ID: 1096252130

View in Genome Browser
Species Human (GRCh38)
Location 12:50040160-50040182
Sequence AGGGCCTCAGCCTCTGGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096252130_1096252138 15 Left 1096252130 12:50040160-50040182 CCACCGCCAGAGGCTGAGGCCCT No data
Right 1096252138 12:50040198-50040220 ATCAGGACCCAGAAAACTTTCGG No data
1096252130_1096252139 16 Left 1096252130 12:50040160-50040182 CCACCGCCAGAGGCTGAGGCCCT No data
Right 1096252139 12:50040199-50040221 TCAGGACCCAGAAAACTTTCGGG No data
1096252130_1096252135 -2 Left 1096252130 12:50040160-50040182 CCACCGCCAGAGGCTGAGGCCCT No data
Right 1096252135 12:50040181-50040203 CTCTCCACTCATAAACCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096252130 Original CRISPR AGGGCCTCAGCCTCTGGCGG TGG (reversed) Intergenic
No off target data available for this crispr