ID: 1096254925

View in Genome Browser
Species Human (GRCh38)
Location 12:50057104-50057126
Sequence TACGTGGACATCTGTTGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096254916_1096254925 0 Left 1096254916 12:50057081-50057103 CCATGTGGGTCAGGCCCCCGGGA 0: 1
1: 0
2: 1
3: 15
4: 177
Right 1096254925 12:50057104-50057126 TACGTGGACATCTGTTGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096254925 Original CRISPR TACGTGGACATCTGTTGCGG GGG Intergenic
900910220 1:5592091-5592113 GATGTGGACATCTGTTGCAGGGG - Intergenic
903325959 1:22568675-22568697 TCCGTGCACATCTGGTGTGGAGG - Intronic
906836951 1:49094231-49094253 AACGTGGACATCTTTGGTGGGGG - Intronic
908008917 1:59755712-59755734 TATGTGCACATCTGTTGCAGTGG + Intronic
915911991 1:159921174-159921196 GACATGGACACCTTTTGCGGGGG - Intronic
916193846 1:162204831-162204853 TACGTGCACATGTGTGGCTGTGG + Intronic
918426265 1:184413134-184413156 TTGGTGGACACCTGTTGCTGTGG + Intronic
920669915 1:207995688-207995710 TTCGTGGCCATCTTTTGCAGGGG + Intergenic
1065366468 10:24942130-24942152 TACCTGGACATTTGTTCAGGCGG - Intronic
1065428975 10:25634213-25634235 TACGTGGACATCTTTGGGGAAGG - Intergenic
1076776197 10:132699539-132699561 TAAGTGGACACCTGGTGGGGAGG - Intronic
1087574238 11:99970656-99970678 TACTTGTGCATGTGTTGCGGGGG + Intronic
1096035594 12:48466999-48467021 TGAGTGAACATCTGTTGGGGAGG - Intergenic
1096254925 12:50057104-50057126 TACGTGGACATCTGTTGCGGGGG + Intergenic
1104091763 12:125523575-125523597 GACGTGGACATCTCTGGAGGGGG + Intronic
1110354949 13:74556616-74556638 TAGGTCCACATCTGTTGGGGAGG + Intergenic
1112619537 13:101040548-101040570 GAAGTGGACATTTGTTGAGGTGG - Intergenic
1124606619 15:31174278-31174300 TAGGTGGACACCTGGTGCAGTGG + Intergenic
1132692216 16:1186709-1186731 TACGTGGCCACCCGTTGAGGAGG - Intronic
1147886613 17:43688533-43688555 GATGTGGACATCTTTTGAGGTGG + Intergenic
1152685921 17:81693864-81693886 TACGTGGACTTCTGTCTCTGAGG - Exonic
1156428459 18:37043466-37043488 TCAGTGGACATATGTTGCAGGGG - Intronic
1159674940 18:71271132-71271154 TATGTGCATATGTGTTGCGGGGG - Intergenic
1164397268 19:27877177-27877199 TACGTGGAGATCTCTGGGGGTGG - Intergenic
927125594 2:20010391-20010413 GACGTGGACGTCTTTGGCGGGGG - Intronic
928318441 2:30264172-30264194 GACATGGACATCTGTGGGGGTGG - Intronic
930660021 2:54044103-54044125 TGTGTGTACATCTGTTGCAGGGG - Intronic
934233237 2:90205811-90205833 GACATGGACATCTCTTGGGGTGG + Intergenic
941177593 2:162217816-162217838 TATGTGGACATCTGTTGCTTTGG - Intronic
943575660 2:189627904-189627926 TATGTGGACATTTGTTGAAGAGG - Intergenic
943760801 2:191606463-191606485 TATGTGGACATATCTTTCGGGGG + Intergenic
946551613 2:220807727-220807749 AACGTGGACATCTTTTGAGGTGG - Intergenic
1176305811 21:5122547-5122569 TGTGTGGACAACTGTTGTGGTGG + Intronic
1179851246 21:44139484-44139506 TGTGTGGACAACTGTTGTGGTGG - Intronic
1181775473 22:25156913-25156935 TACGTGTAAACCTGTTGAGGAGG - Intronic
1184412135 22:44331604-44331626 AACCCGGACAACTGTTGCGGCGG - Intergenic
953206385 3:40833705-40833727 TACCTGGACATCTGATGGAGAGG - Intergenic
962554104 3:136528472-136528494 TGCGGGGACATCTGTTGCTGGGG - Intronic
968543245 4:1178901-1178923 CACGTGGCCATCTGCTGCTGGGG - Intronic
977687107 4:99859736-99859758 TAGGTGGACATCTGTAGTGAGGG - Intronic
978394440 4:108263523-108263545 TACATGGAGATCTGTTGTAGAGG + Intergenic
994043137 5:95280918-95280940 TACGTGCACATATGTTGTTGGGG + Intronic
995447961 5:112267525-112267547 TACGTGGACATCTGAAGGCGGGG - Intronic
1008631445 6:53366157-53366179 TAGGTGGAAGTCTGTTGCAGGGG - Intergenic
1021574739 7:22096789-22096811 TACGTGGAGATATGTGGGGGCGG - Intergenic
1022997769 7:35775329-35775351 TCAGTGGCCATCTGTTGAGGTGG + Intergenic
1023463037 7:40421308-40421330 TTCCTGGAGATCTGTTGCTGGGG + Intronic
1024066858 7:45745259-45745281 TAGGTTGACATCTGTTTCTGAGG - Intergenic
1048645225 8:136412372-136412394 TACTTGGAAATCTTGTGCGGAGG - Intergenic
1056573169 9:87834108-87834130 TCTGTGGACATCTGTTGCTTTGG + Intergenic
1057953216 9:99386311-99386333 TATGGTGACATCTGTTGAGGAGG + Intergenic
1188133102 X:26461995-26462017 CACGTGGATAACTGTTGCAGTGG + Intergenic
1199362029 X:146931955-146931977 AACATGGACATCTATTGGGGAGG + Intergenic