ID: 1096250067

View in Genome Browser
Species Human (GRCh38)
Location 12:50025299-50025321
Sequence CGTGGCCGCCGCGGGGGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096250067_1096250076 19 Left 1096250067 12:50025299-50025321 CCCGGACCCCCGCGGCGGCCACG 0: 1
1: 0
2: 1
3: 29
4: 257
Right 1096250076 12:50025341-50025363 TGCTTCCTATCACAATCCAGCGG 0: 1
1: 0
2: 0
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096250067 Original CRISPR CGTGGCCGCCGCGGGGGTCC GGG (reversed) Intronic
900097037 1:944020-944042 CGTGGCCGTCGTGGGGGACAAGG - Exonic
900269172 1:1778418-1778440 CGGCGCCGGCGCCGGGGTCCGGG - Intronic
900283917 1:1890505-1890527 CGTGGCGGCGGCCGGGGCCCCGG - Intronic
900326357 1:2110426-2110448 CGTGGCAGCCCCGTGGCTCCTGG + Intronic
901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG + Intronic
902823184 1:18955963-18955985 CGTGCCCGCCGCCGGGCGCCGGG + Exonic
903069102 1:20717828-20717850 CGGGGCCGCGGCGGGGGGCGGGG + Exonic
903468473 1:23568472-23568494 CGCTGGGGCCGCGGGGGTCCGGG - Intergenic
903855686 1:26336580-26336602 CGTGCCGGCCGCGGGGGGCGGGG - Intronic
904034116 1:27549976-27549998 CGTGGCAGCCGCTGGGGTCGGGG - Exonic
904050167 1:27634157-27634179 CTGGGCCGCCGCGGGGCTCCGGG - Intronic
904285115 1:29449062-29449084 CGTGTCTGCCACGTGGGTCCTGG - Intergenic
904420218 1:30386319-30386341 CGTGTCTGCCACGTGGGTCCTGG + Intergenic
905206145 1:36343888-36343910 CCTGGCCGCCGCCGACGTCCTGG - Exonic
905886915 1:41496559-41496581 CAGGGCCCCCGCAGGGGTCCGGG - Intergenic
907364169 1:53945976-53945998 CGAGGCCGCCGCGAGGGGGCGGG - Intergenic
908401322 1:63774700-63774722 CCGGCCCGCCGCGGGGCTCCGGG - Intronic
910892312 1:92030349-92030371 CGTGACCGCCGCGAGGGTGGGGG + Intronic
913215135 1:116613837-116613859 CGAGGCCGCCGAGTGGATCCAGG - Exonic
913592332 1:120341457-120341479 CGTGGCCCGAGCGGGGGTCTAGG - Intergenic
913651027 1:120913688-120913710 CGTGGCCCGAGCGGGGGTCTAGG + Intergenic
914170087 1:145215379-145215401 CGTGGCCCGAGCGGGGGTCTAGG - Intergenic
914598472 1:149176488-149176510 CGTGGCCCGAGCGGGGGTCTAGG + Intergenic
914641198 1:149607792-149607814 CGTGGCCCGAGCGGGGGTCTAGG + Intergenic
916963865 1:169915330-169915352 CATGGGAGCCGCGGGGGTCCCGG - Intergenic
917256880 1:173125098-173125120 CGTGGCTGTCACGGGGGTCAGGG - Intergenic
920367617 1:205456398-205456420 CGTGGGCGCCGCGCCGGTGCCGG + Intergenic
922536268 1:226383091-226383113 CGTGGCCGCCACGGAGGCGCTGG + Exonic
922739438 1:228007062-228007084 CGTGAGCGCCGGGGGGGGCCGGG - Exonic
923506230 1:234608948-234608970 CGTGGCCGCGCCGCGGGTTCGGG + Exonic
924610159 1:245567062-245567084 CTTGGCCGCGGCTGGGGTGCAGG - Intronic
1062860221 10:804890-804912 CGTGGCCGCAGCCAGGGTTCAGG - Intergenic
1063662781 10:8045398-8045420 TGTGGCCGCCGCTGCCGTCCTGG - Intergenic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1067710958 10:48650917-48650939 CGAGGCCGGCCCAGGGGTCCTGG + Intronic
1067778369 10:49179023-49179045 CTTGGCTGCAGCTGGGGTCCAGG + Intronic
1070305348 10:75235880-75235902 CGTGCCCGCCGCGCTGGCCCTGG - Exonic
1072169926 10:92848905-92848927 CGGGGCCGCAGCGCGGGGCCCGG - Intronic
1073048622 10:100654234-100654256 GGTGGGAGCCGCGGGGGGCCGGG - Intergenic
1075334351 10:121597894-121597916 CGTGGGCGCCACGGGAGCCCGGG - Intronic
1076680377 10:132168591-132168613 CGTGGCCGCCGCGGGCCGCGTGG + Exonic
1076734697 10:132453341-132453363 CGTGGCCGCGGGGCGGGGCCCGG + Intergenic
1076781869 10:132728951-132728973 CTTGGCAGGCGTGGGGGTCCTGG + Intronic
1076885806 10:133261884-133261906 CGTGGAGGCCGCGCGGGGCCGGG + Intergenic
1079459758 11:20669465-20669487 CGCAGCCGCAGCGGGGGGCCGGG + Intergenic
1082807645 11:57460766-57460788 CGGGGACCCCGCGGGGCTCCGGG - Exonic
1083265763 11:61546209-61546231 AGTGGCCGCCGCGGCGGGGCTGG - Exonic
1083674216 11:64316473-64316495 CCTGGCCACCCCAGGGGTCCAGG - Exonic
1083904669 11:65662153-65662175 AGTGGCCCCCGCGGCGGTCGGGG - Intronic
1084128611 11:67118009-67118031 CGTGGCGGGCGCGGGAGGCCCGG - Intergenic
1084172961 11:67409485-67409507 TGTGGCCGGGGCGGGGGTCCCGG - Exonic
1084636969 11:70398948-70398970 CCTGGGCGCCGGGGGGCTCCAGG + Intronic
1085396328 11:76208874-76208896 CGTGGCCTGCGCGGCTGTCCCGG - Intronic
1090385579 11:126355963-126355985 CGTGGGCGCAGCGCGGGTCGGGG + Intronic
1091696945 12:2633998-2634020 TGTGGCCGCCCCGGGGAGCCGGG - Intronic
1094829845 12:34295091-34295113 CGTGGGATCCGCGGGGGTCGTGG - Intergenic
1094830660 12:34298674-34298696 CGTGGGGACCGCGGGGGTCATGG + Intergenic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096365485 12:51025886-51025908 CGTCGGCGCCGCAGGGGGCCGGG - Intronic
1096533969 12:52258908-52258930 GGTGCCCGCTGCGGGGGACCGGG - Intronic
1096717420 12:53499686-53499708 CGTGTCCGTCCCGGGGGGCCAGG - Intronic
1096994098 12:55828414-55828436 CATGGCCCCCCAGGGGGTCCAGG - Exonic
1099014268 12:77325592-77325614 CGTGGCCTGCGCCGGGGTCACGG + Intergenic
1101773823 12:107775754-107775776 TGCGGCGGGCGCGGGGGTCCTGG - Exonic
1102527112 12:113520051-113520073 CGTGCCAGCCGCGGGGATCCTGG + Intergenic
1102962040 12:117099283-117099305 GGTGCCCGCGGCGGGGGCCCCGG + Exonic
1102997448 12:117361207-117361229 CGCGGCGGCCGCGGGCGCCCGGG - Intronic
1104691028 12:130826486-130826508 CGTGGCCTCCGCGTGGGTTGGGG - Intronic
1105293900 13:19071855-19071877 CGGGGCCGCTGCTGGGATCCAGG + Intergenic
1105344210 13:19559483-19559505 CCTGGCCACCCCAGGGGTCCAGG + Intergenic
1105413839 13:20192804-20192826 CGGGGCCGGGGCGGGGGTCTCGG + Intronic
1105535823 13:21262091-21262113 CCTGGCCACCCCAGGGGTCCAGG - Intergenic
1105943616 13:25171491-25171513 CATGTCTGCCGCGAGGGTCCCGG + Exonic
1112505215 13:99971040-99971062 CATGGCCGCCGCGGGGGCCGTGG + Exonic
1112506617 13:99980007-99980029 CGGGGACGCCGCGGGGGGCGGGG + Intergenic
1114554858 14:23556107-23556129 CCTGGCCACCGCGGGGGTCGCGG + Exonic
1115320878 14:32077561-32077583 CGCGGCCGCCGAGGGGAGCCTGG + Intronic
1115398584 14:32934899-32934921 CGGGGCGGCCGCGGGGGTGCCGG + Intergenic
1116817855 14:49599766-49599788 CGGGGCCGGGGCGGGGATCCGGG + Intronic
1119290486 14:73491419-73491441 GGTGCCCGCCGCGCCGGTCCGGG + Exonic
1119649949 14:76376425-76376447 TGTGGTAGCCGAGGGGGTCCGGG - Intronic
1120521257 14:85530434-85530456 CGCGGCAGCAGCGGGGATCCCGG - Exonic
1121645882 14:95516732-95516754 CGGGGCCACCGGGCGGGTCCCGG - Intronic
1122582340 14:102778178-102778200 GGCGGGCGGCGCGGGGGTCCGGG + Intronic
1122983341 14:105201375-105201397 GTTGGCCGCTGTGGGGGTCCTGG - Intergenic
1124500957 15:30225780-30225802 CGAGGCCGCCGCCGGGGGCAGGG - Intergenic
1124742613 15:32312887-32312909 CGAGGCCGCCGCCGGGGGCAGGG + Intergenic
1128075716 15:64824136-64824158 CGCGGCCGCCCCGCGGGCCCTGG + Exonic
1128322543 15:66703442-66703464 CGGGGCCGCCGCGGGGCTACCGG - Exonic
1132251968 15:100341298-100341320 CGTCGCCGCCGTCGGGGCCCGGG + Exonic
1132878007 16:2148818-2148840 CGTGGAGGCAGCGGGGGTGCTGG - Exonic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1134150027 16:11797863-11797885 CGTGCCCGCAGCGGGGCACCTGG - Intergenic
1136153678 16:28368186-28368208 CGAGGCCGCCGCCGGGGGCAGGG - Intergenic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1138340690 16:56287157-56287179 TGTGGCCGCAGCAGGGGGCCAGG + Intronic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139598123 16:67969635-67969657 CGGGCCCGCTGCGGGGGCCCTGG - Intergenic
1139866343 16:70065508-70065530 CGTGGGGGCCGCGAGGGGCCCGG - Intergenic
1141079194 16:81035926-81035948 CGTGGCCGCCGGGACGGCCCGGG - Exonic
1141430644 16:83968865-83968887 GGAGGCCACGGCGGGGGTCCCGG - Intronic
1141692712 16:85605652-85605674 GGTGGCCCCCCCGGGGGTGCAGG - Intergenic
1141720116 16:85751221-85751243 CGAGGGCGCCGGGCGGGTCCTGG - Intergenic
1142156422 16:88534610-88534632 CCTGGCCGGCCCGGGGGTCGAGG + Exonic
1142338968 16:89508442-89508464 CGTGCCCTCCGCCGGGGTCCAGG + Exonic
1142670648 17:1486010-1486032 CGCGGCGGCCGCGCGGGTTCCGG - Intronic
1142697700 17:1643075-1643097 GGTGGCCGCGGCGGGGCGCCGGG - Intronic
1143490245 17:7281824-7281846 TGCGGAGGCCGCGGGGGTCCCGG - Exonic
1144573599 17:16415791-16415813 CGTGGCGGCTGCTGGGATCCCGG - Exonic
1144891449 17:18496528-18496550 AGTGGCGGCCTCTGGGGTCCTGG - Intergenic
1145094075 17:20009569-20009591 CGTCTTCGCCGCGGGGGCCCCGG + Intronic
1145140772 17:20447789-20447811 AGTGGCGGCCTCTGGGGTCCTGG + Intergenic
1145163087 17:20589072-20589094 CGTGACCCCCGCTGGGGGCCGGG + Intergenic
1145747772 17:27332843-27332865 CGCGGCCGGCGCAGGCGTCCAGG + Intergenic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1148072281 17:44915386-44915408 CCTGGCCGCCGTCTGGGTCCTGG - Exonic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1152635138 17:81427727-81427749 CGTGCCAGCCGCGGGGGGCGGGG - Intronic
1152697577 17:81804538-81804560 TGTGGCCGCCGCAGGGCGCCAGG - Intronic
1152710720 17:81869512-81869534 CCCTGCGGCCGCGGGGGTCCGGG - Intronic
1152748415 17:82051638-82051660 CGGGGCCGGGGCGGGGGTCCGGG + Exonic
1152753687 17:82078140-82078162 CGTGGCAGCCCCGGGCTTCCCGG - Intergenic
1152921378 17:83068192-83068214 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921392 17:83068226-83068248 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921555 17:83068668-83068690 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921625 17:83068842-83068864 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1155199349 18:23503587-23503609 CGCGCCCGCGGCGGGGGCCCCGG - Exonic
1155928810 18:31685100-31685122 CGCGGCGGCCGCGGGGCGCCGGG - Intronic
1158555941 18:58474878-58474900 CGTGGCCACCTCCTGGGTCCTGG + Intergenic
1158938351 18:62384947-62384969 CGGGGCCGCCGCACGGGTCCGGG - Exonic
1160390180 18:78524025-78524047 CGAGGACGCCGCGGGTGTTCTGG - Intergenic
1160499891 18:79396375-79396397 CGTGGGGGGCGCAGGGGTCCGGG - Intronic
1160540114 18:79616740-79616762 CGTGGAGGCCGCCGGGGCCCGGG + Intergenic
1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG + Intronic
1160719589 19:591312-591334 CGTGACCGCGGCGGGGTTCCCGG + Intronic
1160725016 19:614033-614055 CGTGGCCGGGGCGGGTGCCCTGG + Intronic
1160725624 19:616690-616712 CGAGGCCGCCGCCGGGGGCAGGG - Exonic
1160792558 19:929398-929420 CGTGGGGGCCGCGGGGGAGCCGG - Exonic
1160793951 19:935248-935270 CCAGGCCGCGGCGGGGGGCCGGG + Intronic
1161314779 19:3612720-3612742 CATGACCCCCGAGGGGGTCCTGG + Intronic
1161504975 19:4639206-4639228 CGAGGCCGTCGTGGGGGTGCCGG - Intergenic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162199414 19:9009880-9009902 AGTCGCCGCCGCAGGGTTCCAGG - Intergenic
1163243305 19:16077037-16077059 CGGGGCTGGCGCCGGGGTCCCGG + Intronic
1163435748 19:17294205-17294227 CGTGGCCTCTGCGGGGGGCGTGG - Intronic
1163557638 19:18001606-18001628 GGTCGCGGCCGAGGGGGTCCCGG - Intronic
1163708707 19:18832650-18832672 CGCGGCCGGAGCGGGGGACCCGG - Intronic
1163771307 19:19192791-19192813 CGTGGGTTCCGCTGGGGTCCTGG - Intronic
1163782703 19:19258640-19258662 CCAGGCCGCCGCAGGGCTCCCGG + Exonic
1163828239 19:19535611-19535633 CGTGGCCAGCGCGCGGGTGCAGG - Exonic
1165721410 19:38082116-38082138 CGGGGGAGCCGCGGGGGGCCCGG + Exonic
1166100359 19:40567979-40568001 CTCCGCCGCCGCGGGGGTCGCGG - Exonic
1166682619 19:44778130-44778152 GGAGGCGGCCCCGGGGGTCCCGG + Exonic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167272072 19:48511445-48511467 CGAGGCCGCCGCGGGGGTGGGGG + Intronic
1167613362 19:50517798-50517820 CGTGGCCGCCGCGGCCGCCGTGG - Exonic
1168336282 19:55599408-55599430 CGGGGCCGCCCCGGGTCTCCAGG - Intronic
924985221 2:264307-264329 CGTGGACCCCGCGGGGCTCAAGG + Intronic
925187773 2:1860934-1860956 CGTGGTCGCCGTGGTGGTGCTGG - Intronic
925609439 2:5691788-5691810 CAGGGCCGCCGCGGGGCTACCGG + Intergenic
927472401 2:23385838-23385860 CCTGGCCGCCGCGTGGGGCCGGG + Intronic
928904352 2:36355383-36355405 CGTGGCCGCAGCGGCCGGCCTGG - Intergenic
929966840 2:46542822-46542844 CGGGGCCGGGGCGGGGATCCGGG + Exonic
931348999 2:61471358-61471380 CGCGGCCGCGGGGGGAGTCCGGG + Intergenic
931869639 2:66444652-66444674 CTTGGCCCCCGCGGGCGGCCCGG + Intronic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
936370358 2:111898250-111898272 TCTGGCCGCTGCGCGGGTCCGGG - Intergenic
936452728 2:112645759-112645781 CGTGGCCGCCGAAGCGGGCCGGG + Intergenic
938301121 2:130213696-130213718 CGGGGCCGGGGCGGGGATCCTGG - Intergenic
938455595 2:131460771-131460793 CGGGGCCGGGGCGGGGATCCTGG + Intergenic
941906141 2:170716986-170717008 CGTGGCCGCCAGGGGGGCCTTGG - Exonic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
946966580 2:225042779-225042801 GGCGGCCGCCGAGGGGCTCCGGG + Intergenic
947632304 2:231662146-231662168 CGTGGCCGCCTCGCGGGCCGGGG - Intergenic
947745041 2:232503107-232503129 CCTGGCCGCTGCGGGACTCCTGG + Intergenic
948690014 2:239696062-239696084 CAGGGCAGCCGCAGGGGTCCTGG - Intergenic
948806063 2:240453807-240453829 CGTCGCCGCCCTGGGGGTCCCGG - Intronic
1168777721 20:462212-462234 CGGGGCTGCTGCGGGGTTCCGGG - Intronic
1171191853 20:23164517-23164539 TGTGGCGGCCGTGGGGGACCTGG + Intergenic
1171810218 20:29741202-29741224 CGTGGCCACCACCGCGGTCCTGG - Intergenic
1171908756 20:30921971-30921993 CGTGGCCACCACCGCGGTCCGGG + Intergenic
1171972502 20:31573118-31573140 TGTGGCCGCGGCGGGGGTGGGGG - Intronic
1174099938 20:48119556-48119578 CGTGGCCACTGCTGGGGTGCTGG - Intergenic
1174402379 20:50282967-50282989 CGTGGCCGAAGCGGGGGCCGTGG - Intergenic
1175402859 20:58710538-58710560 CTTGGCCGCCCTGGGGGACCAGG + Intronic
1175794264 20:61761745-61761767 CGTGGCCTCAGCAGGGCTCCGGG + Intronic
1175970449 20:62684194-62684216 TGTGGCAGCCCCAGGGGTCCTGG + Intronic
1176549773 21:8216124-8216146 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
1176557664 21:8260353-8260375 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
1176568698 21:8399158-8399180 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
1176576612 21:8443393-8443415 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
1179980317 21:44892070-44892092 CCTGGCCTCTGCAGGGGTCCTGG + Intronic
1180089390 21:45526046-45526068 CGTGGCTGCCGGGCGGGTCATGG - Intronic
1180092882 21:45541995-45542017 CGGGGTCTCCGCGGGGGTCGCGG - Intronic
1180866220 22:19121600-19121622 TGTGGCCGGCGCGAGCGTCCCGG - Intronic
1180915045 22:19480032-19480054 CAAGGCCTCGGCGGGGGTCCCGG - Intronic
1181057857 22:20268325-20268347 CGTGGGCGGCGCGGCGGGCCGGG + Exonic
1181312527 22:21952876-21952898 CCTGGCCGCCGCGGGCGCCGCGG + Intergenic
1182086414 22:27564084-27564106 CGTGGCCACCTCAGGGCTCCGGG + Intergenic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
1203254662 22_KI270733v1_random:132450-132472 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
1203262718 22_KI270733v1_random:177529-177551 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
950729800 3:14947689-14947711 CGGGGGCGCCGCCGGGGTCGCGG - Intronic
953930045 3:47001321-47001343 AGAGGCCCCCGTGGGGGTCCTGG + Exonic
954468977 3:50675317-50675339 CCTGGCCGTGGCGGGGGTTCTGG + Intronic
960586119 3:119322866-119322888 CGGCCCGGCCGCGGGGGTCCCGG + Intronic
961551665 3:127673228-127673250 GGGGGCTGCGGCGGGGGTCCGGG - Intronic
964786148 3:160399006-160399028 CCTGGCGGCAGCGGGGCTCCGGG - Intronic
967858335 3:194134524-194134546 CGTGACCGCGGCGGGCGCCCAGG + Intergenic
967880358 3:194297256-194297278 CGTGGGCGCAGCGGGGGCCCGGG - Intergenic
968048151 3:195635438-195635460 GGGGGCGCCCGCGGGGGTCCGGG - Intergenic
968048177 3:195635500-195635522 GGGGGCGGCCGCGGGGGTCGGGG - Intergenic
968099227 3:195954120-195954142 GGGGGCGGCCGCGGGGGTCGGGG + Intergenic
968099253 3:195954182-195954204 GGGGGCGCCCGCGGGGGTCCGGG + Intergenic
968133631 3:196207469-196207491 CGTGTCCGCCGCGGGCCTCCTGG - Exonic
968306434 3:197654421-197654443 GGGGGCGGCCGCGGGGGTCGGGG + Intergenic
968306460 3:197654483-197654505 GGGGGCGCCCGCGGGGGTCCGGG + Intergenic
972533102 4:39977751-39977773 CGGGCGGGCCGCGGGGGTCCCGG - Exonic
972543001 4:40056149-40056171 CGTGGCCGCTGCGGCGGGCACGG - Intergenic
975131856 4:70839445-70839467 CGTGGGCGCCGTGAGGGACCTGG - Intronic
981530924 4:145752996-145753018 CGTGGCCGCTGCTGGGGGCTGGG + Intronic
983254146 4:165379310-165379332 CATGCCCGCCGCGGGCGCCCCGG - Exonic
984778586 4:183504903-183504925 CGGGGCCGGCGCCGGGGTCCCGG - Intergenic
985129686 4:186726833-186726855 CGTGGAGGCTGCGGGGGTCCCGG + Intergenic
985727623 5:1524200-1524222 CGTGGCAGCCTCGCGGGCCCGGG - Intergenic
989983286 5:50667422-50667444 CGTGGCCGGAGCGGGGGTCTAGG + Intronic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
995571737 5:113488522-113488544 AGTGGCCGCCGGGGCGCTCCGGG + Exonic
995809126 5:116085179-116085201 CCTGGGCGCCGCGGCGGGCCCGG + Intronic
998254664 5:140575434-140575456 CCTGGCCACCTTGGGGGTCCAGG + Intronic
1000302952 5:159972312-159972334 CGTGGCGGCCGCGGCGGCCGGGG - Exonic
1001081524 5:168671199-168671221 TGTGGCCGAGGCAGGGGTCCCGG + Exonic
1001381979 5:171311318-171311340 CGGGGCCGCCGGCGGGGCCCCGG - Intronic
1001995143 5:176151380-176151402 CGTGGTGGCCCCGGAGGTCCAGG - Intergenic
1002046318 5:176543446-176543468 CGGGGCCGGGGCGGGGGTCCTGG - Intronic
1002173454 5:177387990-177388012 CGTGGCCCCCGCGAAGGCCCTGG - Exonic
1003087110 6:3068884-3068906 CGGGGCGGCCGCGGGCTTCCCGG + Intronic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1008630511 6:53359438-53359460 GGTGACCGCCGCGGGGGAGCGGG - Intergenic
1010568594 6:77449904-77449926 CTTGGCCGGCTCTGGGGTCCGGG - Intergenic
1015994782 6:138987356-138987378 CTTGGCCGCGGCGCGAGTCCAGG + Intronic
1018679664 6:166253462-166253484 GGTGGCGGCCGCCGGGCTCCAGG - Intergenic
1018686281 6:166307296-166307318 CGCGGCTGCCGCGCGGGGCCGGG - Exonic
1019413165 7:915419-915441 CGTGGCCGCCCCGCCGGGCCTGG + Intronic
1019419944 7:946225-946247 CGTGGCCCCTGCAGGGATCCAGG + Intronic
1019421802 7:954275-954297 CGCGGACGCCGCGGGGGTGGCGG - Intronic
1022097129 7:27148036-27148058 CGTGCCCGCCGCTGGCGTTCGGG - Intronic
1022427954 7:30285552-30285574 CGCGGCGGCCGCGGCGGCCCCGG + Exonic
1023064788 7:36366877-36366899 GCTGGCCGCGGCGGGGGTGCGGG - Intronic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1029549914 7:101232281-101232303 CGTGGCCGGGGCGGGGCTACGGG + Exonic
1029639855 7:101814213-101814235 CGTGGCAGGCGCGGGGGCCTGGG + Intergenic
1034560677 7:151877505-151877527 TGCGGCCGCCGCAGGGGTCTGGG - Intergenic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1035681753 8:1493547-1493569 TGTGGGAGCCGCGAGGGTCCTGG + Intergenic
1037495655 8:19438179-19438201 CTTGGCCGGGGCGGGGGTCGGGG + Intronic
1037889367 8:22615456-22615478 TGAAGCCGCCGGGGGGGTCCCGG - Exonic
1039060121 8:33566440-33566462 CGTGGGAGCCGAGGGGTTCCCGG - Intronic
1042696025 8:71556390-71556412 CGTGGCTGCCGCGGGCGCGCGGG - Intronic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1044781652 8:95749923-95749945 CGGGGCCGCTGCAGGAGTCCTGG + Intergenic
1045222507 8:100213005-100213027 CGCGGAGGCCGCGGGGGTGCAGG - Intronic
1049396371 8:142402997-142403019 CGCGGCCCCCGCCGGGCTCCGGG + Intronic
1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG + Intronic
1049469527 8:142769199-142769221 CGTGGGCACTGCGGGGGTCGAGG + Intronic
1049674472 8:143883556-143883578 CGAGGCTGCCGCGCGGATCCAGG - Intergenic
1050345260 9:4679778-4679800 CGTGGCCGCCTCCGGGACCCTGG + Exonic
1053482312 9:38424560-38424582 CGCGGGCACCGCGCGGGTCCCGG - Intergenic
1060970569 9:127735180-127735202 CGCGGCCGCCGCCTGGGACCTGG - Exonic
1061123089 9:128656403-128656425 CGTGGCTGCCGGGCGGGTTCGGG - Intronic
1061123100 9:128656434-128656456 CGTGGCTGCCGGGCGGGTTCGGG - Intronic
1061321823 9:129835631-129835653 GGCGGCGGCCGGGGGGGTCCCGG - Intronic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061972690 9:134053438-134053460 AGTCGCCCCCGCGGGGATCCCGG - Exonic
1061987155 9:134136353-134136375 AGGGGCCGGGGCGGGGGTCCCGG - Intronic
1062290570 9:135792548-135792570 TGTGGCCCACGCGGGGCTCCTGG - Exonic
1203471063 Un_GL000220v1:115595-115617 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
1203478884 Un_GL000220v1:159567-159589 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
1185520429 X:734524-734546 GGTGGCGGCCTCGGGGGTCCTGG - Intergenic
1185747472 X:2584230-2584252 CGGGGCCGGCGCGGGGCTCCGGG - Intergenic
1185778873 X:2829025-2829047 CCTGGGCGCGGCGGGGGGCCGGG + Intronic
1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG + Exonic
1187281613 X:17861473-17861495 CGTGGGCGGCGCGGGGTGCCAGG + Intergenic
1187669964 X:21657868-21657890 TGTGGCTTACGCGGGGGTCCCGG - Exonic
1190279205 X:48918477-48918499 TGTGGCGGGGGCGGGGGTCCTGG - Intronic