronic
928291624 2:30043328-30043350 GTGTGTGTGTGCATGTTCACAGG + Intergenic
928467081 2:31532356-31532378 GTGTGTGTGTGTGTGTGAACTGG - Intronic
928758159 2:34550441-34550463 GTGTGTGTGTGTGTGTGTACTGG + Intergenic
929102134 2:38325657-38325679 GTGTGTGTGTGTGTGTGTACTGG - Intronic
929102135 2:38325695-38325717 GTGTGTGTGTGTGTGTGTACTGG - Intronic
929156118 2:38789949-38789971 GTGTGTGTGTGTGTGTGCATGGG + Intergenic
929313280 2:40450364-40450386 GTGTGTGCACGCGCGCGCGCTGG + Intronic
929315855 2:40477753-40477775 GTGTGTGCACGTGTGTGTAGGGG + Intronic
929543443 2:42840450-42840472 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
929783956 2:44975843-44975865 GTGTGTGCGTGTGTGTGCGTAGG - Intergenic
931201987 2:60106333-60106355 GTGTGTTTGCGTGTGTGCAAAGG - Intergenic
931663915 2:64596317-64596339 GTGTGTGTGTACGTGTGCATTGG - Intergenic
931667031 2:64617037-64617059 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
931927017 2:67084761-67084783 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
931960474 2:67476941-67476963 GTGTGTGCGCCTGTGTGCCTGGG + Intergenic
932142069 2:69287939-69287961 GTGTGTGCGTGCATGTTTACAGG - Intergenic
932221888 2:70006110-70006132 GTGTGTGCGCACATGGGCATGGG - Intergenic
932279207 2:70474988-70475010 GTGTGTGTGTGTGTGTGTACTGG + Intronic
932453142 2:71828568-71828590 GTGTGTGCGTGTGTGTGTGCAGG - Intergenic
933606412 2:84389142-84389164 GTGTGTGGGCAAGTGAGCACAGG + Intergenic
933817235 2:86077796-86077818 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
933949445 2:87315488-87315510 GTGTGTGCATGTGTGTGCACGGG + Intergenic
934856601 2:97733727-97733749 GTGTGGGCACATGTGTGCACAGG - Intronic
935066026 2:99648870-99648892 GTGTGTGCGCGCGTGTTTTGAGG - Intronic
935095443 2:99940140-99940162 ATGTGTGTGTGAGTGTGCACAGG + Intronic
935300103 2:101686524-101686546 GTGTGTACGTGCGTGTGCGCAGG + Intergenic
935408573 2:102735829-102735851 GTGTGCGCGCGCGCGTGTCCTGG - Intronic
935430165 2:102967378-102967400 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
935506237 2:103907401-103907423 GTGTGTATGTGTGTGTGCACGGG - Intergenic
935590400 2:104842694-104842716 GTGTGTGCGCGTGCGAGGACCGG - Intergenic
935831570 2:107006166-107006188 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
936073712 2:109388078-109388100 GTGTGTGCATGTGTGTGCACAGG - Intronic
936075702 2:109400568-109400590 GTGTGTGTGTGTGTGCGCACAGG - Intronic
936330747 2:111546109-111546131 GTGTGTGCATGTGTGTGCACGGG - Intergenic
937167947 2:119837932-119837954 GTGTGTGGGCGAGTGAGCACAGG - Intronic
937225570 2:120366948-120366970 GTGTGTATGCGTGTGTGCATGGG + Intergenic
937300829 2:120840404-120840426 GTGCATGCACGCGTGTGCATGGG + Intronic
937950856 2:127387383-127387405 GTGTGTGCGCGCGTGTGTGTCGG - Intronic
938202312 2:129383725-129383747 TTGTGTGTGTGTGTGTGCACCGG + Intergenic
938461892 2:131502709-131502731 GTGTGCGCGTGCGCGTGCAATGG - Intergenic
938639668 2:133266117-133266139 GTGTGTGCGCGCCTGTAGAGCGG + Intronic
938721981 2:134075477-134075499 GTGTGTGAGCGAGTGAGCAAGGG + Intergenic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
939118519 2:138088792-138088814 GTGTGTGTGTGTGTGTGCACAGG - Intergenic
939312995 2:140509057-140509079 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
939758204 2:146139294-146139316 GTGTGTGCATGCATATGCACAGG + Intergenic
940193781 2:151070321-151070343 GTGTGTGTGTGTGTGTGTACGGG - Intergenic
940973021 2:159914081-159914103 GTGTGTGTGTGGGTGTGCCCTGG + Intergenic
941264961 2:163349242-163349264 GTGTGTGTGCGTGTGTGTAGAGG - Intergenic
941574405 2:167212908-167212930 GTGTGTGTGTGTGTGTGCAGAGG - Intronic
941606784 2:167607519-167607541 GTGTGCGTGTGTGTGTGCACAGG + Intergenic
941821414 2:169847109-169847131 GTGTGTGTGTGTGTGTGCGCTGG + Intronic
942182385 2:173392587-173392609 ATGCGTGCATGCGTGTGCACAGG - Intergenic
942425126 2:175852089-175852111 GTGTGTATGCGCGTGTGTAGGGG - Intergenic
942448594 2:176094374-176094396 GTGTGTGTGTGCGTTTGCAGGGG - Intronic
942660862 2:178263827-178263849 GTGTGTGTGTGCGTGTACACAGG + Intronic
942803959 2:179908119-179908141 GTGTGTGTGTGCATGTGCGCGGG + Intergenic
943194227 2:184722087-184722109 GTGTGGGTGCGCGTGTGTATGGG + Intronic
943485750 2:188478107-188478129 TTGTGTGTGTGTGTGTGCACAGG + Intronic
944354353 2:198768151-198768173 GTGTGTGTGTGTGTGTCCACTGG + Intergenic
945033359 2:205684939-205684961 GTGTGTGCGCGCTCGCGCGCTGG - Intronic
946310479 2:218880319-218880341 GGGTCTGTGCGCGCGTGCACAGG - Intergenic
946311069 2:218882978-218883000 GTGTGTGTGCCTGTGTGCAGTGG + Intronic
946888821 2:224252590-224252612 GTGTGTGTGTGTGTGTACACAGG - Intergenic
947054705 2:226087288-226087310 GTGTGTGAGCAAGTGAGCACAGG + Intergenic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
947744946 2:232502638-232502660 GTGTGCGCACGCGTGTGTGCAGG + Intergenic
948097118 2:235344046-235344068 GTGTGTGTGAGCGTGTGGGCGGG - Intergenic
948640453 2:239372479-239372501 GTGTGCGCGCGTGTGTGCGCGGG - Intronic
948661564 2:239510096-239510118 GTGTGTGTGCGTGTGTGCAGTGG + Intergenic
949014716 2:241702554-241702576 GGCTGTGCGCCCGTGTGCGCCGG + Intronic
949040374 2:241845411-241845433 GTGTGTGGGTGTGTGTGTACAGG - Intergenic
1169143624 20:3239134-3239156 GTGAGTGCGCGAGTGTGCCATGG - Intronic
1169751573 20:8999995-9000017 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
1170083788 20:12506575-12506597 GTGTGTGTGTGTGTGTGTACTGG - Intergenic
1170163054 20:13335319-13335341 GTGTGTGTGTGTGTGTGCATAGG - Intergenic
1170180788 20:13527601-13527623 GTGCGTGCGTGCGTGTGTGCAGG - Intronic
1170210774 20:13844380-13844402 GTGTGTGTGCGTGTGTGTAGCGG + Intergenic
1170648610 20:18218635-18218657 ATGTGTGCGCATGTGTGCATGGG + Intergenic
1170821501 20:19758685-19758707 GGGTGTGCGTGCGTGTGCACCGG + Intergenic
1171182271 20:23099416-23099438 GTGTGTGCGTGTGTGTGTATTGG - Intergenic
1171183491 20:23108491-23108513 GTGTGTGCACGTAGGTGCACAGG + Intergenic
1171294183 20:24002932-24002954 ATGTGTGTGCGTGTGTTCACAGG - Intergenic
1171420087 20:25012167-25012189 GTGTGTGCCAGAGTGTGCTCTGG - Intronic
1172587245 20:36093370-36093392 GTGTGTGCGCGTGTGAGTGCGGG + Intronic
1172840875 20:37902245-37902267 GTGTGCGCGCGCGTATGCGTGGG - Intergenic
1173384859 20:42577851-42577873 GTGTGTGTGTGTGTGTGTACAGG + Intronic
1173418991 20:42883919-42883941 GTGTGTGCATGCCTGTGTACTGG - Intronic
1173429589 20:42974458-42974480 GTGTGTGCGCGCGTGCACTGAGG - Intronic
1173576228 20:44114594-44114616 GTGTGTGTGTGTGTGTGCGCTGG + Intronic
1173657018 20:44706458-44706480 GTGTGTGCTGCCGTGTGCAGAGG + Intergenic
1173882289 20:46424615-46424637 GTGTGTGCGTGTGTGTGTAGGGG + Intronic
1173997516 20:47350241-47350263 GTGCGTGCATGTGTGTGCACGGG - Intronic
1174765602 20:53250917-53250939 GTGTGTGTGTGTGTATGCACAGG + Intronic
1174874624 20:54213396-54213418 GTGTGTGTGAGTGTGTACACAGG - Intronic
1175279216 20:57791954-57791976 GTGTGTGTGATTGTGTGCACAGG - Intergenic
1175404694 20:58718488-58718510 GTGAGTGCATGCGTGTGCACTGG + Intronic
1175494038 20:59400809-59400831 GTGTGTGCGCGCCTGCTGACTGG - Intergenic
1175679226 20:60973312-60973334 GTGTGTGTGTGTGTGTGTACGGG + Intergenic
1175684651 20:61019582-61019604 GTGTGTGTGCGTGGGTGCATGGG - Intergenic
1175793856 20:61758915-61758937 GTGTGTGCACCTGTGTGCATGGG + Intronic
1175808068 20:61841731-61841753 GAGTGTGTGCACATGTGCACAGG + Intronic
1175814401 20:61876056-61876078 GTGTGTGGGAGTGTGTGGACAGG - Intronic
1175864738 20:62169273-62169295 GTGAGTGTGCGTGTGTGCAAGGG - Intronic
1175932764 20:62500595-62500617 GCGTGTGAGGGCGTGTGCAGGGG + Intergenic
1175952928 20:62592940-62592962 GTGTGTGCGCATGTGTGTATGGG + Intergenic
1176102161 20:63369502-63369524 GGGTGTGTGCACGTGTGCATGGG + Intronic
1176176902 20:63732370-63732392 GTGTGTGCGCGCATGTGTGTGGG + Intronic
1177078339 21:16606911-16606933 GTGCGTGTGCGCATGTGCACAGG + Intergenic
1177257389 21:18683108-18683130 GTGTGTATGCACATGTGCACGGG + Intergenic
1177344534 21:19853253-19853275 GTGTGTGAGTGAGTGTGCGCAGG + Intergenic
1178706078 21:34874147-34874169 GTGTGTGTGCGTGTGTGCAAGGG - Intronic
1179354645 21:40648246-40648268 GTGTGTGTGTGTGTGTGTACAGG - Intronic
1179565230 21:42243474-42243496 GTGTGTGTGTGTGTGTGCGCTGG + Intronic
1179569250 21:42268381-42268403 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1180083147 21:45495695-45495717 GTATGTGTGCGCGTGTGTATGGG - Intronic
1180172815 21:46068730-46068752 GTGTGTGTGCACGTGTGCCTGGG + Intergenic
1180611535 22:17101350-17101372 GTGTGTGCACGCGTGTGTGCAGG - Intronic
1180766947 22:18350974-18350996 GTGTGTGTGTGCACGTGCACTGG + Intergenic
1180779367 22:18511405-18511427 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1180812082 22:18768725-18768747 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1181069257 22:20322341-20322363 GTGTGTGCGCGCGCGCACAATGG - Intergenic
1181198238 22:21202969-21202991 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1181401507 22:22652835-22652857 GTGTGTGCGCGCACGTGCACTGG + Intergenic
1181596730 22:23920123-23920145 GTGTGTGCGCGTGTGTGTGATGG + Intergenic
1181648046 22:24244284-24244306 GTGTGTGTGTGCACGTGCACTGG - Intronic
1181859010 22:25803961-25803983 GTGTGTGTGTGTGTGTTCACTGG - Intronic
1182022577 22:27093720-27093742 GTGTGTGCGTGTGTGTGTGCAGG - Intergenic
1182041635 22:27242811-27242833 GTGTGTGCGCGCGTGCGCGGGGG - Intergenic
1182041637 22:27242813-27242835 GTGTGTGTGCGCGCGTGCGCGGG - Intergenic
1182121028 22:27786835-27786857 GTGTGTGTGTGTGTGCGCACGGG - Intronic
1182737661 22:32542646-32542668 GTGTGTGTGCGCGCGCACACAGG + Intronic
1182826769 22:33272315-33272337 GTGTGTGCTTGTGTGTACACAGG + Intronic
1183034868 22:35134019-35134041 GTGTGTGTGCGCGTGTGCGCAGG + Intergenic
1183186670 22:36295406-36295428 GTGTGTGTGTGTGTGTGCAGAGG + Intronic
1183278190 22:36914564-36914586 GTGTGTGCAGGTGTGTGTACTGG + Intronic
1183358807 22:37372924-37372946 GTGTGTGCGTGCGTGCGTGCGGG + Exonic
1183614847 22:38937641-38937663 GTGGGTGCACGTGTGTGCATGGG + Intergenic
1183664998 22:39242096-39242118 GTGTGCGCGCACGTGTGCTCAGG + Intronic
1184264730 22:43341076-43341098 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
1184779449 22:46639500-46639522 TTGTGTGTGAGCGTGTGCAGTGG + Intronic
1184802366 22:46769430-46769452 GTCTGTGCGCATGTGTTCACAGG - Intronic
1184868932 22:47220894-47220916 GTGTGCATGCACGTGTGCACAGG - Intergenic
1185023687 22:48395507-48395529 GTGTGTGCATGTGTGTGCACAGG - Intergenic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
1185100402 22:48837638-48837660 GTGTGCGCACGTGTGTGCATGGG - Intronic
1185125069 22:49005580-49005602 GTGTGTGTGCTCGTGTGAATGGG + Intergenic
1185143007 22:49113804-49113826 GTGTGTGTGTGTGTGTGCACTGG - Intergenic
1185299251 22:50070968-50070990 GTGTGTGCAAGAGTGTGCCCTGG - Intronic
1203228569 22_KI270731v1_random:91868-91890 GTGTGTGTGTGCACGTGCACTGG + Intergenic
950105629 3:10386568-10386590 GTGTGTGTGCGCGTGCGCATGGG - Intronic
950576159 3:13833358-13833380 GTGTGTGTGCGCTTGTGTGCCGG - Intronic
950794463 3:15499276-15499298 GTGTGTCCATGCTTGTGCACTGG - Intronic
951329260 3:21345650-21345672 GTGTGTGCGCGTGTGCGCGAAGG + Intergenic
951479999 3:23150284-23150306 TTGTGTGTGCGTGTGTGCAGTGG + Intergenic
951649753 3:24938029-24938051 GTGTGTGCGCATGTGTGCATAGG - Intergenic
951729797 3:25797979-25798001 GTGTGTGTGCGCGTGTGTGTAGG - Intergenic
952204061 3:31162095-31162117 GTGTGTGTGTGTGTGTGTACTGG - Intergenic
952384433 3:32829654-32829676 GTGTGTGCGTGTGTGTGCATTGG + Intronic
953350925 3:42215508-42215530 GTGTGTGTGTGTGTGTGTACTGG + Intronic
953541679 3:43824690-43824712 GTGTGTATGTGTGTGTGCACAGG + Intergenic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
953743493 3:45556129-45556151 GTGTGTGTGTGCCTGTGCCCAGG + Intronic
954074588 3:48168355-48168377 GTGTGTGTGTGTGTGTGGACAGG - Intronic
954256661 3:49412060-49412082 GTGAGTGCGCGCGCGTGCGCGGG - Exonic
954815040 3:53273603-53273625 GTGTGTGTGCACGTGTGCACAGG + Intergenic
955456781 3:59130293-59130315 GTGTGTGCGCGCTTGTGTTCAGG + Intergenic
955534376 3:59907603-59907625 ATGTGTGTGCATGTGTGCACTGG + Intronic
955856798 3:63280730-63280752 GTGTGTGTGTGTGTGTGCACAGG + Intronic
956097758 3:65735361-65735383 GTGTGTGTGTGTGTGTGTACAGG + Intronic
956129180 3:66038452-66038474 GAGTGCGCGAGCGTGTGCAGGGG - Intronic
957188810 3:76979598-76979620 GTGTGTGTGTGTGTGTGCGCAGG + Intronic
957363391 3:79188537-79188559 GTGTGTGTGTGCGTGTGCAAAGG - Intronic
957458501 3:80486187-80486209 GTGTATGGGCCCGTGTGAACGGG - Intergenic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
957820781 3:85371627-85371649 GTGTGTGTGTGTGTGTGCATGGG + Intronic
958010148 3:87866840-87866862 GTGTGTGCGTGTGTGTGTTCAGG + Intergenic
958166143 3:89880290-89880312 GTGTGTGTGTGCGTGTGCTGTGG + Intergenic
959034276 3:101342281-101342303 GTATGTGCATGCATGTGCACAGG + Intronic
959623469 3:108423780-108423802 GTGTGTGTGTGCATCTGCACAGG - Intronic
959778418 3:110199344-110199366 GTGTGTGCACACAGGTGCACTGG - Intergenic
959988771 3:112607015-112607037 ATGTGTGCCTGTGTGTGCACGGG - Intronic
960052903 3:113254624-113254646 GGGTGTGCATGCGTGTGCACCGG - Intronic
960084019 3:113571481-113571503 GTGTGTGTGTGTGTGTGCAGAGG - Intronic
960414513 3:117368124-117368146 GTGTGTGTGCGTGTGTGTACAGG - Intergenic
960465936 3:117996887-117996909 GTGCGCGCGCGCGTGTGAACGGG - Intergenic
960854374 3:122087487-122087509 GTGTGTGCGAGGGTGTGGGCTGG - Intronic
961163189 3:124746797-124746819 GCATGCGCGCGCGTGCGCACTGG + Intergenic
961492001 3:127262891-127262913 GTGTGTGTGCATGTGTGTACAGG + Intergenic
961611933 3:128146414-128146436 GTGTCTCTGTGCGTGTGCACGGG + Intronic
961611941 3:128146530-128146552 GTGTCTCTGTGCGTGTGCACGGG + Intronic
961793734 3:129394551-129394573 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
961793750 3:129394686-129394708 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
961810039 3:129516612-129516634 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
962100499 3:132337082-132337104 GTGTGTGTGTGTGTGTGTACAGG + Intronic
962190083 3:133300971-133300993 GTGTGTGTGTGTGTGTGTACTGG - Intronic
962190193 3:133302259-133302281 GTGCATGCGTGCGCGTGCACGGG + Intronic
962318859 3:134374921-134374943 GTGTGTGCGTGTGTGTGTACCGG + Intronic
962903839 3:139783907-139783929 GTGTGTGTGGGTGTGTGTACGGG - Intergenic
963018991 3:140854025-140854047 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
963080286 3:141385674-141385696 GTGTGTGCGCGTGTGTTGATAGG + Intronic
963722085 3:148873352-148873374 GTGTGCGCGCGTGCATGCACTGG - Intronic
963741939 3:149089565-149089587 GTGTGTGTGTGTGTGTGCACGGG - Intergenic
964526351 3:157619107-157619129 GTGTGTGCGTGTGTGTGTATTGG + Intronic
964531925 3:157677842-157677864 GTGTGTGTGTGTGTGTGAACAGG + Intergenic
964619915 3:158710975-158710997 TTGTGTGTGCTTGTGTGCACTGG - Intronic
964656301 3:159069877-159069899 GTGTGTGTGTGCGTGTGTATGGG + Intronic
964733780 3:159894952-159894974 GTATGTGCGTGCATGTGCATAGG + Intronic
964812887 3:160684549-160684571 GTGTGTGTGCGCATGTGTAGCGG - Intergenic
964829049 3:160862651-160862673 GTGTGTGTGTGCGTGTGCCTAGG - Intronic
965297490 3:166968316-166968338 GTGTGTGTGTGTGTGTGCAATGG + Intergenic
965881752 3:173396031-173396053 GTGTGTGTGTGCGTGTCTACAGG + Intergenic
966008734 3:175050102-175050124 GTGTGTGTGTGAGTGTGCCCTGG + Intronic
966297285 3:178439074-178439096 GTGTGTGCGTGTGTGTGTATGGG + Intronic
966560845 3:181318428-181318450 GTGTGTGTGTGTGTGTGTACTGG - Intergenic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
966711655 3:182979359-182979381 GTGTGTGCGCGCCTGTGTTAAGG - Intronic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
966886046 3:184378722-184378744 GTATGTGCGCACACGTGCACTGG + Intronic
967241253 3:187441687-187441709 GTGTGTGTGCGTGTGTGTAGGGG - Intergenic
967363564 3:188659805-188659827 GTGTGTGTGTGTGTGTGCATAGG - Intronic
967905343 3:194495000-194495022 GTGTGTGTGTGTGTGTGTACTGG + Intronic
968063761 3:195746902-195746924 GTGTGCACGCGCGCGTGCACAGG + Exonic
968434455 4:577143-577165 GTGTGCGCGCGCGTGTGTGCGGG + Intergenic
968447547 4:659730-659752 GTGTGTGCTCACATGTGCACAGG + Intronic
968585616 4:1414725-1414747 GGGGGTGGGCGCGTGAGCACGGG + Intergenic
969301497 4:6299965-6299987 GTGTGTGCACGTGTGTGTACGGG + Intronic
969321219 4:6414106-6414128 GTGTGTGTGTGTGTGTGTACAGG + Intronic
969421086 4:7096222-7096244 GTGTGTGCATGCGTTGGCACTGG + Intergenic
969543894 4:7811420-7811442 GTGAGTGTGTGCGTGTGCAGAGG - Intronic
969962911 4:10964225-10964247 GTGTGTGCACACGTGAACACAGG + Intergenic
970353987 4:15234298-15234320 GAGTGAGCGAGCGTGTGTACGGG - Intergenic
970514919 4:16819110-16819132 GTGTGTGTGTGTGTGTGTACAGG + Intronic
970826545 4:20283105-20283127 GTGTGTGCGCGCGCGCACACAGG - Intronic
971198792 4:24493338-24493360 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
972801463 4:42480014-42480036 GTGTGTGTGTGTGTGTGTACTGG + Intronic
973162130 4:47032123-47032145 GTGTGTGTGTGTGTGTGCCCAGG - Intronic
973184722 4:47312063-47312085 GTGTGTGTGCGCGTGCATACAGG + Intronic
973199669 4:47485842-47485864 GTGTATGCCCGCGTGTACAAAGG - Intronic
973263668 4:48188894-48188916 GTGTGTGCGCGCATATGCATGGG - Intronic
973936820 4:55854299-55854321 GTGTGAGTGCCCGTGTGCATTGG - Intronic
973956841 4:56070875-56070897 GTGTGTGTGTGTGTGTCCACAGG + Intergenic
975398328 4:73903844-73903866 GTGTGTGTGTGTGTGTGGACAGG + Intergenic
975557432 4:75678326-75678348 GTGTGTGTGTGTGTGTACACAGG + Intronic
976108638 4:81646358-81646380 GTGTGTGTGTGTGTGTGTACTGG + Intronic
976345879 4:84000495-84000517 GTGTGTGTGTGTGTGTGTACTGG + Intergenic
979234170 4:118380915-118380937 GTGTGTGTGTGTGTGTACACTGG + Intergenic
979469021 4:121072685-121072707 GTGTGTGTGTGCGTGCGCGCTGG - Intronic
980113595 4:128658317-128658339 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
980136035 4:128859611-128859633 ATGTGTATGCACGTGTGCACTGG + Intronic
980249254 4:130292884-130292906 GTGTGTGCGCGTGTGTGTGTGGG + Intergenic
980400043 4:132271424-132271446 GTGTGTGTGTGTGTGTGCATGGG + Intergenic
980538065 4:134155407-134155429 GTGTGTGTGTGTGTGTGAACTGG - Intergenic
981034458 4:140154504-140154526 GTATGCGCGCGCGCGTGCGCGGG + Intergenic
981093414 4:140756124-140756146 GGGCGGGCGCGCGTGTGCCCAGG - Intergenic
981162122 4:141510499-141510521 GTGTGTGTGTGTGTGTGTACTGG - Intergenic
981419689 4:144534939-144534961 GTGTGTGTGTGTGTGTGTACTGG + Intergenic
981424482 4:144587575-144587597 GTGTGTGTGTGTGTGTGTACTGG + Intergenic
981509147 4:145536222-145536244 GTGTGTGTGCGTGTGTGTACTGG - Intronic
982484241 4:155948391-155948413 GTGTGTGTGCACATGTGTACTGG + Intronic
982839046 4:160159536-160159558 GTGTGTGAGCGAGTGAGCACGGG + Intergenic
982991214 4:162277782-162277804 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
984639159 4:182144187-182144209 GTGTGTGCGGGAGTGTGCGAGGG - Intronic
985068878 4:186149024-186149046 GTGTGTGTGCGCTCATGCACAGG + Intronic
985074700 4:186202607-186202629 GTGTGTGCATGTGTGTGCATGGG - Intronic
985120706 4:186638610-186638632 GTGTGTGTGTGTGTGTGCATTGG - Intronic
985329443 4:188813503-188813525 GTGTGTGTGCGTATGTACACAGG + Intergenic
985383839 4:189424461-189424483 GTGTGTGCGCGTATGCGTACAGG - Intergenic
985624707 5:979165-979187 GTGTGTGTGTGTGTGTGCATGGG - Intergenic
985681948 5:1260269-1260291 GTGTGTGCACAGGTGTGCAAGGG - Intronic
985730591 5:1545497-1545519 ATGTGTGCAGGTGTGTGCACAGG - Intergenic
985840064 5:2299281-2299303 ATGTGTGGGTGTGTGTGCACAGG - Intergenic
985842016 5:2313841-2313863 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
985895918 5:2750077-2750099 CTGTGTGCGCGCACGTGCAAGGG - Intronic
985959886 5:3293446-3293468 GGGTGTGTGCGGGTGTGCAAAGG - Intergenic
985963944 5:3325250-3325272 GTGTGAGCGCGCGCGTGCGTGGG + Intergenic
985985552 5:3513069-3513091 CTGTGTGTGCGCGTGTGGAAGGG + Intergenic
986109795 5:4702224-4702246 GTGTGTGTGTGTGTGTGCTCAGG + Intergenic
986282742 5:6336900-6336922 GTGTGTGTGCACGTGTGTGCTGG - Intergenic
986412052 5:7490626-7490648 GTGTGTGCGTGTGTGTTTACTGG - Intronic
986499237 5:8381183-8381205 GTGTGGGTGAGTGTGTGCACGGG + Intergenic
986713915 5:10508731-10508753 GTGTGTGTGTGTGTGTGTACAGG - Intronic
986806327 5:11311886-11311908 GTGTGTGTGGGCGTGTGTATGGG - Intronic
986976028 5:13395018-13395040 GTGTGCACGCGCGCGCGCACTGG - Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
987397107 5:17434681-17434703 GTGTGTGTGTGTGTATGCACAGG - Intergenic
987901085 5:24013042-24013064 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
988391017 5:30631116-30631138 GTGTGTGTGTGTGTGTGAACTGG - Intergenic
989033993 5:37150509-37150531 GTGTGTGCGCGCGTGTGTGTTGG - Intronic
990189423 5:53241917-53241939 GTGTGTGTGTGTGTGTGCATAGG + Intergenic
990760811 5:59127484-59127506 GAGTGAGCGGGCGTGTGCACAGG + Intronic
990872591 5:60449066-60449088 GTGTGTGTGTGTGTGTGCGCGGG - Intronic
990944645 5:61237185-61237207 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
991502994 5:67295636-67295658 GTGTGTGTGTGTGCGTGCACGGG + Intergenic
991978779 5:72210479-72210501 GTGTGTGTGTGTGTGTGCATTGG + Intergenic
992005615 5:72474647-72474669 GTGTGTGTGTGTGTGTGCATGGG - Intronic
992247337 5:74839393-74839415 GTGTGTGCGCACGTGTGTGAAGG - Intronic
992672957 5:79077830-79077852 GTGTGTGTGGGCGTGTGGATGGG - Intronic
992680937 5:79152411-79152433 GTGTGTGTGTGTGTGTGCATGGG - Intronic
992866200 5:80960102-80960124 GTGTGCGAGCGCGTGTGAGCGGG + Intergenic
993107574 5:83616849-83616871 GTGTGTGTATTCGTGTGCACAGG + Intergenic
993134874 5:83947389-83947411 GTGTGTGTGTGTGTGTGCAGAGG + Intronic
993555195 5:89328316-89328338 GTGTGTGTGTGTGTGTGCATTGG - Intergenic
993589125 5:89772100-89772122 GTGTGTGCCTGTTTGTGCACAGG + Intergenic
993602266 5:89941892-89941914 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
993617911 5:90136157-90136179 GTGTGTGGACGAGTGAGCACAGG + Intergenic
993805151 5:92398224-92398246 GTGTGTGTGTGTGTGTGTACGGG - Intergenic
994314543 5:98317046-98317068 GTGTGTGCTCCCATGTGCCCTGG + Intergenic
994580094 5:101630761-101630783 GTGTGTGTACACGTTTGCACAGG + Intergenic
995106471 5:108381805-108381827 GTGTGTGCGTGTGTGTGCGCAGG - Exonic
995936151 5:117517521-117517543 GTGTGTGCGCCTGTGTGCAAAGG - Intergenic
997459874 5:134044655-134044677 GTGTGTGTGCGCGCGCGCACAGG + Intergenic
997725586 5:136117499-136117521 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
998966506 5:147546782-147546804 GTGTGTGCGTGTGTGTGTAAGGG - Intergenic
999445850 5:151638798-151638820 ATGTGTGGGTGGGTGTGCACAGG - Intergenic
999621377 5:153478084-153478106 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
1000253187 5:159514381-159514403 GTGTGTGTGCGTGTGTGTTCTGG - Intergenic
1000517809 5:162261177-162261199 GTGTGCACCCGCGCGTGCACGGG - Intergenic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1000665423 5:163989215-163989237 GTGTGCGCGCGCGTGTGGGGGGG + Intergenic
1001042679 5:168348254-168348276 GTGTGCACGGGTGTGTGCACAGG + Intronic
1001245729 5:170104852-170104874 GTGTGTGCGCGTGCGTGCGTGGG + Intergenic
1001443221 5:171762196-171762218 GTGTGTGCACACGTGTGTCCTGG - Intergenic
1001959900 5:175873276-175873298 GTGAGTGCGTGCGTGTGTGCAGG - Intronic
1002058834 5:176614168-176614190 GTGTGTGTGCGCGCGCGCAGGGG - Intergenic
1002095899 5:176830802-176830824 GTGTGTGCGTGTGTGTGCGCTGG + Intronic
1002167522 5:177357769-177357791 GTGTGTGCGCGTGTGTGTGTAGG + Intergenic
1002879823 6:1241528-1241550 GTGTGTGCGTGTGTGTGTCCTGG - Intergenic
1003162043 6:3644478-3644500 GTGTGTGTGCATGTGTGCCCTGG + Intergenic
1003680248 6:8245578-8245600 GTGTGTGAGTGTGTGTGCATTGG + Intergenic
1004281498 6:14283278-14283300 GTGTGTGTGTGTGTGTACACAGG - Intergenic
1004351960 6:14898005-14898027 GTGTGTGCGCGTGTGTGTGGTGG - Intergenic
1004580118 6:16942287-16942309 GTGTGTCTGTGTGTGTGCACAGG + Intergenic
1005306883 6:24522487-24522509 GTGTGTGTGTGTGTGTGTACAGG + Intronic
1005502402 6:26440810-26440832 GTGTGTGCGTGTGTGCGCATGGG + Intronic
1005795651 6:29359236-29359258 GTGTGTGTGGGCATGTGAACTGG - Intronic
1006173139 6:32106980-32107002 GTGTGTGCACGTGTGTGCATGGG - Intronic
1006458324 6:34144349-34144371 GTGTGTACGCGCGTGTGTGCTGG - Intronic
1007430328 6:41772764-41772786 GTGTGTGTGTGTGTGTACACTGG + Intronic
1007600574 6:43078255-43078277 GTGTGTGCGCGCGTGTGTGTGGG + Intronic
1010982677 6:82386988-82387010 GTGTGTGCGCGTGTGAGCATGGG + Intergenic
1011396632 6:86916925-86916947 GTGTGTGTGTGTGTGTGGACGGG - Intergenic
1011826390 6:91310399-91310421 GTGTGTGCGTGTGAGTGAACGGG + Intergenic
1011930036 6:92700614-92700636 GTGTGTGAGCGACTGAGCACAGG + Intergenic
1012886513 6:104852227-104852249 GTGCGCGCGTGCGCGTGCACGGG + Intronic
1012986351 6:105880414-105880436 GTGCGGGGGCGCGTGTGCTCCGG - Intergenic
1013401310 6:109799372-109799394 GTGTGCACGCACGTGTGCACAGG + Intronic
1014303214 6:119709585-119709607 GTGTGTGTGTGTGTGTGTACCGG - Intergenic
1014369799 6:120590445-120590467 GTGTGTGTGTGTGTGTGTACTGG - Intergenic
1014632355 6:123803245-123803267 GTGTGTGTGCGCGCGCGCTCGGG - Intergenic
1015576514 6:134677422-134677444 GTGTGTGCATGTGTGTGCATAGG - Intergenic
1015867762 6:137744404-137744426 GTGTGTGTGTGTGTGTGCACTGG - Intergenic
1016220142 6:141658318-141658340 GTGTGTGTGTGTGTGTGCATGGG - Intergenic
1016272572 6:142305425-142305447 GTGTGTGTGTGTGTGTGTACAGG - Intronic
1016672292 6:146722873-146722895 GTGTGTGCGTGTGTATGCAAGGG - Intronic
1016913196 6:149219326-149219348 GTGTGTGTGTGTGTGTGTACTGG + Intronic
1016976406 6:149813272-149813294 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
1016986041 6:149896650-149896672 GTGTGTGTGTGTGTGTGCATGGG + Intronic
1017175081 6:151494720-151494742 GTGTGTGTGCGCGCGCGCATTGG - Intronic
1017447391 6:154519261-154519283 ATGTGTGTGCGCGCGTGCGCAGG - Intergenic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1018240973 6:161774377-161774399 GTGTGTGTGTGTGTGTGCTCAGG - Intronic
1018730709 6:166648159-166648181 GTGTGTGAGCATGTGTGCATGGG - Intronic
1018906929 6:168080895-168080917 GTGTGGGCGCTGGTGTGTACAGG + Intronic
1018918569 6:168154637-168154659 GCGTGTGAGTGTGTGTGCACAGG + Intergenic
1019137380 6:169919048-169919070 GTGTGTGTGTGCGTGTGTGCAGG + Intergenic
1019139566 6:169934987-169935009 GAGTGTGCGAGTGTGTGCCCGGG - Intergenic
1019183281 6:170206160-170206182 GTGTGAGCACGTGTGTGCATGGG + Intergenic
1019275999 7:176054-176076 GTGTGTGTGTGCGTGTGCACAGG + Intergenic
1019352448 7:561269-561291 GTGTGTGTGTGTGTGTGCACAGG - Intronic
1019352978 7:563789-563811 GTGTGTACGTGTGTGTGCACAGG + Intronic
1019352991 7:563893-563915 ATGTGTGCACACGTGTGCATGGG + Intronic
1019560046 7:1651389-1651411 GTGTGTGCCCGTGTGTGCCTGGG - Intergenic
1019719985 7:2563395-2563417 GTGTGTGTGTGTGTGTGTACAGG + Intronic
1021044621 7:15907052-15907074 GTGTGTACGCACACGTGCACAGG - Intergenic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1021107627 7:16656542-16656564 GTGTGTGTGCGCGCGCGCGCTGG - Intronic
1021378947 7:19943124-19943146 GTGTGTGTGTGTGTGTGCATGGG + Intergenic
1021438388 7:20648513-20648535 GTGTGTGTGCGTGTGTGTAAAGG - Intronic
1021736977 7:23648998-23649020 GTGTGTGTGTGTGTGTGTACTGG + Intergenic
1021991231 7:26143239-26143261 GTGTGTGTGTGTGTGTGCAGAGG - Intergenic
1023081583 7:36531860-36531882 GTGTATGTGTGCGTGTGCACAGG + Intronic
1023615514 7:42015724-42015746 GTGTGTGTGCGTGTGTAAACTGG - Intronic
1023795539 7:43789032-43789054 GTGTGTGTGTGTGTGTGTACAGG - Intronic
1023986022 7:45096541-45096563 GTGTGTGTATGTGTGTGCACTGG - Intergenic
1024148786 7:46545380-46545402 GAGTGTGCACGTGTGTGCATTGG - Intergenic
1024752622 7:52486214-52486236 GTGTGTGTGTGCGTGTGTAGAGG - Intergenic
1024883767 7:54118105-54118127 GTGTGTGCGTGCATGTGTGCAGG - Intergenic
1026043692 7:66889913-66889935 GTGTGTGTGTGTGTGTGGACAGG + Intergenic
1026426433 7:70298933-70298955 GTGTGTGCACCCGTGTGGGCTGG - Intronic
1026572017 7:71539489-71539511 GTGTGTGCGTGCACGTGTACAGG + Intronic
1026678508 7:72447973-72447995 GTGTGTGTGTGTGTGTGCATGGG - Intergenic
1027638558 7:80705422-80705444 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
1028964412 7:96786318-96786340 GTGTGTGCGCGCGCACACACAGG + Intergenic
1029382177 7:100221385-100221407 GTGTGTGCGTGTGTGGGCACAGG + Exonic
1030115214 7:106057660-106057682 GGGTGTGTGCGTGTGTGCACGGG - Intergenic
1031989181 7:128185749-128185771 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032013413 7:128360972-128360994 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
1032064636 7:128757377-128757399 GTGTGTGTGTGTGTGTACACAGG + Intronic
1032216245 7:129959606-129959628 GTGTGTGTGTGTGTGTGTACGGG - Intergenic
1032496296 7:132365359-132365381 GTGCGTGCGCGCGCATGCATGGG + Intronic
1032651603 7:133884615-133884637 GTGTGTGCGCGCGTGTGTGATGG + Intronic
1033450545 7:141458863-141458885 GTGTGTGTGTGCGTGCGCACAGG - Intronic
1034526847 7:151669765-151669787 GTGCGTGCAAGTGTGTGCACAGG - Intronic
1034526848 7:151669791-151669813 GTGTGTGCAAGTGTGTGCACAGG - Intronic
1034526850 7:151669819-151669841 GTGTGTGCCTGCAGGTGCACAGG - Intronic
1035189698 7:157155182-157155204 GTGTGTGTGTGCGTGTGGAGGGG - Intronic
1035288318 7:157820627-157820649 GTGTGTGTGCACGTGTGTAGGGG - Intronic
1035368822 7:158365646-158365668 CTGTGTGTGTGCGTGTGCATTGG - Intronic
1035368838 7:158365756-158365778 GTGTGTATGCACGTGTGCACTGG - Intronic
1035368846 7:158365823-158365845 GTGTGTGTGCACGCATGCACTGG - Intronic
1035368855 7:158365886-158365908 GTGTGTGTGCACGCGTGCATTGG - Intronic
1035368874 7:158366058-158366080 GTGTGTGTGCACGCGTGCATTGG - Intronic
1037080187 8:14775485-14775507 GTGTGTGTGTGTGTGTACACAGG + Intronic
1037405170 8:18534792-18534814 GTGTGTGCGTGTGTGGGCATGGG - Exonic
1037579816 8:20238460-20238482 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
1037723124 8:21461502-21461524 GTGTGTGCGCACATGTGCATGGG - Intergenic
1038023091 8:23566483-23566505 GTGTGTGCGTGCGTGTGTCTGGG - Intronic
1038097887 8:24336044-24336066 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1038218321 8:25583810-25583832 GTGTGTGTGTGTGTGTGTACTGG + Intergenic
1038380021 8:27084225-27084247 GTGTGTGTGCATGTGTGCAAGGG - Intergenic
1038680259 8:29660379-29660401 GTGTGTGCACACGTGTGTATGGG - Intergenic
1039224288 8:35371171-35371193 GTGTGTGTGTGTGTGTGCAGTGG - Intronic
1039470201 8:37808572-37808594 GTGTGTGTGTGTGTGTGCATGGG + Intronic
1039550926 8:38442379-38442401 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1039778102 8:40756651-40756673 GTGTGTGTGTGTGTGTGTACTGG + Intronic
1039797887 8:40930969-40930991 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
1041392249 8:57357627-57357649 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
1041837857 8:62237138-62237160 GTGTGTGTGTGTGTGTTCACTGG - Intergenic
1042178568 8:66061627-66061649 GTGTGTGTGCGCGTGTATAAGGG + Intronic
1042344274 8:67711680-67711702 GTGTGTGTGTGTGTGTACACAGG - Intronic
1042588961 8:70376354-70376376 GTGTGTGCGTGTGTGTGTACTGG - Intronic
1043348771 8:79333365-79333387 GTGTGTGTGTGCATGCGCACGGG + Intergenic
1043707939 8:83377434-83377456 GTGTGTGAGTGAGTGAGCACAGG + Intergenic
1043919322 8:85963148-85963170 GTGTGTGTGTGTGTGTACACTGG + Intergenic
1044488667 8:92785610-92785632 GTGTGTGTGCGCGCGTGCATAGG - Intergenic
1044533601 8:93335656-93335678 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
1044661813 8:94598873-94598895 GTGTGTGTGCGCGTGCGCGCGGG + Intergenic
1044758627 8:95493156-95493178 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
1044945957 8:97390387-97390409 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
1045189521 8:99869043-99869065 GTGTGTGCATGCGGCTGCACGGG - Intronic
1045287780 8:100806878-100806900 GTGTGTGCGCGCGCACGCACAGG + Intergenic
1046209404 8:111048002-111048024 GTGTGTGTGTGCGTGCGCACTGG + Intergenic
1046603749 8:116347603-116347625 GTGTGTGTGTGTGTGTACACAGG - Intergenic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048865371 8:138757034-138757056 GTGTGTGTGCACGTGTGTGCAGG - Intronic
1048993387 8:139774378-139774400 GGGTGTGCGTGTGTCTGCACGGG + Intronic
1048995671 8:139792406-139792428 GCGTGTGCGCGTGTGTGCGTGGG + Intronic
1049197453 8:141323572-141323594 GTGTGTGTGTGCCTGTGCAGTGG - Intergenic
1049251155 8:141589763-141589785 GTGTGTGCACACGTGTGTACAGG + Intergenic
1049251905 8:141593726-141593748 GTGTGTGTGCATGTGTGCAGGGG + Intergenic
1049355897 8:142187892-142187914 GTGTGGGAGGGCGTGTGCACGGG - Intergenic
1049420970 8:142516477-142516499 GTGTGCGCGCGCGTGTGTGCGGG + Intronic
1049453561 8:142675572-142675594 GTGAGTGTGGGTGTGTGCACCGG - Intronic
1049462825 8:142738027-142738049 GTGTGTGCGCACGTGCACGCAGG + Intergenic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049623093 8:143607403-143607425 GTGAGTGCGTGCATGTGCATGGG - Intronic
1050091283 9:2017556-2017578 GTGTGTGCGCGCGCGAGCGGCGG + Intronic
1050187564 9:2991067-2991089 ATGTGTGCACCCGTGTGAACAGG - Intergenic
1050291839 9:4163222-4163244 GCATGTGCACGCATGTGCACTGG + Intronic
1050305242 9:4299629-4299651 GTGTGCGCGCGCGTCTGCGAGGG + Exonic
1050343834 9:4666531-4666553 GTGAGGGCGCGCGTCTGCGCTGG - Exonic
1050367116 9:4882842-4882864 GTGTGTGCATGTGTGTGCATAGG - Intronic
1050445789 9:5721435-5721457 GTGTGCACGCGCGTGTGTGCTGG - Intronic
1051027601 9:12631885-12631907 GTGTGTGTGTGTGTGTGCACGGG - Intergenic
1051087265 9:13364163-13364185 GTGTGTGTGCACGTGTAAACAGG + Intergenic
1051167268 9:14277316-14277338 GTGCGTGCACGTGTGTGCGCGGG - Intronic
1051752498 9:20357976-20357998 GTGTGTGTGTGTGTGTGCGCAGG - Intronic
1051892534 9:21957912-21957934 GTGCGTGCGTGTGTGTGTACTGG + Intronic
1051964109 9:22804663-22804685 GTGTGTGTGTGCGTGTGCGTGGG - Intergenic
1052041074 9:23739782-23739804 GTGTGTGCGTGTGTGTGTGCAGG - Intronic
1052051153 9:23850826-23850848 GTGTGTGCGCGCGAGTGACAGGG - Intergenic
1052200661 9:25775089-25775111 GTGTGTGTGTGTGTGTGTACTGG - Intergenic
1052243658 9:26306712-26306734 GTGTGTGCGTGCGTGTGTGTTGG - Intergenic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1055049756 9:71966590-71966612 TTGTGTGCATACGTGTGCACAGG + Intronic
1055332547 9:75198954-75198976 GTGTGTGTGTGTGTGTGTACGGG - Intergenic
1055850165 9:80617874-80617896 GTGTGTGTGTGTGTGTGCATGGG + Intergenic
1056280895 9:85040429-85040451 TTGTGTGTGTGCGTGTCCACAGG + Intergenic
1056537967 9:87547597-87547619 GTGTGTGTGCGTGTGTGTAGAGG + Intronic
1056687324 9:88777392-88777414 GTGTGTGTGTGCATGTGTACGGG + Intergenic
1056705406 9:88948381-88948403 ATGTGTGCACGCATGTGCATGGG + Intergenic
1057786059 9:98087992-98088014 GGGCGTGCGCGCGTCTGCAGGGG + Exonic
1058027048 9:100153015-100153037 GTGTGTGTGTGTGTGTGTACAGG + Intronic
1058454568 9:105127172-105127194 GTGTGTGTGTGCATGTGCAGGGG - Intergenic
1059602457 9:115794673-115794695 GTGTGTGTGTGTGTGTGTACTGG - Intergenic
1059652712 9:116330605-116330627 GTGTGTGCGTGTGTGTGTAGGGG + Intronic
1060378445 9:123140825-123140847 GTGTGTGCATGATTGTGCACAGG + Intronic
1060442157 9:123651375-123651397 GTGTGTACGTGCATGTGCTCAGG - Intronic
1060463867 9:123884982-123885004 GTGTGTGCGCGCGCGCTCGCAGG - Intronic
1060948589 9:127586240-127586262 GTGTGTGCGCTTGTGTGTGCGGG + Intergenic
1061206172 9:129164789-129164811 GTGTGTGTGTGTGTGTGTACTGG + Intergenic
1061330568 9:129889864-129889886 GTATGCGCACGCGTGTGTACTGG + Exonic
1061408274 9:130404639-130404661 GTGTGTGTACACGTGTGCACAGG + Intronic
1061521869 9:131123065-131123087 GTATGTGTGTGCGTGTGCATGGG + Exonic
1062022457 9:134326051-134326073 GTGTGTGCGCGAGTGTGTGGCGG + Intronic
1062187487 9:135225693-135225715 GTGTGTGAGCATGTGTGTACGGG - Intergenic
1062187498 9:135225927-135225949 GGGTGTGAGCATGTGTGCACGGG - Intergenic
1062198177 9:135286217-135286239 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198185 9:135286280-135286302 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198211 9:135286464-135286486 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062320518 9:135988563-135988585 GTGTGTGTGTCTGTGTGCACAGG + Intergenic
1062325560 9:136010925-136010947 GTGTGTGCGTGTGTGTGCAGGGG - Exonic
1062325562 9:136010927-136010949 GTGTGTGTGCGTGTGTGTGCAGG - Exonic
1062444160 9:136586469-136586491 GTGTGTGCCCGTGTGTGTAGAGG + Intergenic
1062609290 9:137366772-137366794 GTGTGTGTGAGCGTGAGCACTGG - Intronic
1203611111 Un_KI270749v1:5414-5436 GTGTGTGTGTGTGTGTGCATTGG + Intergenic
1185589818 X:1268537-1268559 GTGTGTGTGCACGTGTGTGCGGG + Intergenic
1185705305 X:2262367-2262389 GCGTGAGTGCTCGTGTGCACAGG - Intronic
1185759520 X:2679570-2679592 GTGTTTGTGTGTGTGTGCACAGG + Intergenic
1186490594 X:9969422-9969444 GTGTGTGCGCGCGTGCACTGGGG - Intergenic
1186490596 X:9969424-9969446 GTGTGTGTGCGCGCGTGCACTGG - Intergenic
1187082676 X:16007567-16007589 GTGTGTGTGTGTGTGTGCAAGGG + Intergenic
1187487990 X:19722548-19722570 GTGTGTGTGCGCGTGCGCACTGG + Intronic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1188195057 X:27222872-27222894 GTGTGTGAGCAAGTGTGCATGGG - Intergenic
1188536348 X:31201154-31201176 GTGTGTGTGTGTGTGTGTACAGG - Intronic
1188597812 X:31922522-31922544 GTGTGCGCGCGCGTGCGCTAGGG + Intronic
1188816940 X:34727018-34727040 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
1188923243 X:36005671-36005693 GTGTGTGCACATGTGTGCAATGG + Intergenic
1188996737 X:36895908-36895930 GTGTGTGTGTGTGTGTGTACGGG + Intergenic
1189492961 X:41483982-41484004 TTGTGTGCGTGTGTGTACACCGG + Intergenic
1189892625 X:45621077-45621099 GTGTGTGTGTGTGTGTGTACTGG - Intergenic
1190201419 X:48364838-48364860 GTGTGCGCTCGTGCGTGCACAGG - Intergenic
1191781005 X:64865371-64865393 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
1192148312 X:68696334-68696356 GTGTGTGCGCACGTGTGCATGGG + Intronic
1192244513 X:69361523-69361545 GTGTGTGTGTGTGCGTGCACAGG - Intergenic
1192436482 X:71146371-71146393 GTGTGTGTGCGTGTGTGTGCGGG + Intronic
1192483913 X:71508756-71508778 GTGTGTGCGCGCATATGCATAGG + Intronic
1192599840 X:72450377-72450399 GTGTGTGCCTGTGTGTGCATAGG - Intronic
1193441275 X:81542113-81542135 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
1194035534 X:88866236-88866258 GTGTGTGTGCGCGCGCGCAAAGG + Intergenic
1194102570 X:89724166-89724188 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
1194157437 X:90409427-90409449 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
1195117063 X:101709729-101709751 GTGTGTGCACACGTATGCATGGG + Intergenic
1195307805 X:103602981-103603003 GTGTGTGTGCACGTGTGCACTGG - Intergenic
1195328888 X:103780461-103780483 GTGTGTGTGCGCGTCTGAAGAGG + Intronic
1198676009 X:139131407-139131429 GTGTGTGTGTGTGTGTGCAAAGG + Intronic
1198843896 X:140888839-140888861 GTGCGTGCGCGTGTGTTTACAGG + Intergenic
1198999869 X:142622630-142622652 GTGTGTGTGTGTGTGTGCATGGG + Intergenic
1199737646 X:150698663-150698685 GTGTGCGCGCGCGTGTAGACAGG - Intronic
1200167339 X:154045930-154045952 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1200503770 Y:3986412-3986434 GTGTGTGTGTGTGTGTGTACAGG - Intergenic
1201233015 Y:11883797-11883819 GTGTGTGTGTGTGTGTGCATGGG - Intergenic
1201652692 Y:16307849-16307871 GTGTGTGTGTGTGTGTGTACAGG + Intergenic
1201892340 Y:18956268-18956290 GTGTGTGTGTGTGTGTGTACAGG - Intergenic