ID: 1096257512

View in Genome Browser
Species Human (GRCh38)
Location 12:50072414-50072436
Sequence CAGAACACACAGAGGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 398}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096257502_1096257512 29 Left 1096257502 12:50072362-50072384 CCTGGAGACTTGGCTGATGGCTC 0: 1
1: 0
2: 4
3: 29
4: 181
Right 1096257512 12:50072414-50072436 CAGAACACACAGAGGGGCCAGGG 0: 1
1: 0
2: 2
3: 30
4: 398
1096257504_1096257512 1 Left 1096257504 12:50072390-50072412 CCTCAACCAGTGGCCCTGAGTAA 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1096257512 12:50072414-50072436 CAGAACACACAGAGGGGCCAGGG 0: 1
1: 0
2: 2
3: 30
4: 398
1096257505_1096257512 -5 Left 1096257505 12:50072396-50072418 CCAGTGGCCCTGAGTAATCAGAA 0: 1
1: 0
2: 2
3: 28
4: 279
Right 1096257512 12:50072414-50072436 CAGAACACACAGAGGGGCCAGGG 0: 1
1: 0
2: 2
3: 30
4: 398
1096257501_1096257512 30 Left 1096257501 12:50072361-50072383 CCCTGGAGACTTGGCTGATGGCT 0: 1
1: 0
2: 2
3: 24
4: 290
Right 1096257512 12:50072414-50072436 CAGAACACACAGAGGGGCCAGGG 0: 1
1: 0
2: 2
3: 30
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096257512 Original CRISPR CAGAACACACAGAGGGGCCA GGG Intronic
900432161 1:2607504-2607526 CAGGACACACACAGGCCCCAGGG - Intronic
901544405 1:9944629-9944651 CACAACACTTTGAGGGGCCAAGG - Intronic
902233696 1:15044276-15044298 CAGAACACAAGCAGGGGGCAGGG + Intronic
902288105 1:15419518-15419540 CAGGAAAAAGAGAGGGGCCAGGG + Intronic
902368061 1:15990211-15990233 CAGGACACAGAGGGTGGCCACGG - Intergenic
902718012 1:18285931-18285953 GTGAACACACAGAGAGCCCAGGG - Intronic
903063797 1:20687254-20687276 CAGCAGACACAGTGGAGCCACGG + Intronic
903157692 1:21459472-21459494 AAGAACACACAGGAGGGCTATGG + Intronic
904331573 1:29761344-29761366 CAGCACACCCAGGGGGCCCAAGG - Intergenic
904451617 1:30616507-30616529 CCCAACACTCTGAGGGGCCAAGG - Intergenic
905654403 1:39676818-39676840 CAAATCATACAGAGGGGCAAGGG + Intergenic
905895987 1:41546050-41546072 CACTAAACTCAGAGGGGCCATGG - Intronic
906528182 1:46508604-46508626 CAGAGCACAGAGAGGAGTCAGGG + Intronic
907242122 1:53086606-53086628 CAGGGCACACAGAAGGGCCCTGG - Intergenic
907426721 1:54384381-54384403 CAGACTGCACAGAGGGGCCCTGG + Intronic
907926963 1:58964383-58964405 CAAGACACAAGGAGGGGCCATGG - Intergenic
908968317 1:69794175-69794197 CAGAACATAAACAGGGGACACGG + Intronic
910663261 1:89696453-89696475 AAGAACAGACAGAGGGGAGAGGG + Intronic
911016146 1:93334956-93334978 CAACACACACAGAGGGGAAATGG - Intergenic
911096997 1:94062756-94062778 GAGAAGACACAGAGGGACAAAGG + Intronic
911737586 1:101354602-101354624 TACAAAACACAGAGGGGGCAAGG - Intergenic
912282176 1:108327549-108327571 CAGGACACACAGAGTGGCAGTGG + Intergenic
917108372 1:171518751-171518773 CCCAACACTCTGAGGGGCCAAGG - Intronic
920943818 1:210509687-210509709 CAGCACACACAGAGTGGAGAAGG - Intronic
920964771 1:210692677-210692699 CAGAACACAGAGAAAGGCCATGG + Intronic
921278707 1:213544533-213544555 GGGAACACACAGAGGGGCCACGG - Intergenic
922887313 1:229030059-229030081 CTGACCACACAGAGGTGCCTGGG - Intergenic
922986541 1:229870297-229870319 CAGGAGACCCAGAGGGCCCATGG + Intergenic
923113451 1:230912067-230912089 CAGAACACAGAGAAGGGGCGTGG + Intronic
1062931726 10:1357320-1357342 CAGAGCACTCAGAGAGGTCACGG - Intronic
1063045526 10:2388382-2388404 CAGCACACACAGAGGATCCTTGG - Intergenic
1068674494 10:59755899-59755921 CAGAGCCTTCAGAGGGGCCATGG + Intergenic
1069636050 10:69925666-69925688 CAGAACAGCCAGCGGGGCCCTGG - Intronic
1069806174 10:71126499-71126521 CAGAAGACACGGCGGTGCCAGGG - Intergenic
1069821302 10:71230331-71230353 CTGAACACACAGAGAAGCCAAGG + Intronic
1069830479 10:71279536-71279558 CATTACAGACAGAGAGGCCAAGG - Intronic
1070378547 10:75858173-75858195 CTGAGTAGACAGAGGGGCCAGGG - Intronic
1070521585 10:77258387-77258409 CACAAGACATAGAAGGGCCATGG + Intronic
1070900209 10:80022118-80022140 CAGAAAACACTGAGGGTCAATGG + Intergenic
1070901963 10:80037988-80038010 CAGAAAACACTGAGGGTCAATGG + Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1072204798 10:93193752-93193774 AAGAACACACAGAAGGAACAAGG + Intergenic
1072623989 10:97099200-97099222 CAGGACGAAGAGAGGGGCCAGGG + Intronic
1072781544 10:98255119-98255141 GAGAACACACAGCTGGGCCTTGG + Intronic
1074446332 10:113524223-113524245 AAGAACACACTGATGGACCATGG - Intergenic
1075103147 10:119519803-119519825 CAGAATTCACGGAGGGGACAGGG - Intronic
1075386452 10:122058877-122058899 AAAAACACACAGAGGGGGCTGGG - Intronic
1075522183 10:123149538-123149560 GAGAACAGACAGAAAGGCCATGG - Intronic
1076138202 10:128059299-128059321 CAGCCCACACAGGGTGGCCAGGG - Intronic
1076908125 10:133373313-133373335 CAGGACACGCAGGGCGGCCATGG + Exonic
1076946690 10:133656483-133656505 CCTAACACACAGTGGGGGCAGGG - Intergenic
1077179361 11:1205305-1205327 CTGAACCAACAGAGGAGCCATGG + Intergenic
1077190878 11:1255591-1255613 CAGGACACTCAGAGAGGCCGAGG - Intronic
1077190900 11:1255650-1255672 CAGGACACTCAGAGAGGCCGAGG - Intronic
1077190922 11:1255709-1255731 CAGGACACTCAGAGAGGCCGAGG - Intronic
1077190944 11:1255768-1255790 CAGGACACTCAGAGAGGCCGAGG - Intronic
1077190966 11:1255827-1255849 CAGGACACTCAGAGAGGCCGAGG - Intronic
1077190988 11:1255886-1255908 CAGGACACTCAGAGAGGCCGAGG - Intronic
1077191010 11:1255945-1255967 CAGGACACTCAGAGAGGCCGAGG - Intronic
1077191032 11:1256004-1256026 CAGGACACTCAGAGAGGCCGAGG - Intronic
1077191052 11:1256063-1256085 CAGGACACTCAGAGAGGCCGAGG - Intronic
1078451902 11:11446714-11446736 GAGAACAGACCGAGGGGGCAAGG - Intronic
1079328083 11:19511687-19511709 CAGAACAGAAAGAAGGGCGACGG - Intronic
1083791579 11:64989461-64989483 CAGCAACCACAGCGGGGCCAAGG + Exonic
1084129048 11:67119395-67119417 CAGGAAAGACAGAGCGGCCACGG - Intronic
1084429787 11:69104800-69104822 CAAAACTCACAGTGGAGCCAGGG - Intergenic
1084474450 11:69380926-69380948 CAGAGCCCACAAAGGGGCCCTGG + Intergenic
1084551550 11:69846179-69846201 GAGAAGACACAGAGGGGAGAAGG + Intergenic
1084605797 11:70170929-70170951 CAGCGCAAACAGTGGGGCCAGGG - Exonic
1086063537 11:82723972-82723994 CAGCACACATAAAGGGGACAGGG + Intergenic
1086412803 11:86559151-86559173 GAGAACTCACAGAGGAGGCAGGG + Intronic
1088727022 11:112648214-112648236 GAGAACACTCAGAGAGGCCTTGG + Intergenic
1089029183 11:115305647-115305669 CAGAAAACACAGAGGGGAGGAGG - Intronic
1091400222 12:176778-176800 CAGAAAACAGAGGAGGGCCAGGG - Exonic
1092215324 12:6678049-6678071 CAGAACACAATGAGGGTACAGGG + Intronic
1092678459 12:10949003-10949025 CAGAACACTGAGAGGGAACATGG - Intronic
1094817162 12:34199464-34199486 CAGAACACACATATGCACCATGG + Intergenic
1095099858 12:38169250-38169272 CAGAACACACATATGCACCATGG - Intergenic
1095655645 12:44666838-44666860 CAGAACACTGAGAGGGGAGAAGG - Intronic
1096257512 12:50072414-50072436 CAGAACACACAGAGGGGCCAGGG + Intronic
1097019741 12:56011864-56011886 GAGAAGACGCAAAGGGGCCAGGG - Intronic
1098803528 12:74992221-74992243 CAGACCACACAGCAGGACCAGGG + Intergenic
1099641050 12:85284779-85284801 CAGAACACACACAAAGACCAAGG - Intronic
1101570406 12:105948356-105948378 CTGAACCCACAGAGTGGGCAAGG - Intergenic
1102584480 12:113913545-113913567 TAGAACAAACAGAGGGGAAAAGG + Intronic
1103012130 12:117465713-117465735 CAGGAAACACAGAGGGGCTGTGG + Exonic
1103147828 12:118610829-118610851 CAGGAAGCAGAGAGGGGCCAGGG - Intergenic
1103898517 12:124290875-124290897 CAGATCACACAGCCGGGACATGG + Intronic
1104092761 12:125529522-125529544 CAGGACACACAGAGGTGGGAAGG - Intronic
1104645845 12:130496745-130496767 CAGGCCACCCAGAGGAGCCAAGG + Intronic
1105414557 13:20198061-20198083 CAGATCACAAAGAGGAGCCCTGG - Intergenic
1105717833 13:23084878-23084900 TGGAACACACAGAGGAGGCATGG + Intergenic
1108432763 13:50371031-50371053 CAGAGCACACAGAGGGGAGGAGG + Intronic
1108526555 13:51290609-51290631 CAGAACACTCAAAGGGGGCTAGG - Intergenic
1109308440 13:60664463-60664485 CAGGATATACAGTGGGGCCATGG + Intergenic
1110055103 13:70958014-70958036 AAGAAGACACAGACGGGGCAAGG + Intergenic
1110304816 13:73973431-73973453 CAAAACAGACAGAGAGGGCAAGG + Intronic
1112618245 13:101027346-101027368 AAGAACACAGAGAGCAGCCATGG - Intergenic
1113028220 13:105964641-105964663 CAGAACATATAGAGGAGACAAGG - Intergenic
1113567459 13:111327390-111327412 AACAACTTACAGAGGGGCCAGGG + Intronic
1113701255 13:112390277-112390299 CAAACCATACAGAGTGGCCATGG - Intronic
1113777360 13:112955395-112955417 CTGAACACAAAAATGGGCCATGG - Intronic
1114650891 14:24284047-24284069 CAGGACACACTGAGGGGGCAAGG + Intergenic
1115136604 14:30116842-30116864 AAGAGCAAACAGAGGGGACAAGG + Intronic
1118709534 14:68508307-68508329 CAGAATTCACTGAGGAGCCATGG - Intronic
1119527535 14:75334123-75334145 CTGAATACCCCGAGGGGCCAGGG + Intergenic
1119535274 14:75397793-75397815 CAGTTCAGACAGAGGGGACAAGG + Intergenic
1119765826 14:77187164-77187186 CAGAACCCAAACTGGGGCCATGG + Intronic
1120259165 14:82160417-82160439 CAGAACACACAAAGGAGCTAAGG - Intergenic
1121010809 14:90519048-90519070 CAGAAGACACAGAAGGCACAGGG - Intergenic
1121226903 14:92327716-92327738 CAGAGCCCACAGCGGGGCAAAGG - Intronic
1122348783 14:101076162-101076184 GAGAGCCCTCAGAGGGGCCATGG + Intergenic
1122442087 14:101738930-101738952 GAGAACACAGAGAGGGGAGAGGG + Intergenic
1122942815 14:104990024-104990046 CACCACACACAGAGGGCACACGG - Intronic
1122969380 14:105146310-105146332 CTGATCTCACAGAGTGGCCAGGG + Intronic
1202920773 14_KI270723v1_random:29037-29059 CCTAACACACAGTGGGGGCAGGG - Intergenic
1202924143 14_KI270724v1_random:8544-8566 CCTAACACACAGTGGGGGCAGGG + Intergenic
1123626672 15:22231881-22231903 CAGAACCGACAGATGAGCCAGGG + Intergenic
1123930501 15:25169275-25169297 CATAACACACAGAGCAGGCATGG - Intergenic
1124895833 15:33776637-33776659 CAGAAAGCACAGTGGGGACAGGG - Intronic
1128326337 15:66726348-66726370 CAGACTGCACAGAGAGGCCAAGG + Intronic
1128738575 15:70067649-70067671 CAGAACACAGTGAAGGCCCATGG + Intronic
1129379236 15:75154926-75154948 CAGAACACCCAGCAGGGTCAGGG - Intergenic
1130027939 15:80285991-80286013 GAGGACAGACAGAGGGGTCAGGG - Intergenic
1130104653 15:80920307-80920329 CAGCACACAGAGAGGGGTCCAGG - Intronic
1130107643 15:80941034-80941056 TTGGACTCACAGAGGGGCCATGG - Intronic
1130289861 15:82589229-82589251 CAGAACAAACAGCAGGGCCTTGG - Intronic
1130404561 15:83586448-83586470 CAAAACGCATAGAGGGGACAGGG + Intronic
1131065796 15:89434252-89434274 CAGACCACACAGATGGGAAACGG - Intergenic
1131952421 15:97694942-97694964 CTGCACACACAGAGAGTCCAGGG + Intergenic
1133133946 16:3696240-3696262 CGGAGCACACAGAGGAGCCTAGG + Intronic
1133383890 16:5353429-5353451 CACCACACACAGAGGGGCGGAGG - Intergenic
1133989402 16:10692853-10692875 CAGAACAGAGAGAGGAGCCTGGG + Intronic
1134162971 16:11907187-11907209 CAGAACACAGAGAAATGCCATGG + Intronic
1135435567 16:22424761-22424783 CGAAACAAACAGAGAGGCCAAGG - Intronic
1135503993 16:23020523-23020545 CTGAACACAGAGAGTGGCAAAGG + Intergenic
1135843111 16:25894435-25894457 CAGAAATCCCAGAGGGGCCGGGG - Intronic
1136036795 16:27546731-27546753 CAGATAACACAGAGGGGGCAAGG - Intronic
1136075407 16:27813774-27813796 CAGGAAACACGGAGGGGACAAGG + Intronic
1136419325 16:30122481-30122503 CAGAGCACACGGTGGGGCCGGGG + Intronic
1137671707 16:50283107-50283129 CTGAACCCACTGAGGGGCCACGG + Intronic
1137974948 16:53023377-53023399 TAGAAAAAAAAGAGGGGCCAGGG + Intergenic
1138458089 16:57132762-57132784 CAGGTCACACAGTGGGGCCTGGG - Intronic
1138490848 16:57375655-57375677 CAGGACACACAGCTGGGCAATGG + Intronic
1141046822 16:80722985-80723007 GAGAAGACATAGAGGGGCCATGG + Intronic
1141541321 16:84724718-84724740 CACAACACACACAGGGGTCAGGG - Intronic
1141937454 16:87250926-87250948 GTGAACACACAGAAGTGCCAAGG + Intronic
1142116001 16:88356369-88356391 CAGTACACAGGGAGGGGGCAGGG + Intergenic
1142219130 16:88844495-88844517 CAGGCCAGACAGAGGGGCCTCGG - Intronic
1142272605 16:89098369-89098391 CAGATCCCACAGAGGGGGCGTGG + Intronic
1142847497 17:2689363-2689385 CAGAACACACAGGTGAGCCTGGG + Intergenic
1142891681 17:2948024-2948046 CAGGACACACGGAGGGGACAAGG - Intronic
1142968261 17:3594433-3594455 CAGAGCACACAACTGGGCCATGG + Intronic
1143180542 17:4981610-4981632 CAGGGCTCCCAGAGGGGCCATGG - Intronic
1143205167 17:5136150-5136172 CAGGACACAGAGGGTGGCCATGG - Intronic
1143735570 17:8909878-8909900 AAGAATACAGAGAGGAGCCACGG + Intronic
1144267096 17:13580595-13580617 CAGAACACACACAGTGGACCAGG + Intronic
1144851401 17:18245889-18245911 GGGCACACACAGAGGAGCCAGGG - Intronic
1144876218 17:18398842-18398864 CAGGACACAGAGGGTGGCCACGG - Intergenic
1145063546 17:19747315-19747337 CAGAACATAGGGAGGGACCATGG - Intronic
1145156010 17:20545578-20545600 CAGGACACAGAGGGTGGCCACGG + Intergenic
1146482216 17:33213865-33213887 GAGAATGCCCAGAGGGGCCAGGG - Intronic
1146843475 17:36169646-36169668 CAGGACACAGAGGGTGGCCACGG + Intronic
1146855783 17:36257584-36257606 CAGGACACAGAGGGTGGCCACGG + Intronic
1146864837 17:36330791-36330813 CAGGACACAGAGGGTGGCCACGG - Intronic
1146871690 17:36381495-36381517 CAGGACACAGAGGGTGGCCACGG + Intronic
1146879049 17:36432577-36432599 CAGGACACAGAGGGTGGCCACGG + Intronic
1146882989 17:36453723-36453745 CAGGACACAGAGGGTGGCCACGG + Intergenic
1147067696 17:37931385-37931407 CAGGACACAGAGGGTGGCCACGG - Intronic
1147074576 17:37982119-37982141 CAGGACACAGAGGGTGGCCACGG + Intronic
1147079227 17:38010940-38010962 CAGGACACAGAGGGTGGCCACGG - Intronic
1147086099 17:38061658-38061680 CAGGACACAGAGGGTGGCCACGG + Intronic
1147095166 17:38134882-38134904 CAGGACACAGAGGGTGGCCACGG - Intergenic
1147102044 17:38185623-38185645 CAGGACACAGAGGGTGGCCACGG + Intergenic
1147254846 17:39175397-39175419 CTGACCCCTCAGAGGGGCCAGGG - Exonic
1147490831 17:40864375-40864397 CAGAAAACTCTGAGGTGCCATGG - Intronic
1148240267 17:45995781-45995803 CAAATCCCACAGAGGAGCCAGGG + Intronic
1149660777 17:58332978-58333000 GAGCACACGCAGAGGAGCCAGGG - Intergenic
1149846636 17:60012134-60012156 CAGGACACAGAGGGTGGCCACGG + Intergenic
1149982693 17:61323846-61323868 AGGAACCCACACAGGGGCCAGGG - Intronic
1150084982 17:62268708-62268730 CAGGACACAGAGGGTGGCCACGG + Intergenic
1150714056 17:67556544-67556566 CAGGGCACACTGATGGGCCAAGG + Intronic
1151523049 17:74644863-74644885 ATGAAGACACAGAGGGGTCAGGG - Intergenic
1152260143 17:79262372-79262394 CAGATCCCACTGAGGGGACACGG + Intronic
1152263840 17:79282004-79282026 AAGAAAACACTGAGGGGGCAGGG + Intronic
1152359209 17:79822916-79822938 AAGAACACAGAGAGAGGCCAAGG - Intergenic
1152419490 17:80184418-80184440 CAGGCTACACAGAGGGGCCTGGG - Intronic
1152423951 17:80208991-80209013 CCGAACAGGCACAGGGGCCACGG - Exonic
1152559590 17:81071288-81071310 CAGAGCCCCCACAGGGGCCAGGG - Intronic
1152782793 17:82233604-82233626 CAAAACACAAAGAGGTACCAAGG - Intronic
1153141103 18:1973436-1973458 CAGAACACAGAGGAGGGCCTCGG + Intergenic
1155331340 18:24721646-24721668 TAGAAAAAACAGATGGGCCAAGG - Intergenic
1155518299 18:26644330-26644352 CAGAAAAGACAGAGAGGTCAAGG + Intronic
1155883711 18:31182405-31182427 CAGAACACTGAGAGGAGCCAGGG + Intergenic
1157228453 18:45890246-45890268 GAGAGCACACAGAAGGGCTACGG - Intronic
1158279397 18:55804777-55804799 CAGAGCTCACATAAGGGCCAGGG - Intergenic
1158446411 18:57526166-57526188 CAGAAGGCACTGAGGGGTCAAGG + Intergenic
1159596115 18:70384262-70384284 CAGGACTCACTGAGGAGCCAGGG - Intergenic
1159922511 18:74238370-74238392 CAGGACACACTGAGGAGCCGGGG + Intergenic
1160391954 18:78540611-78540633 CAGAGCAGAGAGAGGGGCCAGGG + Intergenic
1160992816 19:1867123-1867145 CGGGACTCTCAGAGGGGCCACGG + Intergenic
1161059684 19:2208668-2208690 CAGAACAGACACAGGGCCCTGGG - Intronic
1161850283 19:6734384-6734406 GAGGACACGCAGAGGGTCCAAGG - Intronic
1162398600 19:10431788-10431810 CAGAAGAGGAAGAGGGGCCAGGG + Intronic
1162967998 19:14164903-14164925 CAGAACCCACACATAGGCCAGGG + Intronic
1163815226 19:19460938-19460960 CAGAGCACACAGAGGGACGGGGG - Intronic
1163926760 19:20353257-20353279 AAGAGCACACAGAGGGGGGAGGG - Intergenic
1164542053 19:29128630-29128652 GAGAACACACACAGGGACGATGG + Intergenic
1164542167 19:29129228-29129250 TAGAACACACACAGGGACGATGG + Intergenic
1166035061 19:40162029-40162051 CAGATCACACTCTGGGGCCATGG + Intergenic
1166200143 19:41232107-41232129 GTGACCACACAGAGTGGCCAGGG - Intronic
1168160245 19:54505666-54505688 CAGAACAAAGAGAGGTGCCTGGG - Intronic
1168567205 19:57435239-57435261 CAGAAGACACTGCGGGGGCAGGG + Intronic
1202665483 1_KI270708v1_random:115240-115262 AAGAAAACACAGTTGGGCCAGGG + Intergenic
925123510 2:1437771-1437793 CTGAACACAGAGATGGGTCAGGG + Intronic
925512079 2:4638829-4638851 AAGAACACACAAAGGAACCAGGG - Intergenic
925662622 2:6219086-6219108 GAGAACACAAAGAGGCGACATGG + Intergenic
926002214 2:9342839-9342861 CAGAAGACACAGGGAGGTCACGG - Intronic
926006006 2:9373928-9373950 CAGCACACACAGTGGGTCCCGGG - Intronic
926284889 2:11481494-11481516 CAGGACCCACAGTGGGGCCTTGG - Intergenic
926724433 2:15986514-15986536 CAGTACAGACAAAGGGGCCTTGG - Intergenic
926772972 2:16394314-16394336 CAGAACCCAGAGAGGGGCAAGGG - Intergenic
927137869 2:20110569-20110591 CAAGCCACACAGAGAGGCCACGG - Intergenic
927391723 2:22603704-22603726 CAGAACACACTGAGACACCATGG + Intergenic
928352494 2:30572748-30572770 CAGAACTCACAGTAGAGCCAAGG - Intronic
929605717 2:43232815-43232837 CAGATCACACAGGACGGCCAGGG + Exonic
929631308 2:43465681-43465703 GAGATCACCCAGAGGGGCTAGGG - Intronic
931707621 2:64960401-64960423 CTGCACACTCTGAGGGGCCAAGG - Intergenic
933236019 2:79865586-79865608 CAGAACACACAGTGCAGGCAGGG + Intronic
935557011 2:104520947-104520969 CAATACACACAAAGGGGCAAGGG - Intergenic
936011678 2:108929134-108929156 CAGAAAACCCCGAGGGGCTACGG - Intronic
937321885 2:120965896-120965918 CTGACCCCACAGAGGGGCCAGGG - Intronic
938499398 2:131822548-131822570 GAGGACACACAGGGTGGCCAGGG + Intergenic
939654175 2:144802155-144802177 CAGAAATCACAGATGAGCCAAGG + Intergenic
942743261 2:179203496-179203518 TAGCACACCCAGAGAGGCCATGG + Intronic
943702496 2:191001764-191001786 CAGAACACTCAGAAGTGACAGGG + Intronic
945250657 2:207763903-207763925 CACAACACACACATGGGCCTTGG + Exonic
946083605 2:217149392-217149414 CAGAGCACACAGAGGCTCCAGGG + Intergenic
946299766 2:218815412-218815434 CAGACCTCACAGAGAGGCCTTGG + Intergenic
946434772 2:219644236-219644258 CAGCACACTCAGGGGGACCATGG + Intergenic
946687018 2:222280695-222280717 GAGAAGACCCAGAGGAGCCAAGG + Intronic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
948234609 2:236379084-236379106 CAGAGCACCCAGAGGGGCACTGG - Intronic
948699956 2:239753300-239753322 AAGAACACATGGAGGGGCCCAGG - Intergenic
948727930 2:239946092-239946114 CCGAACACACACAGCTGCCAAGG - Intronic
948792910 2:240388474-240388496 CAGACCACCCAGCGGGGACATGG + Intergenic
949042994 2:241857991-241858013 CAGTGTACACAGAGGGCCCAGGG + Intronic
1168849541 20:967173-967195 CAGAACACACGGGAGTGCCAGGG - Exonic
1171114583 20:22513651-22513673 CAGAACACACAGGGAATCCAGGG - Intergenic
1171158828 20:22902825-22902847 AAGAACAGACACTGGGGCCAGGG + Intergenic
1171779079 20:29402402-29402424 CAGAACACACATAAGCACCATGG + Intergenic
1172189561 20:33053839-33053861 CTGAGGACACAAAGGGGCCACGG - Intergenic
1173229638 20:41184044-41184066 CAGAACACCCAGAGTGCCCGTGG - Exonic
1173288986 20:41697851-41697873 CAAAGCACACAGAGGGGGCCCGG + Intergenic
1175180085 20:57140162-57140184 CCCAACACACTGTGGGGCCAAGG + Intergenic
1175532530 20:59683988-59684010 AAGAACGCAGAGAGGGGCAATGG + Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176147762 20:63573046-63573068 CAGGGCACACAGCCGGGCCAGGG + Intronic
1176184657 20:63771632-63771654 CAGATCACACCGAGGCGCCTCGG + Intronic
1176222056 20:63974425-63974447 CAAAGCACACAGAGGGGACTAGG + Exonic
1176687275 21:9862177-9862199 CTGCACACAGAGAGGGGCCCTGG - Intergenic
1179000998 21:37458037-37458059 CAGAACACACAGAGGCGGCCAGG - Intronic
1179002599 21:37477276-37477298 AGGAACACAAAGATGGGCCAGGG + Intronic
1179016694 21:37600127-37600149 CAGAACACACACAGAGGAGAAGG - Intergenic
1180045614 21:45303792-45303814 CAGAGCGCACAGAGGGGCCCTGG + Intergenic
1180056885 21:45363578-45363600 CAGAACACACACTGAGGCCTGGG - Intergenic
1180058018 21:45369068-45369090 CAGAACACACACCGAGGCCTAGG + Intergenic
1180629840 22:17220843-17220865 GTGAAAACACAGAGGGGTCAGGG + Intronic
1181052023 22:20242377-20242399 CAGGGCACGCAGGGGGGCCAGGG + Exonic
1181849161 22:25737453-25737475 CAGAAGACACAGTTGGGTCAGGG + Intergenic
1181968316 22:26671899-26671921 CAGAACACCCAGAGAGGCCAGGG - Intergenic
1183020055 22:35019554-35019576 CAGGTCACACAGCAGGGCCAGGG + Intergenic
1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG + Intronic
1183305162 22:37079101-37079123 CAGAAAACTCAGATGGGCCAAGG - Intronic
1184073708 22:42162901-42162923 AGGAACACACACAGAGGCCATGG + Intronic
1185092882 22:48785857-48785879 CAGTACAAACAGACAGGCCAAGG + Intronic
950519345 3:13487323-13487345 CAGCACACACAGAATGACCAGGG - Intronic
950715205 3:14842895-14842917 CCGCACAGACAGAGGGGCCAGGG - Intronic
950737701 3:15023644-15023666 CAGTACACACAAAAGGCCCAAGG + Intronic
952874427 3:37931448-37931470 GAGAAGACACAGAGGGGGCTGGG - Intronic
953335764 3:42092538-42092560 CAGAGCACAGAGGTGGGCCAGGG + Intronic
954151144 3:48657711-48657733 CAGGACACAGAGAGGAGCTAGGG + Intronic
954762181 3:52883075-52883097 CAAAACTTACAAAGGGGCCAAGG + Intronic
955021376 3:55124951-55124973 CAGAGCACACCAAGGGTCCATGG + Intergenic
957080766 3:75633927-75633949 CCTAACACACAGTGGGGGCAGGG + Intergenic
957086066 3:75678266-75678288 CAGAACACACATATGCACCATGG - Intergenic
957482398 3:80815781-80815803 AAGAACATACAGTTGGGCCATGG + Intergenic
957524267 3:81359109-81359131 CCCAACACACTGGGGGGCCAAGG + Intergenic
960307991 3:116086004-116086026 CAGAACACACAGAATGCCTAGGG - Intronic
962298055 3:134211887-134211909 CAGCACTGACAGAGAGGCCATGG + Intronic
962348637 3:134640875-134640897 GAGAATAAACAGAGGGGGCAAGG - Intronic
962832560 3:139157446-139157468 CAAAACAAACAGAAGGGCCAAGG - Intronic
963688311 3:148466206-148466228 CAGAAAAGAAAAAGGGGCCAAGG - Intergenic
963907290 3:150783151-150783173 CAGAACCCAGAGAGGGGCTGAGG + Intergenic
964028499 3:152107505-152107527 TAAACCAAACAGAGGGGCCAAGG - Intergenic
968054845 3:195683579-195683601 CAGAACCCACAGAGGCCACATGG - Intergenic
968101066 3:195965693-195965715 CAGAACGCACAGAGGCCACATGG + Intergenic
968627557 4:1634022-1634044 CAGAACACCAGGAGGGGCCCAGG + Intronic
969173508 4:5382536-5382558 CTGACCACAGAGAGGGACCAGGG - Intronic
969284579 4:6194907-6194929 CAGACCACACAGAGGGGAACAGG + Intronic
969477426 4:7429558-7429580 CAGAAAAGACAGAGGTGTCATGG + Intronic
969613505 4:8239778-8239800 CTGATCACACAGGGTGGCCAGGG - Intronic
969633434 4:8351599-8351621 CTGAGCACACAGAGGGGCTGTGG - Intergenic
970368881 4:15388392-15388414 TACAACATAAAGAGGGGCCAAGG + Intronic
971143654 4:23952024-23952046 GAGAACACACAGAGTGACCGTGG - Intergenic
971780658 4:31029870-31029892 CAGAACCCACAGAGTTGCCAAGG - Intronic
972306905 4:37839407-37839429 AGGAAAACACTGAGGGGCCAGGG - Intronic
972325225 4:38008809-38008831 CAGAACACAAACATGGGCGAAGG - Intronic
972523487 4:39884633-39884655 CAGAAACCAAAGAGGGGCTAAGG - Intronic
972629566 4:40831696-40831718 CAGAACACAAAGAGACACCATGG + Intronic
976428605 4:84936154-84936176 CAGAAGACATAGATAGGCCAGGG - Intronic
976591011 4:86849977-86849999 TAGAATGCACAGAGGGGCCCTGG - Intergenic
977105411 4:92876758-92876780 CAGAACACACAGGGAGGACAGGG + Intronic
977681948 4:99806932-99806954 GAGCACACACAGATGGTCCAAGG + Intergenic
977740203 4:100470842-100470864 ATGAACACATAGAGGGGTCAAGG + Intronic
980350677 4:131680284-131680306 CTGCACACAGAGAGGGGCCCTGG - Intergenic
983558349 4:169077887-169077909 CAGAACTCACCTAGTGGCCAAGG - Intergenic
983636707 4:169905242-169905264 CAGAAAATAAAGAGGTGCCATGG + Intergenic
983690953 4:170468303-170468325 CAAAAGACACAGAGATGCCAAGG + Intergenic
985122917 4:186661731-186661753 CAGAACCCAAAGAGAGGTCATGG + Intronic
985443954 4:190009273-190009295 CAGAACACACATATGCACCATGG + Intergenic
985450146 4:190057282-190057304 CCTAACACACAGTGGGGGCAGGG - Intergenic
985574899 5:669483-669505 CAGGACAGACAGAGGCCCCAAGG - Intronic
985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG + Intronic
986267846 5:6205787-6205809 GAGAACAGAGAGAGGGGCCCAGG - Intergenic
988128560 5:27074102-27074124 CAAAACACAGAGAGGGAACATGG + Intronic
988900976 5:35731910-35731932 CAGAAATCACAGAGGGTACAGGG + Intronic
988909729 5:35827152-35827174 CAGAAAACACACTGTGGCCATGG - Intergenic
991507567 5:67341426-67341448 CAGAACATACTTAGGGACCATGG - Intergenic
992023479 5:72648482-72648504 CAGAAAGCACAGAGAGGCCATGG - Intergenic
993467521 5:88267649-88267671 CAGAACACAAACGGGGGCAAGGG - Intronic
995182938 5:109245661-109245683 TAGATGACACAGTGGGGCCAGGG + Intergenic
995524778 5:113041742-113041764 CAGAGCACACTGTGAGGCCAAGG + Intronic
995599493 5:113780158-113780180 CTGAACACACAGAGGGTTCCTGG + Intergenic
999257011 5:150215343-150215365 CAGCAGATTCAGAGGGGCCATGG - Intronic
999479841 5:151937857-151937879 CAGAACACAGACAGAGGCTAGGG - Intergenic
999940478 5:156537234-156537256 CACAAAACACAGATGTGCCAAGG - Intronic
1000055157 5:157599559-157599581 GTAAACTCACAGAGGGGCCATGG + Intergenic
1000205971 5:159058909-159058931 CTGAACAGTCAGAGGGGCTATGG + Intronic
1001141780 5:169150612-169150634 CATAAGGCAAAGAGGGGCCAGGG - Intronic
1001397808 5:171429277-171429299 AGGAAGACACAGAGAGGCCACGG - Intronic
1001459160 5:171894112-171894134 AAGACTACACAGAGGAGCCAGGG + Intronic
1001787635 5:174427196-174427218 CCGCAAACACAAAGGGGCCAGGG + Intergenic
1002100644 5:176855925-176855947 AGGAACACAGCGAGGGGCCAGGG - Intronic
1002591437 5:180293453-180293475 CAGGATCCACAGAGTGGCCAGGG + Intergenic
1002791639 6:441571-441593 CAGGACCCACAGAGGGGTCTCGG + Intergenic
1002833804 6:848490-848512 CTGAACACCCAGAGGGGCAGAGG + Intergenic
1003152949 6:3568153-3568175 CAGAAAACACAGAGTGGTCCTGG - Intergenic
1003409933 6:5853124-5853146 TAGGACACACAGAGGGGCACTGG + Intergenic
1005466526 6:26121404-26121426 CAGAAAACTCAAAGGGTCCAGGG + Intronic
1005768049 6:29034722-29034744 AAGAACACACAATGGGGACAGGG - Intergenic
1006017644 6:31094948-31094970 GTGACCACAGAGAGGGGCCAAGG - Intergenic
1006467033 6:34201988-34202010 CAGAGCACACAGAGAGGTCTAGG + Intergenic
1007156454 6:39749721-39749743 CAGAAAGGACAGAGGGGTCAAGG + Intergenic
1007670981 6:43553571-43553593 CAGAAGACACAGAGAGACAATGG + Intronic
1008482046 6:51995952-51995974 CAGATCACTCAGAGGGTCCCAGG - Intronic
1010249288 6:73691702-73691724 CACACCACACACAGGGGCAATGG + Intergenic
1015301760 6:131660461-131660483 CAGCAGACAAAGAAGGGCCAGGG + Intronic
1017511556 6:155118683-155118705 CGCAACACACTGAGAGGCCAAGG - Intronic
1018660121 6:166078157-166078179 TACAACACAGAGAGCGGCCAAGG + Intergenic
1018985504 6:168633647-168633669 CAGGAGACACAGAAGGGCCAAGG + Intronic
1019442734 7:1055659-1055681 CAGAGCACACTGAGGGGTCCCGG + Intronic
1020071142 7:5227693-5227715 CAGAACACACACAGGGCCTGTGG + Intronic
1020457899 7:8395032-8395054 CACAACAAAAAGAAGGGCCAGGG - Intergenic
1021383567 7:19999975-19999997 CAGAACACACAATGGGGAAAGGG + Intergenic
1021877107 7:25059464-25059486 CAGAACTAGCATAGGGGCCATGG - Intergenic
1022780115 7:33573010-33573032 AAGAACAGAAAGAGGAGCCAGGG - Intronic
1022843846 7:34190690-34190712 CAAAGCTCACAGAGGGGCCAAGG + Intergenic
1023102916 7:36737172-36737194 GAGAAGACACAGAGGGTCCTTGG + Intergenic
1026358983 7:69585417-69585439 CAGAAGACACAGTGGGACCAGGG - Intergenic
1028077311 7:86532996-86533018 CAGAGCACTGAGAGGGGGCATGG - Intergenic
1028754865 7:94423260-94423282 CAGCACACACTGAGGGGCTGTGG + Intronic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1029241607 7:99167189-99167211 CAGAGGAGACAGTGGGGCCAGGG - Intergenic
1030359090 7:108576539-108576561 CAGAATAGACAGAGGGGCAATGG + Intergenic
1032341838 7:131080931-131080953 CAGAAGAGACAAAAGGGCCAGGG - Intergenic
1033126794 7:138713765-138713787 GCAAACACACAGAGGGGCCCAGG + Intronic
1034276738 7:149827134-149827156 CAGACCACACTGAGTGCCCAGGG - Intergenic
1035053742 7:156019916-156019938 CAGACCCCACTGAGGGGCCCGGG + Intergenic
1035288191 7:157819522-157819544 AAGCACACACCGAGCGGCCACGG + Intronic
1035352949 7:158259262-158259284 CAGGCCACAGAGAAGGGCCATGG + Intronic
1035936651 8:3848684-3848706 CAGATCACACAGATGGTGCAAGG - Intronic
1036078455 8:5526428-5526450 CAGACAGCACTGAGGGGCCAGGG + Intergenic
1036663298 8:10722197-10722219 CAGGACACACTGTGGGGGCATGG - Intergenic
1037337865 8:17809205-17809227 CAGAAGAGACAGAGAGGGCAGGG + Intergenic
1038212955 8:25536892-25536914 CAGAATACACATAGGGCCCTTGG - Intergenic
1038415345 8:27390871-27390893 CAGATCACACAACGGGTCCATGG + Intronic
1038723391 8:30058234-30058256 CAGCACATACAGAGGGAGCATGG - Intergenic
1041296017 8:56358457-56358479 CAGAAGACTGAGAGGGGGCATGG - Intergenic
1042164325 8:65930827-65930849 CAGAACGCAGAGAGGGCCCAGGG - Intergenic
1042226310 8:66517482-66517504 CAGAACATAGAGAAGGACCAAGG + Exonic
1043517020 8:81004133-81004155 CAAAACACACAGATGGTGCACGG + Intronic
1044843617 8:96359385-96359407 GAGAACACAAGGAAGGGCCAAGG - Intergenic
1045363338 8:101452991-101453013 CAGAACACACACAGAGATCATGG - Intergenic
1046605827 8:116371324-116371346 CAGAACACACAAAGGAGCAGGGG - Intergenic
1046711039 8:117512005-117512027 CAGAACACACAAAGCCCCCAGGG + Intergenic
1048181746 8:132201694-132201716 CAGCAAAGACATAGGGGCCACGG - Intronic
1048445608 8:134490588-134490610 CAGAGCTGACAGAGGGGCTACGG + Intronic
1049258090 8:141624552-141624574 CAGAGCAGAGGGAGGGGCCATGG + Intergenic
1049427204 8:142542781-142542803 CAGCACACCCAGCAGGGCCAGGG - Intronic
1049575484 8:143387891-143387913 GCGCACACAGAGAGGGGCCAGGG - Intergenic
1052172669 9:25420705-25420727 TAGAAAACAAAGAGTGGCCAAGG + Intergenic
1053782030 9:41619424-41619446 CTGCACACAGAGAGGGGCCCTGG + Intergenic
1054169982 9:61829578-61829600 CTGCACACAGAGAGGGGCCCTGG + Intergenic
1054667556 9:67751237-67751259 CTGCACACAGAGAGGGGCCCTGG - Intergenic
1056685988 9:88759776-88759798 AAGAGCACACAGTAGGGCCATGG - Intergenic
1056753557 9:89368410-89368432 GAGAGCACAGAGATGGGCCAGGG - Intronic
1056830798 9:89915720-89915742 CAGAACACACACAGGTTCCTGGG - Intergenic
1056893070 9:90514112-90514134 CAGAAAACCCAGAAAGGCCAGGG + Intergenic
1058461589 9:105188992-105189014 CAGAACACTGAGAGGGAACATGG - Intergenic
1060082673 9:120665854-120665876 CAGAACACACATTGGGGGAAAGG - Intronic
1060591221 9:124818126-124818148 CAGAGCTCACAGAGGGGAGATGG - Intergenic
1060799054 9:126532237-126532259 CAGAAGCCACAGGAGGGCCAGGG - Intergenic
1061805599 9:133136029-133136051 CAGACCACAGAGAGGGCCCGGGG + Intronic
1061849193 9:133404685-133404707 CAGAGCTCACACAGGGGCCTGGG - Intronic
1062190370 9:135244942-135244964 CAGAACACACAGAGGCTCTGGGG + Intergenic
1062194341 9:135264631-135264653 CAGAACACAAAGAGAAGGCAGGG - Intergenic
1062316231 9:135968409-135968431 CAGCACACCCATAGGGGCCTGGG - Intergenic
1062373233 9:136250960-136250982 CAGGACACACGGAGCTGCCAAGG - Intergenic
1203453386 Un_GL000219v1:142196-142218 CAGAATACACAGAAGGTCCCAGG - Intergenic
1187417245 X:19103941-19103963 CTGAACATATAGAGGGGCCCAGG + Intronic
1192168256 X:68839394-68839416 CAGACCTTACCGAGGGGCCATGG + Intronic
1192233123 X:69279335-69279357 CAGAAGAGACAGAGGGAACAGGG - Intergenic
1194898359 X:99473706-99473728 CAGAACTCACAGAGTGGCAGAGG - Intergenic
1197518923 X:127473208-127473230 AAGACCACACAGTGGGGTCAGGG - Intergenic
1197561268 X:128024853-128024875 CTGCACACACAGAGGGACCCTGG + Intergenic
1197841541 X:130752927-130752949 GAGAACACACAGAAGGAGCAAGG - Intronic
1199579316 X:149345523-149345545 CCGTACACACAGAAGGGGCATGG - Intergenic
1199744748 X:150765405-150765427 GACAACACACAGAGGGCACAGGG - Intergenic
1201762094 Y:17551659-17551681 CAGAACACACATATGTACCATGG + Intergenic
1201839458 Y:18354329-18354351 CAGAACACACATATGTACCATGG - Intergenic