ID: 1096243747

View in Genome Browser
Species Human (GRCh38)
Location 12:49973248-49973270
Sequence GGCGCTGTTTGCAGAGTTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096243742_1096243747 17 Left 1096243742 12:49973208-49973230 CCAGCATGTTGGCGTGCAGGCTT 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1096243747 12:49973248-49973270 GGCGCTGTTTGCAGAGTTCCTGG 0: 1
1: 0
2: 3
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096243747 Original CRISPR GGCGCTGTTTGCAGAGTTCC TGG Exonic
900531564 1:3156225-3156247 GGGGCTGTCTGCAGGGCTCCCGG + Intronic
901023315 1:6266057-6266079 GGCGCTCCTTGCAGCGGTCCTGG + Intronic
903293518 1:22329372-22329394 GGCACTGTGTGCAGAGGCCCTGG - Intergenic
904324169 1:29716952-29716974 GGCGCTGCTTGAACAGTTACTGG + Intergenic
904743318 1:32695275-32695297 GGCTCAGTTTGCCGATTTCCGGG - Exonic
907480743 1:54744059-54744081 GGAGCTAGCTGCAGAGTTCCTGG + Intergenic
907515236 1:54989608-54989630 TGCCCTGCTTGCTGAGTTCCTGG + Intronic
907736419 1:57116960-57116982 GACAATGTTTGCAGAGTGCCGGG - Intronic
909549552 1:76882585-76882607 GGAGGTGTCTGTAGAGTTCCTGG + Intronic
912502194 1:110130005-110130027 GGCGGTGTTTGCAGATGTTCTGG + Intergenic
916194946 1:162213767-162213789 GGCGCCTTCTCCAGAGTTCCAGG - Intronic
917809797 1:178647182-178647204 GGTGGTGCTTGCAGAGGTCCTGG - Intergenic
920917626 1:210270772-210270794 GACTCTGCTTGCAGAGCTCCTGG + Intergenic
921488803 1:215748531-215748553 GGCTCTGTTTTCAGACCTCCTGG + Intronic
922809816 1:228409201-228409223 AGGACTGTGTGCAGAGTTCCCGG - Exonic
1064756450 10:18575895-18575917 GGCGCTGTCCTTAGAGTTCCGGG + Intronic
1070026479 10:72636792-72636814 GGCACTGATTGCAGAGATGCAGG + Intergenic
1072331431 10:94357248-94357270 GGTGCAGTTTGCAGAGTTCTTGG + Exonic
1075463387 10:122633254-122633276 GGCATTGTTTGGATAGTTCCCGG - Exonic
1077392002 11:2304532-2304554 GGAGCTGTTTCCAAAGTCCCTGG + Intronic
1082986067 11:59172288-59172310 GGGCCTGTTTGCAGAGAGCCGGG + Intronic
1083332366 11:61904852-61904874 AATCCTGTTTGCAGAGTTCCAGG - Exonic
1084707330 11:70823000-70823022 GGTGATGTTGGCAGAGTTCATGG + Intronic
1084712604 11:70853200-70853222 GGCTCTGTTTCCAGAGCTCACGG - Intronic
1096239262 12:49950863-49950885 GGCTGTGTTCGCAGAGTTCCTGG + Exonic
1096241418 12:49962053-49962075 GGCCGTGTTCGCAGAGTTCTTGG + Exonic
1096243747 12:49973248-49973270 GGCGCTGTTTGCAGAGTTCCTGG + Exonic
1096782454 12:53999109-53999131 GGCTCTGTCTGCAGAGAGCCAGG - Intronic
1098689187 12:73465404-73465426 GCCTCAGCTTGCAGAGTTCCAGG - Intergenic
1101921841 12:108939310-108939332 GGGGCTGTTTTCAGAGTTCCAGG + Intronic
1111150634 13:84249646-84249668 GCCCCTGTTTGCAGAGTGCACGG - Intergenic
1112853356 13:103734289-103734311 GTCACTCTCTGCAGAGTTCCAGG + Intergenic
1113462513 13:110492002-110492024 GGCGCTGTGTGGTGAGGTCCTGG - Intronic
1113599090 13:111555436-111555458 GGCACTGTTGGCAGAGTTCCTGG + Intergenic
1115530115 14:34319239-34319261 GGTGCTGTTTGCTGAGGTTCTGG + Intronic
1120215211 14:81674734-81674756 ACAGCTGTTTGCAGAGTTCCTGG - Intergenic
1122635485 14:103127731-103127753 GTCGGTGTTTGCAGAGTTTTGGG + Intronic
1128847967 15:70918068-70918090 GAAGCTGCTTGCAGTGTTCCTGG + Intronic
1129112405 15:73345136-73345158 GCCCCTGCCTGCAGAGTTCCAGG + Intronic
1129905632 15:79185333-79185355 GTGGAGGTTTGCAGAGTTCCAGG - Intergenic
1130876242 15:88017294-88017316 GGAGCTGTATGAAGGGTTCCTGG - Intronic
1131140436 15:89972716-89972738 GGCCCAGTGGGCAGAGTTCCAGG - Intergenic
1131389303 15:92034149-92034171 GGGGCTGTATGCAGGGATCCAGG + Intronic
1132631057 16:917681-917703 GGGGCTGTTTGCAGGGGTGCTGG + Intronic
1133492860 16:6288034-6288056 AGCCATGTTAGCAGAGTTCCAGG - Intronic
1138471518 16:57241963-57241985 GGTGCCATTTGCAGAGTGCCAGG + Intergenic
1139945125 16:70635590-70635612 GGAGCTGTTTCCAGTGTTCAAGG + Intronic
1143156201 17:4838168-4838190 GGGGCTGTTTGGAGAGCTCGAGG + Intronic
1145214910 17:21043593-21043615 GGAGCTGTTTGCAGGGCCCCCGG + Intronic
1150343983 17:64389977-64389999 GGCGGAGTTTGCAGAGAGCCGGG + Intronic
1150587094 17:66528616-66528638 GGAGGTGCTCGCAGAGTTCCGGG - Intronic
1153932297 18:9888835-9888857 TGCCCTGATGGCAGAGTTCCTGG + Intronic
1158427723 18:57353762-57353784 GGCCCTGCTGGGAGAGTTCCCGG - Intronic
1159255328 18:65937686-65937708 CCTACTGTTTGCAGAGTTCCAGG + Intergenic
1160513633 18:79466510-79466532 GGCGCTGTTCGCAGAGGTCGGGG - Intronic
1161312839 19:3604339-3604361 GGCGCTGTTTCCAGAGGCCCGGG + Intronic
1162044713 19:7990944-7990966 GTAGGTGTTTGCAGAGGTCCTGG - Intronic
1164025063 19:21344370-21344392 GGCGCTGTTTGAACAGTCACTGG + Intergenic
1164929779 19:32166509-32166531 GTCCCTGCTGGCAGAGTTCCAGG + Intergenic
1167211268 19:48135627-48135649 GGGGCTGTGGGCAGAGTGCCAGG - Intronic
1168036685 19:53725334-53725356 GGCCCTGTTTGCACATTTTCTGG - Intergenic
1168038129 19:53736736-53736758 GGCCCTGTTTGCATGTTTCCTGG - Intergenic
1168038918 19:53742405-53742427 GGCCCTGTTTGCATATTTTCTGG - Intergenic
926278538 2:11425209-11425231 GGTGGTGTTTGTACAGTTCCAGG - Intergenic
929532813 2:42763171-42763193 AGAGCTGTGTGCAGAGGTCCAGG + Exonic
934740034 2:96713622-96713644 GGAGCTGTTTCCTGAGATCCTGG - Intronic
935026958 2:99286130-99286152 GGGACTCTTTGCAGAGTCCCAGG - Intronic
937062650 2:118991951-118991973 GGCGCTGTTTTAAGAGTTCTGGG + Intronic
938953372 2:136277627-136277649 GGCCCTGTTTGAGGAGTTTCTGG - Intergenic
945914946 2:215693645-215693667 GGAGCTGTTTGCAGACCTCTGGG + Intergenic
946642700 2:221801531-221801553 GAAGCTGTTTGCCCAGTTCCTGG - Intergenic
947059298 2:226144636-226144658 GGAGCTGTTTCCAGTGTGCCAGG - Intergenic
947461462 2:230307552-230307574 GAAGCTGTTTGCAGTGTGCCTGG + Intronic
948781107 2:240322470-240322492 GGTCCTGTCTTCAGAGTTCCCGG + Intergenic
948806279 2:240454590-240454612 AGGGCTGTGTGCAGAGCTCCAGG - Intronic
948931439 2:241134904-241134926 GGCCCTGGAGGCAGAGTTCCGGG + Intronic
1169171096 20:3466174-3466196 TGAGCTGTTGGCAGAGCTCCTGG - Intergenic
1169328686 20:4699274-4699296 GGCGCTTCTTGCAGAGGCCCAGG - Exonic
1171217549 20:23362862-23362884 GGCCCTGTTGGCAGAGGTCTGGG + Intronic
1171259756 20:23722155-23722177 GGCTCTGTTGGCTGGGTTCCAGG + Intergenic
1173380461 20:42535087-42535109 GGCGCTGTTACCAAAGTCCCTGG + Intronic
1173579076 20:44133195-44133217 GGTGCTGTTTGCAGAGATGTGGG - Intronic
1174610025 20:51791144-51791166 CCAGCTGTTTGCCGAGTTCCAGG - Exonic
1175445912 20:59019169-59019191 GGCACTGTTTGCAGGCTTCTAGG - Intergenic
1180098863 21:45574971-45574993 GGCACTGTTTGGAGAGTCGCAGG + Intergenic
1180731443 22:17985344-17985366 GGCTCTGTTCTCAGAGTTCACGG - Intronic
1181044631 22:20208720-20208742 GGCCCTGTGTGCAGAAGTCCGGG + Intergenic
1184670747 22:46011341-46011363 GGCGCTGTTTGCTCAGTGCCCGG - Intergenic
1184931316 22:47683232-47683254 GGCTCTGTTTGCAGCGTCCTGGG - Intergenic
949512988 3:4782897-4782919 GACCCAGTGTGCAGAGTTCCAGG + Intronic
949614058 3:5734507-5734529 GTCACTGTTTGCAGAGTACTAGG - Intergenic
950624485 3:14234783-14234805 GGCCCTCTTTGCAGAGTCTCTGG + Intergenic
954129429 3:48552587-48552609 TGCATTGTTTGCATAGTTCCCGG + Intronic
965401375 3:168216966-168216988 GTCTCTGTTTGGAGAGTCCCTGG + Intergenic
968972111 4:3801416-3801438 GGCCCCGTGTGCCGAGTTCCAGG + Intergenic
973604065 4:52569654-52569676 GGCTCTGGTTGCAGACTGCCTGG + Intergenic
974635866 4:64563508-64563530 GGCGCTGCTTGAACAGTCCCTGG - Intergenic
979741750 4:124159609-124159631 GACGGTGTGTGCAGAGTGCCTGG - Intergenic
993693591 5:91033592-91033614 GGCCCTGTTTGCACATTGCCAGG - Intronic
995344175 5:111092489-111092511 CGCGCTTTTTGCGGGGTTCCGGG + Exonic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
999060098 5:148624587-148624609 GGTGCTGTTTGCAGATTTCCTGG - Intronic
1003461420 6:6332210-6332232 GACAGTGTTTGCAGAGTTGCTGG + Intergenic
1003832830 6:10033369-10033391 GGAGCTGTTGCAAGAGTTCCTGG + Intronic
1006801839 6:36764799-36764821 GGAGCTGTTTGCAGAGAGCCAGG - Intronic
1007333822 6:41136764-41136786 GGAGCTGTTAACAAAGTTCCTGG - Intergenic
1009823621 6:68838106-68838128 GTAGCAGTTGGCAGAGTTCCTGG - Intronic
1011636762 6:89381908-89381930 GATGCTGTTTACAGACTTCCAGG - Intronic
1015094015 6:129393075-129393097 GAAGCTGTTTGGAGAGTCCCGGG + Exonic
1018236547 6:161731204-161731226 GGAGCTGTATGCAGGGTTACAGG + Intronic
1019480563 7:1264810-1264832 GGGGCTGCTGGGAGAGTTCCAGG - Intergenic
1019885675 7:3902761-3902783 AGAGCTGTTTTCAAAGTTCCTGG + Intronic
1020260227 7:6526810-6526832 GCCGCGGTTTGCAGAGATCCGGG - Intronic
1026165489 7:67905609-67905631 TGAGCTTTTTGCAGACTTCCAGG - Intergenic
1026941798 7:74291319-74291341 GGCTCTGAGTGCAGAATTCCAGG - Intronic
1033858787 7:145599178-145599200 AGCGTTGTTTGGACAGTTCCAGG - Intergenic
1035630410 8:1103232-1103254 GGGGGTGTTTGGAGACTTCCAGG + Intergenic
1038985552 8:32805348-32805370 GGCGCTGTGAGCAAAGATCCTGG - Intergenic
1039510196 8:38085750-38085772 GGCCCTGTTTCCTGAATTCCTGG + Intergenic
1048996929 8:139800296-139800318 GGCCCTGTTGGCTGAGTTCTTGG - Intronic
1049774969 8:144399952-144399974 GGCGGTGTGGGCAGAGTTCATGG + Intronic
1052952444 9:34223846-34223868 GGCTCTTTTTGCTGAGTTCCTGG + Intronic
1062495445 9:136829407-136829429 GGCCCTGGATGCTGAGTTCCTGG + Exonic
1203784901 EBV:122196-122218 GCAGCTCTTTGCAGAGTACCGGG - Intergenic
1203569174 Un_KI270744v1:115746-115768 GGCGTTGTTTGGAGAGTAGCTGG + Intergenic
1203570123 Un_KI270744v1:122035-122057 GGCGTTGTTTGGAGAGTAGCTGG + Intergenic
1187416395 X:19096952-19096974 GGAGCAATTTGCAGAGTGCCTGG - Intronic
1189294844 X:39910841-39910863 AGCGCTGTGTGCAGAGCTGCAGG + Intergenic
1192210182 X:69123028-69123050 GCCCCTGTTTACAGAGTTCAAGG + Intergenic
1194973655 X:100371769-100371791 GGAGCTGTTTTCAGGGTTCCAGG - Intronic
1195178907 X:102338361-102338383 GAGGCTGCTTGCAGTGTTCCTGG - Intergenic