ID: 1096242677

View in Genome Browser
Species Human (GRCh38)
Location 12:49967674-49967696
Sequence GTGTGTGCGCGCGTGTGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1077
Summary {0: 1, 1: 1, 2: 21, 3: 160, 4: 894}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096242677_1096242679 -3 Left 1096242677 12:49967674-49967696 CCCGTGCACACGCGCGCACACAC 0: 1
1: 1
2: 21
3: 160
4: 894
Right 1096242679 12:49967694-49967716 CACACTGACCCCACACAGTCCGG 0: 1
1: 0
2: 1
3: 18
4: 158
1096242677_1096242684 6 Left 1096242677 12:49967674-49967696 CCCGTGCACACGCGCGCACACAC 0: 1
1: 1
2: 21
3: 160
4: 894
Right 1096242684 12:49967703-49967725 CCCACACAGTCCGGGGCTCGCGG 0: 1
1: 0
2: 0
3: 13
4: 165
1096242677_1096242680 -2 Left 1096242677 12:49967674-49967696 CCCGTGCACACGCGCGCACACAC 0: 1
1: 1
2: 21
3: 160
4: 894
Right 1096242680 12:49967695-49967717 ACACTGACCCCACACAGTCCGGG 0: 1
1: 0
2: 1
3: 15
4: 405
1096242677_1096242681 -1 Left 1096242677 12:49967674-49967696 CCCGTGCACACGCGCGCACACAC 0: 1
1: 1
2: 21
3: 160
4: 894
Right 1096242681 12:49967696-49967718 CACTGACCCCACACAGTCCGGGG 0: 1
1: 0
2: 2
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096242677 Original CRISPR GTGTGTGCGCGCGTGTGCAC GGG (reversed) Intronic