ID: 1096256272

View in Genome Browser
Species Human (GRCh38)
Location 12:50064009-50064031
Sequence ACTGCCATGCAGACAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096256257_1096256272 29 Left 1096256257 12:50063957-50063979 CCCTCCAGCTAGGCAGGGAGTGG 0: 1
1: 1
2: 0
3: 35
4: 226
Right 1096256272 12:50064009-50064031 ACTGCCATGCAGACAGGGGAAGG 0: 1
1: 0
2: 3
3: 24
4: 289
1096256261_1096256272 25 Left 1096256261 12:50063961-50063983 CCAGCTAGGCAGGGAGTGGAGGG 0: 1
1: 0
2: 3
3: 43
4: 380
Right 1096256272 12:50064009-50064031 ACTGCCATGCAGACAGGGGAAGG 0: 1
1: 0
2: 3
3: 24
4: 289
1096256259_1096256272 28 Left 1096256259 12:50063958-50063980 CCTCCAGCTAGGCAGGGAGTGGA 0: 1
1: 0
2: 2
3: 15
4: 201
Right 1096256272 12:50064009-50064031 ACTGCCATGCAGACAGGGGAAGG 0: 1
1: 0
2: 3
3: 24
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096256272 Original CRISPR ACTGCCATGCAGACAGGGGA AGG Intronic
900210740 1:1454686-1454708 ACACCGAGGCAGACAGGGGAAGG - Intronic
900216617 1:1485356-1485378 ACACCGAGGCAGACAGGGGAAGG - Intronic
900223698 1:1523084-1523106 ACACCGAGGCAGACAGGGGAAGG - Intronic
901071287 1:6520021-6520043 CCTGCCAGGCAGAGAGGGGCTGG + Intronic
902926632 1:19700301-19700323 GCTGCCTTGGAGACAGGGCAGGG - Intronic
904289869 1:29478247-29478269 ACTGCGATGGACACAGCGGAGGG - Intergenic
904415732 1:30360081-30360103 ACAGCCACGCAGGGAGGGGAGGG + Intergenic
904866332 1:33581915-33581937 ACTGCCATGCAAACTGTGAAGGG + Intronic
905505994 1:38480261-38480283 ACTGCCATGAAGACTGAGAAGGG - Intergenic
907162339 1:52380119-52380141 ACTGCCCTCCAGACAGGACAGGG + Intronic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
909949314 1:81701035-81701057 GCTGGCAAGCAGACAGGGTACGG + Intronic
910686057 1:89917691-89917713 AGTACCATGCAAGCAGGGGAAGG + Intronic
912371887 1:109179964-109179986 GCTGCCATGCAGAGGAGGGAGGG + Intronic
915138304 1:153749565-153749587 ACTGCACAGCAGACAGGGCAGGG - Intronic
915148515 1:153810197-153810219 ACTGCGATATAGACCGGGGAGGG + Exonic
917453911 1:175169781-175169803 AGAGCCCTGCAGAGAGGGGAAGG - Intronic
918072094 1:181140651-181140673 ACTGCAATTCAGAAAGGGAAAGG - Intergenic
921006737 1:211101055-211101077 AGTGCCATGCAGAAACTGGAAGG - Intronic
922191593 1:223323545-223323567 GCTGCCATGGAGACAGGGATGGG + Intronic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
924942910 1:248824928-248824950 TCAGCCATGCTGACAGGGGGAGG + Exonic
1064155784 10:12902014-12902036 CGTGCCATGGAGACTGGGGAGGG - Intronic
1064426594 10:15234987-15235009 ACTGCCAGGCAGAAAAAGGAGGG + Intronic
1066196369 10:33104228-33104250 TCTCCTAGGCAGACAGGGGAAGG - Intergenic
1066500633 10:35991096-35991118 AGTGCAATTCAAACAGGGGAAGG + Intergenic
1067225979 10:44375837-44375859 ACCCCCATGCAGACTGGGCAGGG - Intronic
1067511364 10:46897564-46897586 CCTCCCCTGCAGACAGAGGATGG + Intergenic
1067650883 10:48154298-48154320 CCTCCCCTGCAGACAGAGGATGG - Intergenic
1068947115 10:62740632-62740654 TATGCCATGCAGGCAGGGCATGG + Intergenic
1073272148 10:102274342-102274364 ACTGCCAAGCAGGCAGGGCTAGG - Intronic
1074529627 10:114288406-114288428 AGTGCCCTGCATACTGGGGATGG + Intronic
1074700148 10:116085556-116085578 ACAGCCATGCAGGCAGAGGAGGG + Intronic
1076032726 10:127173236-127173258 TCTGTCCTGCAGACAGGGGATGG - Intronic
1076098051 10:127749256-127749278 AAGGCCATGCAGACAGCGGTGGG - Intergenic
1078502119 11:11890499-11890521 ACTGCCATTCTGACAGGTGTGGG - Intronic
1078672047 11:13374391-13374413 ACTGCCATGCAGTCAGCACAGGG - Intronic
1079125144 11:17713794-17713816 ACTGACATGCGGGCAGGGCAGGG - Intergenic
1079853004 11:25561605-25561627 ACTGCCATGGAGTCAGAGGCAGG + Intergenic
1080531339 11:33179618-33179640 TCTGCCATGCAGAAAAGGGGTGG + Intergenic
1083197975 11:61102343-61102365 GCTGCCATTCAAACAGGGGCAGG + Intergenic
1083519633 11:63296316-63296338 ACTGCAATGCAGCGAGGGGGTGG - Intronic
1084175050 11:67418638-67418660 GCTGCCATGCTGAATGGGGATGG + Intronic
1084784605 11:71434896-71434918 ACTGCAGAGCAGGCAGGGGAGGG + Exonic
1085128821 11:74020191-74020213 AGTGCCATGTGGACAGGGCAGGG + Intronic
1085296989 11:75436909-75436931 ACAGCCCTGCAGACAGGTGGAGG - Intronic
1085450492 11:76629322-76629344 ACTGCGACCCAGACAGGAGAAGG - Intergenic
1085459960 11:76687669-76687691 ACCTCCAGGCAGGCAGGGGAGGG - Intergenic
1085639283 11:78182055-78182077 ACCGCCTTGCACTCAGGGGAGGG + Intronic
1087080866 11:94169763-94169785 CCTGCCATGGAGACTCGGGAGGG + Intronic
1087231599 11:95672241-95672263 TCTGCCGTGCAGAAAGGAGAAGG - Intergenic
1087803502 11:102530495-102530517 ACTGCAATGCTAACATGGGAAGG + Intronic
1087906268 11:103701311-103701333 GCTACCATGCAGACAAGGGTAGG + Intergenic
1088157614 11:106827854-106827876 ACTTCCCTGCAGTCATGGGAGGG + Intronic
1088287579 11:108204166-108204188 ATTCCCAGGCAGACAGGGGTGGG + Intronic
1088396558 11:109376246-109376268 ACTGCCATGCAGTGATGGGAGGG + Intergenic
1089356933 11:117860115-117860137 ACAGCCAGGCAGACAGAGCAGGG - Intronic
1089589764 11:119532896-119532918 ACAGCCATGGAGGCAGGGGGTGG - Intergenic
1091995115 12:4987264-4987286 GCTGCCAGGCAGGCAGGAGAAGG - Intergenic
1092019149 12:5185935-5185957 ACTGCCAGGCAGGGAGGGGACGG - Intergenic
1092963950 12:13623962-13623984 ACAGACCTGCAGGCAGGGGAAGG - Intronic
1093908950 12:24724329-24724351 AATGCAGTGTAGACAGGGGAAGG + Intergenic
1094605509 12:31945608-31945630 ACTGCCATGCAGAAAAAGGAGGG + Intergenic
1096256272 12:50064009-50064031 ACTGCCATGCAGACAGGGGAAGG + Intronic
1097533746 12:60839098-60839120 TCTGCCATGCAGACACAGTAAGG - Intergenic
1100572580 12:95857323-95857345 ACTGCCACGCAGAAAAAGGAGGG - Intergenic
1100667382 12:96769705-96769727 ACAGCCATGTAGCCATGGGAAGG - Intronic
1100676856 12:96878088-96878110 ACTGCGATGAAGACCAGGGAGGG - Intergenic
1101442873 12:104716565-104716587 AGTGCCATGAGGGCAGGGGATGG + Intronic
1102624256 12:114221860-114221882 ATAGCCATGAAGCCAGGGGAAGG + Intergenic
1102918830 12:116776518-116776540 AATTCCATGGAGACAGGGCAGGG + Intronic
1103144796 12:118585888-118585910 ATTGTGATGCAGACAGGGCAAGG + Intergenic
1103621610 12:122190377-122190399 ACTGGCATGCAGGGAGGGGGTGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107185437 13:37513744-37513766 CCTGCCATGCAGAAAGTGTAAGG - Intergenic
1107598551 13:41989286-41989308 ACTGCCATGCAGAACAGAGAAGG - Intergenic
1108322877 13:49304243-49304265 ACTGCCATGGAGAAAGGACATGG + Intergenic
1108433190 13:50375517-50375539 ACAGCCAGGCAGACAGGAGTAGG - Intronic
1110065502 13:71100608-71100630 CCTACCCTGAAGACAGGGGAAGG - Intergenic
1110409143 13:75184929-75184951 GCTCCCATTCAGTCAGGGGATGG - Intergenic
1111663439 13:91239016-91239038 ACTGTGATGCAGTCAGAGGAAGG + Intergenic
1112188340 13:97149865-97149887 ACTCCCCTGCAGAGAGAGGAGGG - Intergenic
1112363871 13:98740757-98740779 ACTGCCCTGAGGACAGGGGTGGG + Intronic
1114063650 14:19041235-19041257 CCTGCCATGCAGCCAGAGGCTGG + Intergenic
1114098607 14:19358761-19358783 CCTGCCATGCAGCCAGAGGCTGG - Intergenic
1117067758 14:52027307-52027329 ACTGCCATCCTCACAGGGGTTGG + Exonic
1117517889 14:56520676-56520698 AATGTGATGCAGACAGGGCAGGG + Intronic
1118459984 14:65978825-65978847 ACTGGGTAGCAGACAGGGGATGG + Intronic
1119921293 14:78448787-78448809 AGTGGAATGCAGGCAGGGGAGGG - Intronic
1121118202 14:91358239-91358261 ACTGTCATACGGACAGGAGAGGG + Intronic
1122704007 14:103608750-103608772 ACAGCCATGCAGACACTGGGAGG + Intronic
1123906001 15:24921906-24921928 AATGCCATACAGACCGGGCACGG + Intronic
1124010948 15:25838136-25838158 AGTGCCATCCAGACAGGGTATGG - Intronic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1125715667 15:41818639-41818661 ACTGAAATGGAGAGAGGGGAGGG - Intronic
1126596763 15:50391083-50391105 ACTCCCATTCAGATAGGGTAAGG - Intergenic
1127079142 15:55358563-55358585 TTTGCTATGCAGACAGGGAAGGG - Intronic
1128619972 15:69140544-69140566 TCCGCCAGGCAGACAGGCGAGGG - Intergenic
1128634325 15:69293554-69293576 ACTGGGATGCATGCAGGGGAGGG + Intergenic
1128726189 15:69990199-69990221 TCTGCCATGCAAACACGGGGTGG - Intergenic
1129712077 15:77825564-77825586 ATAGCCATGCACACAGAGGAAGG + Intergenic
1131071520 15:89469475-89469497 ACTGCCATGCAGAAAAAGGAGGG - Intergenic
1132145259 15:99425642-99425664 CCTGCCACGGAGCCAGGGGAAGG + Intergenic
1132267217 15:100484716-100484738 ACTGGCAGGCAGACAAGAGACGG + Intronic
1133971551 16:10571760-10571782 ACTGAGATGAAGAGAGGGGATGG + Intronic
1135383019 16:22009080-22009102 ATTGCCAAGCGGGCAGGGGATGG - Intronic
1135574228 16:23572890-23572912 TCTTCCATGCAGACAGGGTGAGG - Exonic
1135889592 16:26345231-26345253 ACTGGCATGCAGAGAAGGAAGGG + Intergenic
1136246175 16:28977539-28977561 ATTGGGATGCAGACAGAGGAAGG + Intronic
1136400762 16:30016852-30016874 ACTGACGTGGGGACAGGGGATGG + Intronic
1138345735 16:56319131-56319153 ATTGCCATGAAGAGAAGGGAAGG + Intronic
1139378119 16:66513643-66513665 GCCACCTTGCAGACAGGGGAGGG - Intronic
1139387918 16:66586131-66586153 GCTGCCTTGCAAAGAGGGGAAGG + Intronic
1139455696 16:67074221-67074243 ACTGCAGTGCAGACAAGGGTGGG + Intronic
1140984277 16:80142707-80142729 ACTGGCAGGAAGACAGGGGAGGG + Intergenic
1141595658 16:85095377-85095399 GCTGCCCTTCAGACAGGGGCAGG + Intergenic
1141820182 16:86440350-86440372 ACTGCCTTGCTGAGAGGAGAAGG + Intergenic
1142229670 16:88893934-88893956 AGTCCCTTGCTGACAGGGGAGGG + Intronic
1145285576 17:21503791-21503813 ATTTCCAGGCAGACAGAGGATGG + Intergenic
1146835183 17:36104957-36104979 ACTGCCAGGCTGGCAGGGAATGG + Intronic
1148909863 17:50935614-50935636 AGTGCCATGTGGGCAGGGGATGG - Intergenic
1149168688 17:53783688-53783710 CCTGTCATGGAGTCAGGGGAGGG + Intergenic
1149468679 17:56899083-56899105 GTTGCCATGGAGACAGGGGTGGG + Intronic
1152569251 17:81114366-81114388 CCTGGCAGGCAGACAGGGCATGG + Intronic
1153326547 18:3826574-3826596 ACTGCCATGCACACAGCGGGAGG + Intronic
1153994982 18:10432879-10432901 ACTGCTGTGCAAACAGGGGCTGG - Intergenic
1155368656 18:25075122-25075144 ACTGCCATGCATAAAGGGCCAGG + Intronic
1155799923 18:30089108-30089130 AATTCTAGGCAGACAGGGGAAGG + Intergenic
1156214716 18:34984654-34984676 ACTCCCATGCTGACTGGGTAAGG + Intronic
1157277110 18:46318814-46318836 AGGGCCATGAAGACAAGGGATGG - Intergenic
1157588694 18:48821478-48821500 ACTGCCTTGCAGGCAGAGCAGGG + Intronic
1157631022 18:49095865-49095887 ACTGCAATGGAGTCTGGGGAAGG - Intronic
1157893118 18:51437757-51437779 AGTTCCAGGGAGACAGGGGAAGG + Intergenic
1158012954 18:52749358-52749380 ATTCCCAGGCAGACAGGGGTGGG - Intronic
1158422612 18:57309347-57309369 ACTGCCATGCAAAATAGGGAGGG + Intergenic
1159370095 18:67517555-67517577 ACCTACATGCAGACAGGAGAAGG + Intergenic
1160342411 18:78101245-78101267 ACTTCCATCCAGACAGGACAGGG - Intergenic
1161054032 19:2181002-2181024 ACTGACAAGGAGACAGAGGAAGG - Intronic
1161284025 19:3459643-3459665 ACAGCCAGGCAGGAAGGGGAGGG + Intronic
1161495425 19:4583647-4583669 ACAGCCAAGAAGGCAGGGGAGGG - Intergenic
1162153900 19:8663970-8663992 AGTGCCCTGCAGAGAGGGAAAGG + Intergenic
1163255416 19:16153193-16153215 ACAGCCCTGCAGGCAGGTGAGGG + Exonic
1164435682 19:28227065-28227087 TCTCCCATGCAGACATGGGCAGG + Intergenic
1165304474 19:34995122-34995144 ACTGCTAAGCAAACAGGGAAGGG + Intronic
1165352646 19:35284528-35284550 ACTGGCATCCAGGCAGGGGAAGG + Intronic
1165380021 19:35472596-35472618 ACTGCAATGTAGAGAGTGGATGG - Intergenic
1166951099 19:46428536-46428558 ACAGCCCTGCAGGCAGGGGCTGG - Intergenic
1167012651 19:46819073-46819095 ACAGCCATGCAGAAAAAGGAGGG + Intergenic
1167737368 19:51303820-51303842 ACTCCCATTCAGACTGGGTAAGG + Intergenic
925372494 2:3356919-3356941 ACTGCCATGCAGAAAAGGTGAGG - Intronic
926092870 2:10061764-10061786 GTTGCCAGGCAGACAGGGCAGGG - Intronic
926886170 2:17600997-17601019 ACACCCTTGGAGACAGGGGAAGG - Intronic
927504398 2:23603694-23603716 ACTGGCCTGGAGACAGGGAAGGG - Intronic
930525472 2:52524475-52524497 AATTCTAGGCAGACAGGGGAGGG + Intergenic
931169106 2:59783835-59783857 ACTGACATGAAGGCATGGGAGGG + Intergenic
931171178 2:59805092-59805114 ACTAACAGGCAGACAGGGGTGGG + Intergenic
931264501 2:60648595-60648617 TCTGGCATGCAGAGAGGCGATGG - Intergenic
931810537 2:65850351-65850373 AAACCCATGCAGACATGGGAGGG - Intergenic
932467039 2:71930543-71930565 TCTCCCATGCTGAAAGGGGAGGG - Intergenic
932998879 2:76895798-76895820 ACTTCCATGCAGTCTGTGGAGGG + Intronic
933450252 2:82440290-82440312 ACTGCCATGCAGTCTGCAGAAGG + Intergenic
933879022 2:86649320-86649342 ACTGCCATTCATACAGGGCTGGG + Intronic
934572717 2:95382799-95382821 GCCGCCATGCATACAGGTGAAGG - Intronic
936561199 2:113541473-113541495 ACTCCCAGGGAGACAGGGGACGG + Intergenic
936838613 2:116740864-116740886 ACTGTCAAGGAGACAGGGGTAGG + Intergenic
938391101 2:130906779-130906801 ATAGCCATGCTGACAGGGGTAGG - Intronic
938640282 2:133270634-133270656 TCTGCCACGCAGAAAGGAGAGGG - Intronic
942366244 2:175230874-175230896 ACTGCCAGACATACAGTGGAGGG + Intergenic
943571663 2:189581392-189581414 CCTGCTATGCAGTCCGGGGAAGG - Intronic
944606541 2:201356448-201356470 ACTGCCATATAGGCAGGGCACGG - Intronic
946426656 2:219602001-219602023 GAGGCCATGCAGACAGTGGAGGG - Exonic
948075471 2:235162331-235162353 ACTGCCAGGCAGAAAAAGGAGGG + Intergenic
948981164 2:241495634-241495656 ACTGCTGTTCAGATAGGGGACGG - Exonic
1168767075 20:388896-388918 ACTGAGATGAAGACAGGAGAAGG + Intronic
1169385667 20:5147346-5147368 ACAGCCAGGCAGAAAGGGAAGGG + Intronic
1170510093 20:17067590-17067612 ACTGCCATGCTGAGATGGAATGG - Intergenic
1172435677 20:34927381-34927403 ACTGCCAGGCAGAAAGGACAGGG + Exonic
1172704614 20:36873684-36873706 ACTGCCATTCAGAAAAGGGAAGG - Intergenic
1174158246 20:48531226-48531248 GCTGAAATGCAGACAGGGGTGGG + Intergenic
1174207424 20:48850820-48850842 TTTGCCAGGCAGACAGAGGAAGG - Intergenic
1174968889 20:55251534-55251556 ATTACCATGGAGACAGTGGATGG - Intergenic
1175602557 20:60286860-60286882 TCTGCCATGCAGAAAGGGGGTGG - Intergenic
1179420705 21:41234112-41234134 ACTGCCACGAAGACAGTGTATGG - Intronic
1180130122 21:45821740-45821762 GCTGTCATGCAGACTGGGGTTGG + Intronic
1180289036 22:10780138-10780160 ACTGCCTTGTAGAGAGGGGCTGG - Intergenic
1180482145 22:15763869-15763891 CCTGCCATGCAGCCAGAGGCTGG + Intergenic
1180760885 22:18203388-18203410 GCTGCCATGCAGACAGGTGAGGG + Intergenic
1180774784 22:18421272-18421294 GCTGCCATGCAGACAGGTGAGGG - Intergenic
1181276340 22:21689297-21689319 AGGGCCATGCACACAGGGGCCGG + Intronic
1182149125 22:28016457-28016479 GCTGCCATCCAGACAGCAGATGG + Intronic
1182522562 22:30892591-30892613 ACTGCCAGCAAGGCAGGGGAGGG + Intronic
1182680472 22:32075454-32075476 ACTGAGGTCCAGACAGGGGAAGG + Intronic
1184486525 22:44783255-44783277 AAAGCCCTGCAGGCAGGGGAGGG - Intronic
1185309194 22:50144300-50144322 AATGCCAAGTGGACAGGGGAGGG + Intronic
949372215 3:3347740-3347762 ACCCCCATACAGAAAGGGGATGG - Intergenic
950197805 3:11021653-11021675 ACGGACATGCAGACAGGCAATGG + Intronic
950529387 3:13544465-13544487 CCTGCCCTGGAGCCAGGGGAGGG - Intergenic
950580096 3:13856265-13856287 ACTGAGATGCGGACAGGAGAAGG - Intronic
950869917 3:16219661-16219683 ACTGGCATGGAGGCACGGGATGG - Intronic
952248060 3:31619039-31619061 GCTGGCATGGAGACAGGTGAAGG - Intronic
954263972 3:49459389-49459411 AAAGCCATCAAGACAGGGGAGGG + Intergenic
954550823 3:51480225-51480247 CCTGCCATGCAGACATGCCAAGG + Intronic
955086498 3:55707744-55707766 CCTGCGATGCAGGCAGGGGTGGG + Intronic
956917753 3:73891037-73891059 TCTGCTGTGCAGACAGGAGATGG - Intergenic
956958876 3:74374579-74374601 CCTGCCCTGCAGACAAGTGAAGG + Intronic
957892621 3:86379485-86379507 ACTGACATGCTGCCAGGGGTAGG + Intergenic
958442906 3:94178443-94178465 ACGGGCTTGCAGACTGGGGAAGG - Intergenic
959565264 3:107826665-107826687 TCGGCCAAGGAGACAGGGGAAGG - Intergenic
961537478 3:127578885-127578907 CAGGCCCTGCAGACAGGGGAAGG + Intronic
961641003 3:128364820-128364842 GCTGCCATGCAGGCTGTGGAGGG - Intronic
961668249 3:128507420-128507442 ACAGCCATGCAGCCAGGGCTGGG + Intergenic
962681115 3:137801426-137801448 TCTGCCAAGGAGACAGAGGAGGG + Intergenic
963785731 3:149532683-149532705 GTTGCCATCCAAACAGGGGAGGG + Intronic
965672273 3:171159034-171159056 ACAGCCATGCAGGCACGGGAAGG + Intronic
966583517 3:181595325-181595347 ACTGCCATGAACACAGAGGCAGG + Intergenic
970092651 4:12427606-12427628 ACTGCTATGCATACAGCGGAAGG - Intergenic
970376498 4:15463010-15463032 ACTGTGATGCAGAGAGAGGATGG + Intergenic
972926663 4:44016810-44016832 ACTGCCACGCAGAAAAAGGAGGG + Intergenic
972926684 4:44016968-44016990 ACTGCCACGCAGAAAAAGGAGGG + Intergenic
972926690 4:44017011-44017033 ACTGCCACGCAGAAAAAGGAGGG + Intergenic
974385857 4:61201504-61201526 ACAGCCACGGAGAAAGGGGAAGG - Intronic
974720836 4:65736386-65736408 GCTACCATCCAGCCAGGGGATGG - Intergenic
975024778 4:69534550-69534572 AGTGCCATGTTGACAAGGGATGG + Intergenic
976795808 4:88931141-88931163 ACTCCCATGCACCCATGGGAGGG - Intronic
980661167 4:135860408-135860430 ACTCACAGGCAGACAGGTGAGGG - Intergenic
982138437 4:152295015-152295037 ACAGCAAAGCAGATAGGGGAGGG - Intergenic
983090075 4:163493085-163493107 ACTGCCATGCAGAAAAAGGAGGG - Intergenic
983913043 4:173261326-173261348 AAACCCATGCAGACAAGGGAAGG + Intronic
985158109 4:187014341-187014363 GGAGCTATGCAGACAGGGGAAGG + Intergenic
985746211 5:1649604-1649626 ACAAACATGCAGTCAGGGGAAGG + Intergenic
986370062 5:7071178-7071200 ACCGACATGCAGACAGGTGGAGG + Intergenic
987878363 5:23710468-23710490 ATTGGCATGGAGCCAGGGGATGG + Intergenic
988455231 5:31381638-31381660 AGTGCCATCCAGGCAGAGGAGGG - Intergenic
990105709 5:52256952-52256974 AGTTCCAAGCAGCCAGGGGAAGG - Intergenic
990280766 5:54248472-54248494 TAAGCCATGCAGACAGTGGAGGG - Intronic
995175150 5:109167755-109167777 ACTCCCATTCAGATAGGGTAAGG - Intronic
995506145 5:112862359-112862381 ACTGCCACGCAGAAAAAGGAGGG + Intronic
998076370 5:139239936-139239958 AACGACATGAAGACAGGGGAAGG + Intronic
998544084 5:143011094-143011116 AGTGCAATGCAGAGAGGGGTAGG - Intronic
999288853 5:150410264-150410286 ACTGTGGTGCAGAGAGGGGAAGG - Intronic
1001461914 5:171923868-171923890 AATCCTAGGCAGACAGGGGAGGG + Intronic
1002526785 5:179819652-179819674 ACTGCCTTGCAGACAGGGGCAGG - Intronic
1004118409 6:12794384-12794406 TTTGCCAGGCAGACAGGGTAAGG + Intronic
1006650822 6:35549879-35549901 ACTGCCAGGCTGACTGTGGAAGG + Intergenic
1006812323 6:36827902-36827924 GCTGCTGTGCAGACAGCGGAAGG - Intronic
1007543807 6:42675211-42675233 ACTGCCATGCAGACAGCAGGAGG + Intronic
1007709000 6:43809721-43809743 ACTGCCATACAGAAGGCGGATGG + Intergenic
1007942649 6:45797133-45797155 ACTGCTAGGCTGACAGGAGAGGG + Intergenic
1010083495 6:71888627-71888649 ACTGACACTCAGATAGGGGAGGG + Intronic
1010780985 6:79946510-79946532 ACTGCAGTGCAGTCAGGGGGAGG - Intronic
1011577677 6:88822034-88822056 AGTGCTGTGCAGTCAGGGGAAGG + Intronic
1012758400 6:103263571-103263593 ACTTCTAGGCAGACAGGGGTGGG + Intergenic
1013216209 6:108029458-108029480 CCTGCCATGCAGACCAGGGATGG - Intergenic
1013225270 6:108116087-108116109 ACTGGTATGCAGAAAGGGGTGGG + Intronic
1013815166 6:114089164-114089186 TCTACCATGTAGAGAGGGGAAGG + Intronic
1014096700 6:117469191-117469213 ATTCCCATTCAGACAGGGTAAGG + Intronic
1014314371 6:119844639-119844661 ACTGCACTGGAGCCAGGGGATGG + Intergenic
1016662374 6:146596475-146596497 ACTGAAATGCAGACAGGAAATGG - Intergenic
1017122416 6:151037143-151037165 ACAGCAATGCAGAATGGGGAGGG - Intronic
1019080774 6:169428093-169428115 ACTCCCATGAAGTCAGGGGAGGG + Intergenic
1019497770 7:1348360-1348382 ACTGCAATGCAGATAGAGGCTGG + Intergenic
1019756874 7:2777100-2777122 ACTCCCATTCAGATAGGGTAGGG - Intronic
1022340088 7:29459744-29459766 CCTGCCATGCAGGGAGGAGAGGG - Intronic
1023224061 7:37950698-37950720 AGTGCCATGCACATAGGGAAGGG + Exonic
1027440779 7:78217003-78217025 ACAGACATGCACACAGGGGATGG + Intronic
1027658910 7:80965500-80965522 ACTGGCATACAGGCAGGGGTGGG - Intergenic
1027775905 7:82463829-82463851 TCTGCCATGCAGAAAGGAGAGGG + Intergenic
1029128625 7:98312996-98313018 ACTGCCATGCACACAGCCGCAGG - Intronic
1030062523 7:105634229-105634251 ACTGGCGGGCAGACAGGGGACGG - Intronic
1030755771 7:113285977-113285999 ATTCCTATGCAGACAGGGGCTGG - Intergenic
1032326540 7:130934405-130934427 ACAGTCATGCAGACAGTTGATGG - Intergenic
1033082055 7:138307687-138307709 ACTTCCATTCATACAGGGTAAGG + Intergenic
1035249616 7:157588390-157588412 ACTGCCGGGGAGGCAGGGGAGGG - Intronic
1035391920 7:158509782-158509804 GCTGGCATGCACACAGAGGATGG + Intronic
1035582043 8:746538-746560 ACTGCCATGACCACAGTGGACGG - Intergenic
1036181065 8:6585793-6585815 ACTGCCCTGCAGTCATGGGATGG - Intronic
1039056225 8:33539081-33539103 ACAGCATTGCAGACAGGGTATGG + Intergenic
1040305186 8:46208336-46208358 ACAGCCATGCAGAGGGGAGAAGG + Intergenic
1040692779 8:49959827-49959849 TGTGCCATGCAGATAGGGAAAGG - Intronic
1041337246 8:56800259-56800281 TCAGCCAGGCAGAGAGGGGAAGG + Intergenic
1041629042 8:60064130-60064152 ACTTCCATGTGGACAGGGGGTGG + Intergenic
1041955783 8:63556832-63556854 ACTGCAATCCAGGCAGAGGATGG - Intergenic
1044697539 8:94937877-94937899 ACTCCCATTCAGATAGGGTAAGG - Intronic
1045260517 8:100569411-100569433 ACCGCCATTCAGATAGGGTAAGG + Intergenic
1046190968 8:110793372-110793394 ACTCTCATTCAGATAGGGGAAGG - Intergenic
1047710843 8:127550747-127550769 ACTACCCTGCAGAGAGTGGAGGG + Intergenic
1047982606 8:130198483-130198505 ACTGCCTTGCAGACGAGGCAGGG - Intronic
1048436668 8:134424692-134424714 ACTGTCCTGCAGACAGAGGCAGG - Intergenic
1048500996 8:134974881-134974903 CCTGTCTTGCAGACTGGGGAAGG - Intergenic
1048634229 8:136278595-136278617 AGTGCCATGAAGTCAGGGGTAGG + Intergenic
1048974816 8:139665285-139665307 CCTGCTTTGAAGACAGGGGAAGG - Intronic
1049417970 8:142504206-142504228 ACTGGCAGCCAGACAGGGGCTGG + Intronic
1049818160 8:144618179-144618201 TTTGCCATGCAGGCAGGCGAGGG - Intergenic
1050707256 9:8415726-8415748 ACAGACATGCAGACAATGGAGGG + Intronic
1051746926 9:20303851-20303873 GCTAACATGCAGACAGGGCAGGG + Intergenic
1052359551 9:27539552-27539574 ACTGTCATGAAGCCAGAGGAAGG - Intergenic
1053272998 9:36762885-36762907 GGTGTCATGCAGACAGGGGCAGG + Intergenic
1056320593 9:85431218-85431240 ACTGCGACCCTGACAGGGGAGGG + Intergenic
1057268422 9:93633784-93633806 ATGACCATGCAGACAGGTGACGG + Intronic
1057311145 9:93944037-93944059 AGTGCCATGAAGACAATGGAAGG + Intergenic
1057566827 9:96172419-96172441 ACTAGCATGGGGACAGGGGAAGG - Intergenic
1057863765 9:98663149-98663171 ACTGTCATCAAGACAGTGGAGGG + Intronic
1059771558 9:117431231-117431253 ACAGCTTTGGAGACAGGGGAGGG + Intergenic
1059918584 9:119132234-119132256 ACTGGCATTCAGAAAGGTGATGG + Intergenic
1060478494 9:124002037-124002059 GCTGCCAAGCAGGCTGGGGATGG + Intronic
1061090465 9:128423084-128423106 ACTGCCCTGCAGAGAGGGAGGGG + Intronic
1061241727 9:129378485-129378507 ACAGCCCTGCAGCCAGGGGTGGG + Intergenic
1187260593 X:17682104-17682126 ACTGCCAAGCAGAGTGGGCAAGG + Intronic
1187966832 X:24620336-24620358 ACTGCAATGGGGAGAGGGGATGG - Intronic
1189221177 X:39373564-39373586 GCTGCCTTGCAGCAAGGGGAAGG - Intergenic
1189296259 X:39920409-39920431 ACTGAGACCCAGACAGGGGAGGG + Intergenic
1191943228 X:66502215-66502237 ACTCCCGTTCAGACAGGGTAGGG - Intergenic
1191943386 X:66503451-66503473 ACTCCCATTCAGACGGGGTAAGG + Intergenic
1192050067 X:67716644-67716666 AATGCCAGGCAGAAAGAGGATGG + Intronic
1194491200 X:94551916-94551938 ACTGCCATGCAGAAAAAGAAGGG - Intergenic
1198845584 X:140906938-140906960 CCTGCCACCCAGACATGGGATGG - Intergenic
1201411772 Y:13705433-13705455 CCTGCCAGCCAGACAGGCGATGG - Exonic