ID: 1096246542

View in Genome Browser
Species Human (GRCh38)
Location 12:49992228-49992250
Sequence CACACGCACCTGCCTACCTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096246542 Original CRISPR CACACGCACCTGCCTACCTT GGG Exonic
902929069 1:19717612-19717634 CACATGCACCTTCCTGCCTCTGG + Intronic
903686147 1:25133474-25133496 CACACAAACCTGTCTACATTGGG - Intergenic
907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG + Intergenic
915466620 1:156102161-156102183 CACAGGCACATTCCTCCCTTTGG - Intronic
916215689 1:162391099-162391121 GCCAGGCACCTGCCTACCTCTGG + Intergenic
917494769 1:175530333-175530355 CACACACACCCGCCTCTCTTTGG + Intronic
919766896 1:201133343-201133365 TACACCCACCTGCCCACCTTTGG + Intergenic
923475136 1:234324947-234324969 CACAGCCGCCTGCCTGCCTTGGG + Intergenic
1064274115 10:13891386-13891408 CACACACACCTACTTTCCTTGGG - Intronic
1065013689 10:21442239-21442261 CTCAAGCATCTGCCTACCTCGGG - Intergenic
1068351012 10:55845392-55845414 CACATGCTCCTGCATACTTTGGG - Intergenic
1069778063 10:70938247-70938269 CTCACTCACCTGCCCACCTGAGG - Intergenic
1071576994 10:86734752-86734774 CACAGGGCCCTTCCTACCTTTGG + Exonic
1072551092 10:96478199-96478221 CACTCCCATCTGCCAACCTTGGG + Intronic
1075118940 10:119650886-119650908 CAAACTCACCTGCCTTCCTTTGG - Intergenic
1075335447 10:121605938-121605960 CACAAACACATTCCTACCTTTGG + Intergenic
1076320679 10:129579321-129579343 CACCTGTACCTGCCTACCTGTGG + Intronic
1077052055 11:571403-571425 CACAGACACCTGCCTTCCCTAGG + Intergenic
1079469598 11:20765632-20765654 CACAAGCTCCTTCCTGCCTTAGG - Intronic
1080581834 11:33650749-33650771 CACACGCACCTGCCCCTCTCCGG + Intronic
1082928775 11:58578709-58578731 CGCGCGCACCTGCCTCCCTGAGG - Intergenic
1084432824 11:69121215-69121237 CACACGCCCCTGTGTGCCTTTGG + Intergenic
1085444794 11:76593142-76593164 CACAGGCACCTCTTTACCTTGGG + Intergenic
1088769806 11:113022700-113022722 CCTACGTACCTGCCTGCCTTTGG - Intronic
1089973462 11:122712678-122712700 CACAGGTACCTTCCTACCTGTGG + Intronic
1091218133 11:133916078-133916100 CAGACCCACCTGCCTCCCTGCGG + Intronic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1099932053 12:89086252-89086274 CTCAAGCACCTGTCTACCATGGG - Intergenic
1099973734 12:89525510-89525532 TCCTCGCACCTGCCTGCCTTGGG - Intronic
1101717236 12:107321269-107321291 CACACGCACATGCACACCCTTGG - Intronic
1104813609 12:131633479-131633501 CACACCCACCTGCATCTCTTGGG + Intergenic
1107445950 13:40470555-40470577 CACAGTCACCTGCCTTCCTTGGG - Intergenic
1107980475 13:45729964-45729986 CAGCCCCACCTGCCTACATTGGG - Intergenic
1108243363 13:48490514-48490536 CACACTCACATGCCTATCTCTGG - Intronic
1110302007 13:73939681-73939703 CACAGGAGCCTGCCTGCCTTTGG - Intronic
1113572107 13:111365477-111365499 CACACTCACATGCCTGCCCTGGG - Intergenic
1114616581 14:24071760-24071782 CACAAGCCCCTGCCTATCTCGGG + Intronic
1118785071 14:69038840-69038862 CACGAGCACATGCCTACCATGGG - Intergenic
1119706227 14:76784287-76784309 AGCACGCACCTGCCTAATTTAGG + Intergenic
1120722423 14:87903583-87903605 CCCAGGCACCTTCCTTCCTTAGG - Intronic
1122905478 14:104799825-104799847 AACACGTTCCTGCCTACCCTGGG + Intergenic
1123004935 14:105316587-105316609 CACACGCCCCCACCTCCCTTGGG - Intronic
1123995689 15:25716405-25716427 CACACCCACCTGCCTACCTGAGG + Intronic
1125107246 15:35986520-35986542 CACACGCAAAAGCCTACCTCGGG + Intergenic
1127774660 15:62255471-62255493 CACACGCTCCTGGCCACCTGGGG + Intergenic
1130770557 15:86919605-86919627 CACACACACCCGACTACCTAAGG + Intronic
1130932852 15:88442746-88442768 CACACACACCTGGCAACCTCAGG + Intergenic
1132282377 15:100631371-100631393 CACACAGATCTGCCTGCCTTGGG + Intronic
1134274751 16:12766146-12766168 CACCCGCCTCTGCCTCCCTTTGG - Intronic
1136630825 16:31488403-31488425 CACACGCGCCTGCACACCTCAGG - Exonic
1141280100 16:82623595-82623617 CAGACGCATCAGCCTAGCTTTGG - Intergenic
1141797615 16:86285685-86285707 CACAGGTACCTGCCTCCCTCCGG - Intergenic
1147129106 17:38395624-38395646 CACACACACCTTCCTCCCTCTGG - Intronic
1148538045 17:48457136-48457158 CCCACTCAACTGCCTACCTCAGG + Intergenic
1148863616 17:50617584-50617606 CCCACGCACCTGCCCTCCTAGGG + Intronic
1150751849 17:67871115-67871137 CACACACACGTGTCTACTTTAGG + Intronic
1151758887 17:76089689-76089711 CACAGCCACCTGCCCACCCTGGG - Intronic
1152526212 17:80889650-80889672 CACACGCACTGGCCTTCTTTAGG - Intronic
1162323639 19:9985825-9985847 CACCCCCAGCTTCCTACCTTAGG + Exonic
1163148500 19:15398170-15398192 CACACGCTCCTGCCCAGCCTTGG - Intronic
1163591192 19:18194952-18194974 CACACGCACCAGTCTGCCTGCGG - Exonic
1168234585 19:55054085-55054107 CACCTGCACCTGCCTCCCTAGGG + Intronic
925415635 2:3668333-3668355 CACAAGCACCTCCCTCACTTAGG - Intronic
930214516 2:48680870-48680892 CTCATGCAGCTGCCTACTTTAGG - Intronic
932017273 2:68043939-68043961 CACACACACCAACCTGCCTTGGG + Intronic
932706666 2:74031282-74031304 CCCACTCACCTGCCCACCCTGGG - Intronic
933727165 2:85433549-85433571 CACACACCCCTCCCTACCTTAGG + Intronic
1171029630 20:21665706-21665728 CACACACACTTCACTACCTTTGG + Intergenic
1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG + Intronic
1173879996 20:46405390-46405412 CCCAAGCTCCTGCCTTCCTTGGG - Intronic
1176570069 21:8405561-8405583 CACACACACATACCTACCTACGG - Intergenic
1176577980 21:8449768-8449790 CACACACACATACCTACCTACGG - Intergenic
1179033705 21:37741983-37742005 CTCACTCCCCTGCCTGCCTTTGG - Intronic
1181142533 22:20816972-20816994 CACTGCCACCTGCCTGCCTTTGG - Intronic
1182013028 22:27016404-27016426 CACAGGCAGCTGCCTACTTGGGG - Intergenic
1182108749 22:27707721-27707743 CGAACCCACCTGCCTGCCTTCGG + Intergenic
1182325799 22:29511824-29511846 CAGACCTACTTGCCTACCTTGGG - Intronic
1183710677 22:39501715-39501737 CACACTCACGTGCCTTCTTTGGG - Intronic
1203256185 22_KI270733v1_random:139519-139541 CACACACACATACCTACCTACGG - Intergenic
950722852 3:14897319-14897341 CACATGCACCTGGCGACCATAGG - Intronic
954146105 3:48635108-48635130 CGCACGCAGCTGCCTCCCTGTGG + Intronic
955353083 3:58208446-58208468 CAAAAGCACCTACCTACCTCAGG - Intronic
956082360 3:65571148-65571170 CAAATGCACCTGCCTGCATTAGG + Intronic
956670213 3:71682119-71682141 CACAGGCACTTGCCTACATTGGG - Exonic
961530134 3:127535651-127535673 CACAGCCACCTTCCTCCCTTTGG + Intergenic
968443101 4:634367-634389 CTCACGCACCTGCCGCCCTCCGG - Intronic
968909024 4:3467213-3467235 CACATGCCCCTGCCTTCCCTGGG + Intronic
973229439 4:47824905-47824927 CACACTCAGCTGCCCACGTTGGG - Intronic
985665283 5:1178911-1178933 CACCCCCACCTGCCATCCTTGGG + Intergenic
986255633 5:6100567-6100589 CACATGGACCTCCCCACCTTAGG + Intergenic
986255844 5:6101211-6101233 CACATGGACCTCCCCACCTTAGG + Intergenic
988192753 5:27961026-27961048 CACCCGCTCCTGCATAACTTTGG - Intergenic
988801930 5:34704077-34704099 CAAAAGCACCTTCCCACCTTAGG + Intronic
990517503 5:56544066-56544088 CACACACACCAGCCTCACTTGGG + Intronic
993458661 5:88156377-88156399 CACACACACATCCCTACCTTCGG - Intergenic
1002270845 5:178070951-178070973 CACATGCACCTGCAGACCCTGGG + Intergenic
1009042423 6:58194885-58194907 TACACAAACCTGCCTAGCTTTGG + Intergenic
1018484685 6:164228847-164228869 CTCAGGCTCCTTCCTACCTTTGG + Intergenic
1019183818 6:170209385-170209407 CACAGGCACCTGCATACAATTGG + Intergenic
1019379463 7:713293-713315 CACACTCACCTGTCTACCCCCGG + Intronic
1019935000 7:4249077-4249099 CACACTCACCTCCCTCCCTGAGG - Intronic
1022194394 7:28049980-28050002 CAGCCGCACCTGCCAGCCTTAGG - Intronic
1022517853 7:30987240-30987262 CACACCCACCTGCCAGCCTCTGG - Intronic
1032430143 7:131854368-131854390 CCCTCCCACCTGCCTTCCTTGGG - Intergenic
1034417769 7:150974290-150974312 CACAGGCCCCTATCTACCTTAGG - Intronic
1036604438 8:10293263-10293285 CCCACGCACCTGGCCACCATGGG - Intronic
1037405975 8:18542938-18542960 CACACTCAGCTTCCTTCCTTAGG + Intronic
1045002216 8:97888263-97888285 CACCCCCACCTGCCCACTTTTGG - Intronic
1046461303 8:114540793-114540815 CACACACACATGCCAGCCTTAGG - Intergenic
1049615191 8:143572852-143572874 CACACGGACGTGCCTACAATGGG + Exonic
1049908834 9:245639-245661 CACACCCTACTGCCTACCATAGG + Intronic
1053284640 9:36842295-36842317 CACACACACCCGCCTTCCTCTGG - Intronic
1053293982 9:36900220-36900242 CACACGCACGTGTCTACTTGGGG - Intronic
1060359592 9:122941858-122941880 TTCACGCATCTGCATACCTTTGG + Intronic
1060662870 9:125414540-125414562 CACACCCTCCTGCCCACCGTAGG - Intergenic
1061301653 9:129709176-129709198 CACAAGCACCTTCCCACCTCTGG - Intronic
1061327647 9:129873989-129874011 CCCACACACCTGCCTCCCATTGG - Intronic
1061788369 9:133044588-133044610 CACACTCACCTGCCAAGCCTTGG + Intronic
1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG + Intronic
1203472341 Un_GL000220v1:121226-121248 CACACACACATACCTACCTACGG - Intergenic
1192436715 X:71147795-71147817 CACAGGCTCCTGCCAACCGTGGG - Exonic
1193629511 X:83865277-83865299 CACACGCACCAACATAGCTTTGG + Intronic
1196409698 X:115402525-115402547 CACCAGCAACCGCCTACCTTTGG + Intergenic
1199671551 X:150152200-150152222 GACTCCCACCTGCCTAACTTTGG - Intergenic
1199979707 X:152914230-152914252 CACACCCACCTGCCTGCCCAGGG - Intergenic