ID: 1096243747

View in Genome Browser
Species Human (GRCh38)
Location 12:49973248-49973270
Sequence GGCGCTGTTTGCAGAGTTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096243742_1096243747 17 Left 1096243742 12:49973208-49973230 CCAGCATGTTGGCGTGCAGGCTT 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1096243747 12:49973248-49973270 GGCGCTGTTTGCAGAGTTCCTGG 0: 1
1: 0
2: 3
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096243747 Original CRISPR GGCGCTGTTTGCAGAGTTCC TGG Exonic