ID: 1096257627

View in Genome Browser
Species Human (GRCh38)
Location 12:50072880-50072902
Sequence CTGAAATAGAGCTGGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096257615_1096257627 28 Left 1096257615 12:50072829-50072851 CCAAAATACATCTCAGCATAGGT 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1096257627 12:50072880-50072902 CTGAAATAGAGCTGGGGCCAGGG 0: 1
1: 0
2: 2
3: 23
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096257627 Original CRISPR CTGAAATAGAGCTGGGGCCA GGG Intronic
900963022 1:5937679-5937701 CAGATAGAGAGCTGGGCCCAGGG + Intronic
901935469 1:12623202-12623224 GGGAGACAGAGCTGGGGCCATGG + Intergenic
902279146 1:15361710-15361732 CTGAGATTGAGCTGGGGGCCAGG + Intronic
904102397 1:28042800-28042822 CTTGAAGAGAGCTCGGGCCAGGG + Intronic
904353257 1:29922526-29922548 ATGTGATGGAGCTGGGGCCATGG + Intergenic
905910943 1:41653885-41653907 ATGAAAGAGAACAGGGGCCAGGG - Intronic
906349285 1:45043891-45043913 TTGAAATAGAGCTGAAGCTATGG + Intronic
906512004 1:46415372-46415394 GAGAATTAGGGCTGGGGCCAGGG - Intergenic
906665586 1:47619515-47619537 CTGAACCAGAGCTGGGCCTAGGG - Intergenic
908298323 1:62735749-62735771 CAGAAGTAGAGCTGGCTCCAGGG + Intergenic
910881887 1:91929341-91929363 CTGAAGGAGAGCTGGAGACAAGG + Intergenic
911335211 1:96573642-96573664 TAGAAATAAAGCAGGGGCCAGGG - Intergenic
911541592 1:99163994-99164016 CCAACGTAGAGCTGGGGCCATGG + Intergenic
912121682 1:106479437-106479459 CCAAAATAGAGATTGGGCCATGG + Intergenic
912610119 1:111034264-111034286 CTGATGCAGAGCTTGGGCCATGG + Intergenic
916318749 1:163479589-163479611 CCAAAGTAGAGCTTGGGCCATGG + Intergenic
916467196 1:165084305-165084327 CCAATATAGAGCTTGGGCCATGG + Intergenic
917894933 1:179478479-179478501 CCAAGATACAGCTGGGGCCATGG - Intronic
918069149 1:181122342-181122364 CAGAAACAGAGCTGGGCCCCGGG + Intergenic
918079475 1:181194784-181194806 CCTACATAGAGCTTGGGCCATGG + Intergenic
918718156 1:187818228-187818250 CCAACATAGAGCTTGGGCCATGG - Intergenic
918963316 1:191307082-191307104 CTGAGGTGGAGCTGGGCCCAGGG - Intergenic
919221802 1:194639506-194639528 CTAACATAGAGCTTGGGACATGG + Intergenic
919222102 1:194642593-194642615 CCAACATAGAGCTTGGGCCATGG + Intergenic
919639802 1:200036680-200036702 CTGAAATAGGGCTGCCCCCAGGG + Intronic
921032220 1:211343889-211343911 CTGTTACAGAGCTGGAGCCAAGG + Intronic
921716007 1:218417795-218417817 CCAACATAGAGCTTGGGCCATGG + Intronic
1064271137 10:13867293-13867315 CTGAACTCCAGCTGGGACCACGG - Intronic
1065517949 10:26543713-26543735 ATGAGGTAGGGCTGGGGCCAGGG + Intronic
1065814087 10:29469368-29469390 CTGGAACAGAGCAGTGGCCAGGG - Intronic
1067681694 10:48445725-48445747 CTGGAGCAGAGCTAGGGCCATGG + Intergenic
1069661691 10:70127383-70127405 CTGAAAAAGAGCTGAGATCAGGG + Intronic
1070167696 10:73911101-73911123 CTGATATAGAGCAGGCGCCGCGG + Exonic
1070807929 10:79281528-79281550 CTTACAGAGAGCTGAGGCCATGG - Intronic
1071482984 10:86078909-86078931 CTGACATAGAGCTGGGTCCAGGG - Intronic
1071550069 10:86560056-86560078 CTAATGTAGAGCTTGGGCCATGG - Intergenic
1073223540 10:101896595-101896617 CTCAAAAACTGCTGGGGCCAAGG - Intronic
1074965825 10:118490042-118490064 CCAAAATAGAGCTCAGGCCATGG + Intergenic
1075566932 10:123511867-123511889 CTGAAACAGAGCTGAGGGCTGGG + Intergenic
1076210794 10:128643101-128643123 CTGAAATGGAGGTGTGGGCAGGG - Intergenic
1077045944 11:545186-545208 CTCACTCAGAGCTGGGGCCAGGG + Intronic
1077599888 11:3567026-3567048 CTGAAGAAGAGCAGGGGGCATGG + Intergenic
1078110020 11:8384868-8384890 ATGAAAGACAGCTGGGCCCAGGG - Intergenic
1078117373 11:8466946-8466968 CCAACATAGAGCTCGGGCCATGG - Intronic
1078197223 11:9146003-9146025 GTGAAATTGAGGAGGGGCCATGG - Intronic
1078496734 11:11824992-11825014 CCAACATAGAGCTTGGGCCATGG - Intergenic
1079176690 11:18148493-18148515 TTGAAATAGAGGAGAGGCCATGG - Intronic
1080519917 11:33059822-33059844 CTGAGGTAGTGCTGGGGCCGGGG + Intronic
1080852085 11:36078724-36078746 CTGAGGCAGAGCTGGGCCCAGGG - Intronic
1081869349 11:46376281-46376303 CTGGGATAGAGTGGGGGCCAGGG - Intronic
1082002010 11:47398430-47398452 CTGAAGGAGGGCTGGGCCCATGG - Intergenic
1082849597 11:57753417-57753439 CTGTAGTAGAGCAGGCGCCAAGG + Intronic
1083744854 11:64729799-64729821 CTGCAATAGAGGAGGGGCCGTGG + Intronic
1084816958 11:71653681-71653703 CTGAAGAAGAGCGGGGGGCATGG - Intergenic
1087182314 11:95152220-95152242 GTGAAACAGAGCTCGGGCCATGG + Intergenic
1091326354 11:134691450-134691472 CTGAAACAGAGCTGTGGCCCAGG - Intergenic
1091701666 12:2667348-2667370 CTGACAGAGAGCTGGGGGAAGGG + Intronic
1091932081 12:4404151-4404173 CCAACATAGAGCTTGGGCCATGG + Intergenic
1094497168 12:30995544-30995566 CTGAAACAAAGCTGGCTCCAAGG - Exonic
1096117628 12:49064724-49064746 CTGAAATAGAGCTGGCTCCCTGG - Exonic
1096257627 12:50072880-50072902 CTGAAATAGAGCTGGGGCCAGGG + Intronic
1099722544 12:86382742-86382764 CAGACATAGAGCTTGGGCCATGG + Intronic
1099800556 12:87451678-87451700 CCAAAGTAGAGCTTGGGCCATGG + Intergenic
1100927870 12:99570156-99570178 GTGAAATGGAGCTGGGGCAGAGG - Intronic
1101720013 12:107342881-107342903 CTGTAATACAGCTTGGGCAATGG + Intronic
1102173908 12:110862163-110862185 TTGAAGAGGAGCTGGGGCCATGG + Intronic
1102580597 12:113884380-113884402 CAGGAATAGAGGTGGGGACAGGG - Intronic
1103255901 12:119541055-119541077 CTGGGAAAGAGCTGGGGCCATGG + Intergenic
1103980287 12:124732654-124732676 CAGGTATGGAGCTGGGGCCAGGG + Intergenic
1104132192 12:125905037-125905059 CTGATACCGAGCTGGGGCCAGGG + Intergenic
1104695515 12:130860537-130860559 CTGAAATTGAGGTGTGGGCAGGG - Intergenic
1105309242 13:19191567-19191589 AGGAAATAGACCTGTGGCCAGGG + Intergenic
1106207324 13:27612301-27612323 ATGAGAGAGAGCTGGGACCATGG - Intronic
1107260447 13:38484166-38484188 TTGAAATTGAGTTGGGGGCAGGG - Intergenic
1108497377 13:51039026-51039048 CTGAAATACAGCTGCAGCCCAGG + Intergenic
1109702745 13:66048095-66048117 CCGATGTAGAGCTCGGGCCATGG - Intergenic
1110246580 13:73331962-73331984 CTGAAATTGAGCTGGCACTAGGG + Intergenic
1110502879 13:76249551-76249573 CTGAAACAGAGTTGGGGTAAAGG - Intergenic
1111143818 13:84155848-84155870 CCAACATAGAGCTTGGGCCATGG + Intergenic
1113009515 13:105747850-105747872 CTGAAACACAGCTGGTGGCAGGG - Intergenic
1113296454 13:108964207-108964229 CTAGAATAGAGGTGGGCCCAAGG - Intronic
1114276946 14:21155175-21155197 CTGAAAATGAGCTCGGCCCAGGG - Exonic
1114397909 14:22383725-22383747 CTCAGGTAAAGCTGGGGCCAAGG - Intergenic
1114986116 14:28230836-28230858 CCAACATAGAGCTGGGGCCATGG - Intergenic
1115747529 14:36452523-36452545 CTGAAATCCAGATGGTGCCAGGG - Intergenic
1116917242 14:50537203-50537225 CCAACATAGAGCTGGGGCCGTGG + Intronic
1119292662 14:73508037-73508059 CTGAAATGCAGCTGGGGCCGGGG - Intronic
1121049354 14:90810292-90810314 CTGAAATACATCTGGCCCCAAGG + Intronic
1121342826 14:93115508-93115530 CTGAGTCGGAGCTGGGGCCAGGG + Intronic
1121697707 14:95927231-95927253 CTGAAAGACTGCAGGGGCCACGG - Intergenic
1121867575 14:97377240-97377262 CTTAACTAGATCTGGGACCAGGG + Intergenic
1122032026 14:98919346-98919368 CAGAAGTGGAGTTGGGGCCAGGG - Intergenic
1122599697 14:102915141-102915163 CCGAGATGGAGCTGGGCCCACGG - Intergenic
1122692318 14:103537225-103537247 CAGAGGTAGAGCTGGGCCCATGG + Intergenic
1122942407 14:104987379-104987401 CTGAAAGAGAGCAGGGGGCAGGG - Intronic
1123005925 14:105323820-105323842 CAGCACTCGAGCTGGGGCCAAGG + Intronic
1125592388 15:40862938-40862960 CTTAAATATATCTGAGGCCAGGG - Intergenic
1125966038 15:43876325-43876347 CTGATGCAGAGCTGGGACCACGG + Intronic
1126536850 15:49775632-49775654 GTGGAATAGAGCGGTGGCCATGG - Intergenic
1128062980 15:64746993-64747015 CTGGAATAGAGCGGGGAGCAGGG - Intronic
1128822911 15:70677420-70677442 CTGAACTATAGTTAGGGCCATGG - Intronic
1129743685 15:78003149-78003171 CTGCACTAGATCTGGGTCCAGGG - Intronic
1130738951 15:86577738-86577760 CCAACATAGAGCTCGGGCCATGG + Intronic
1130889307 15:88119884-88119906 CTGAAAGGGGGCTGGGACCATGG - Intronic
1131606076 15:93904043-93904065 CTGAAATAAAGCAGTGGCCTTGG + Intergenic
1131743660 15:95421487-95421509 CCAAAATAGAGCTCGGGCCATGG - Intergenic
1133442419 16:5831916-5831938 CTGAAATAGAGTTCGGCACATGG + Intergenic
1133708406 16:8377865-8377887 CTGAATTAGACATGGGGCCTGGG - Intergenic
1134182061 16:12055917-12055939 CTGCACTACAGCCGGGGCCATGG - Intronic
1134508126 16:14824435-14824457 CTTAAATAGAGCTGGGCTCTCGG + Intronic
1134695824 16:16223200-16223222 CTTAAATAGAGCTGGGCTCTCGG + Intronic
1134976003 16:18571488-18571510 CTTAAATAGAGCTGGGCTCTCGG - Intergenic
1136612984 16:31378356-31378378 CTGCAGGAGAGCAGGGGCCATGG - Intronic
1139262703 16:65610234-65610256 CTGGACCAGAGCTGGGGCAAAGG - Intergenic
1140613953 16:76636879-76636901 CTAAAATTGAGGTGTGGCCAGGG + Intergenic
1141513582 16:84528147-84528169 GGGACAAAGAGCTGGGGCCAAGG + Intronic
1141554296 16:84826835-84826857 CTGAAACAGGCCTGGGGCCCCGG - Intronic
1142882062 17:2889540-2889562 GTGAAATACTGCAGGGGCCATGG + Intronic
1143085937 17:4416181-4416203 CTAACCTGGAGCTGGGGCCAGGG + Intergenic
1143652051 17:8269208-8269230 TTGATAAAGAGCTGGAGCCAGGG - Exonic
1145234672 17:21200163-21200185 CTGAAATGCAGCTTGGCCCACGG - Intronic
1148820103 17:50355190-50355212 CTAAAACATAGCTGGGGCCCAGG - Intronic
1149341112 17:55687319-55687341 CCAATATAGAGCTTGGGCCATGG + Intergenic
1149910779 17:60564952-60564974 CTGAAAAAAAGCTGTGACCAAGG - Intronic
1149949572 17:60971469-60971491 CTGAATTAAAGCTGGGGTGATGG + Intronic
1151015764 17:70551025-70551047 CTGGAAGAAAGCTGAGGCCAGGG + Intergenic
1151470115 17:74312699-74312721 GTGCTTTAGAGCTGGGGCCATGG - Intronic
1151684988 17:75641000-75641022 CTGGGCCAGAGCTGGGGCCAGGG - Exonic
1152049693 17:77962744-77962766 CTGAGATAGAGCTGGAGAAAAGG - Intergenic
1152663019 17:81551756-81551778 CAGAAAGAGTGCTGGGGGCAGGG + Intronic
1152749508 17:82056177-82056199 CTGAGAAAACGCTGGGGCCAGGG - Intronic
1155236864 18:23828954-23828976 CTGAAATACACCTGGCTCCAAGG - Intronic
1155888750 18:31240593-31240615 CTGCATTACAGCTGGGGCGATGG - Intergenic
1156829197 18:41470024-41470046 GTGAAAAAGAGCTCGGGCTATGG - Intergenic
1156914833 18:42453619-42453641 CAGAAATGGAGCTGGGCCAAAGG + Intergenic
1157243594 18:46034115-46034137 CGGAAACAGAGCTGTAGCCAGGG + Intronic
1157404895 18:47414458-47414480 CTGAAATAGTGCTAGAACCAGGG + Intergenic
1158260253 18:55598647-55598669 CTGAAATAGGGCTGTGGCTATGG + Intronic
1158889328 18:61858553-61858575 CTGCAGTAGAGTTGGGGCCCAGG - Intronic
1159535306 18:69707474-69707496 CTGAAATAGTGGCTGGGCCAGGG - Intronic
1161237705 19:3206091-3206113 CTGCAGTGGGGCTGGGGCCAGGG - Intronic
1161858483 19:6779715-6779737 CTAAAATAAAGCTGGGGGCTGGG + Intronic
1162149819 19:8636955-8636977 CAGGGATAGAGCTGGGGCCAAGG + Intergenic
1162343726 19:10107719-10107741 CTGAAGAAGAGATGGGGCAAAGG + Intronic
1163201761 19:15774687-15774709 CTGAAATGGACCTGGGACCTGGG + Intergenic
1163384030 19:16988213-16988235 CTGACATAGAGCTGCTGCTATGG - Intronic
1163468224 19:17481956-17481978 CTTAGATCGGGCTGGGGCCACGG + Intronic
1163744999 19:19041127-19041149 ACGAAAAGGAGCTGGGGCCAGGG - Intronic
1165495704 19:36151127-36151149 CCGAACTAGAGCTGGGGTCCAGG - Intronic
1166015885 19:39979055-39979077 CTGAAAAAGATCAGGGACCACGG - Intronic
1166781876 19:45347372-45347394 CTGAGATAGAGCCAGGGCCCCGG + Intronic
1166930361 19:46298222-46298244 CTGGAATAGAGTAGGGGACAGGG - Intronic
1167291159 19:48625906-48625928 CTGACCGGGAGCTGGGGCCACGG + Exonic
1167318501 19:48780768-48780790 ATGAAAGACAGCTGGGCCCAGGG + Intergenic
1167784831 19:51628111-51628133 GGGAAAGAGAGATGGGGCCAGGG + Intronic
1168083005 19:54024107-54024129 TGGACCTAGAGCTGGGGCCACGG + Intergenic
925845412 2:8029002-8029024 CAGAGGAAGAGCTGGGGCCATGG - Intergenic
926262326 2:11277043-11277065 CTGAAAAAGAGAAGGGGACAGGG - Intronic
926653466 2:15371699-15371721 CTGAAATAATGATGGGGACAAGG - Intronic
926675829 2:15619118-15619140 CTGAGATGGAGCTGGGCCCAGGG - Intronic
927486361 2:23491117-23491139 CTGATATAGAGTTGGGGGAAAGG - Intronic
928376560 2:30779158-30779180 GTGAAGAAGAGCTGTGGCCAAGG - Intronic
928731454 2:34237493-34237515 CCGATGTAGAGCTTGGGCCATGG + Intergenic
929418676 2:41769103-41769125 TTGACATAGATCAGGGGCCAAGG + Intergenic
929946267 2:46374990-46375012 CTGAGAAAGAGCTGGGACCCTGG - Intronic
930293961 2:49530302-49530324 CCAAGATAGAGCTAGGGCCATGG - Intergenic
930597230 2:53403490-53403512 CTGAAATAGAGTTGTGGGAAGGG + Intergenic
931927728 2:67092620-67092642 CTGGATTAGATCTTGGGCCAAGG + Intergenic
932497560 2:72153881-72153903 CTGAAACAGAGCTGGGTTCTGGG + Intergenic
933065018 2:77781700-77781722 CCAACATAGAGCTCGGGCCATGG + Intergenic
934156626 2:89207195-89207217 CTGAAAGAAAGGAGGGGCCAAGG - Intergenic
934210689 2:89975556-89975578 CTGAAAGAAAGGAGGGGCCAAGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
936484470 2:112914488-112914510 CTGCACTAGAGCTGGGGCTCAGG - Intronic
936827780 2:116602812-116602834 CCAACATAGAGCTTGGGCCATGG + Intergenic
937808622 2:126174793-126174815 CTGAAATAAACCAGGGGCCTTGG + Intergenic
940542999 2:155045936-155045958 CTAACATAGAGCTCAGGCCATGG - Intergenic
940785824 2:157980290-157980312 CTGAAATAGAGATTGGGCCGTGG + Intronic
942044775 2:172094205-172094227 CTCAAATAGAGCATTGGCCAGGG + Intergenic
942215664 2:173716922-173716944 CTGAGTAAGACCTGGGGCCATGG - Intergenic
942326662 2:174781914-174781936 GTGAAATAAAGCTGCAGCCAGGG + Intergenic
945709470 2:213278059-213278081 CCAAAGTAGAGCTTGGGCCATGG + Intergenic
946339492 2:219058686-219058708 CTGAGAAGAAGCTGGGGCCAGGG + Intronic
947792973 2:232878256-232878278 CTGAGGTGGAGCTGGGGCGAGGG + Intronic
948135403 2:235632589-235632611 CTGAAATCGGGCTGGGGTCTTGG + Intronic
948297174 2:236869616-236869638 CTGAAAGAGAGCTGCATCCAGGG - Intergenic
948346532 2:237303535-237303557 CCAACATAGAGCTTGGGCCATGG + Intergenic
1169376271 20:5068922-5068944 CAGGAACAGAGGTGGGGCCATGG + Intronic
1169642775 20:7773415-7773437 CTAAAATACATCTGGGCCCACGG + Intergenic
1174083950 20:47991767-47991789 GGGAAATAGAGCTGGGGGCAGGG + Intergenic
1174351915 20:49974527-49974549 CTACAAGAGAGCTGGGACCAGGG + Intergenic
1174606424 20:51765179-51765201 CTGAAATAGAACTAGGGGCTGGG - Intronic
1174992737 20:55530080-55530102 CTCAAAAATAGCTGGGGGCAGGG + Intergenic
1175669890 20:60893026-60893048 CTGAAATTGAGGTGTGGGCAGGG - Intergenic
1176838876 21:13821144-13821166 ATGTCATAGATCTGGGGCCAAGG + Intergenic
1180001120 21:44996007-44996029 CTGCACTGGAGCTGGGGCCTTGG - Intergenic
1181776045 22:25160826-25160848 CTGACATAGAGCTGGGGATGGGG + Intronic
1181916252 22:26282808-26282830 CTCAAATAGAGTTGGTGGCAGGG + Intronic
1181953774 22:26573515-26573537 ATAAACTACAGCTGGGGCCAGGG - Intronic
1182569142 22:31223113-31223135 CTGAAGTAGGGCTGGGGTGAAGG + Intronic
1183478004 22:38046532-38046554 CTAAAAAGGAGCTGGGGTCAGGG - Intergenic
1183738367 22:39656376-39656398 CTAAGAGAGAGCTGGCGCCAGGG - Intronic
1184221581 22:43104013-43104035 ATGAAAGACAGCTGGGCCCAGGG + Intergenic
950214005 3:11145063-11145085 CTGAACTAGCGCAGCGGCCATGG - Intronic
952185247 3:30961277-30961299 CCAACATAGAGCTCGGGCCATGG - Intergenic
952389802 3:32870370-32870392 CTGCAACAGAGATGGGGACAGGG - Intronic
952651026 3:35726781-35726803 CTGAAAAAGAGTTGGGGCCAAGG - Intronic
953699578 3:45185415-45185437 CTGAAAGAGAGGTGCTGCCAAGG + Intergenic
955043112 3:55335847-55335869 TAGAAATGGAGATGGGGCCAGGG + Intergenic
955741750 3:62098534-62098556 CAGAATAAAAGCTGGGGCCAAGG - Intronic
956766171 3:72486559-72486581 CTGCACTACAGCTGGGGCAAAGG - Intergenic
956843499 3:73161063-73161085 ATGAAATACAGCTGGGTCTATGG + Intergenic
957403645 3:79749646-79749668 CTGAAAGGGAGCTTGGCCCATGG + Intronic
958956482 3:100470084-100470106 CTGACGTAGAGCTGAGGCCACGG - Intergenic
959915850 3:111815967-111815989 CCAACATAGAGCTTGGGCCATGG + Intronic
960992607 3:123321801-123321823 CTAAAATAGACATGGGGCCCTGG + Intronic
961001183 3:123375111-123375133 TTGAAAAAGGGCTGGGGGCAGGG - Intronic
961069866 3:123912871-123912893 CTGAAATAGAGGTGGGGAGGGGG - Intronic
961283384 3:125780882-125780904 CTGAAGAAGAGCGGGGGGCATGG - Intergenic
961537288 3:127577829-127577851 CTGAACTAGCCCTGAGGCCAGGG - Intronic
961665899 3:128492940-128492962 CTGGAGTAGAGCTGGGAGCAGGG + Exonic
963017558 3:140840337-140840359 CTCAAAAAGGGCTGGGGTCAGGG - Intergenic
965016311 3:163161957-163161979 TTTTAATAGAGCTGGGGCCAGGG + Intergenic
965198632 3:165629435-165629457 CTAACATAGAGCTCAGGCCATGG - Intergenic
965634517 3:170767689-170767711 CTGAACCTGAGCTGGGACCATGG + Intronic
965915691 3:173843116-173843138 GTGGAGTAGAGCTTGGGCCATGG - Intronic
966302675 3:178496706-178496728 CTGAGATGTATCTGGGGCCATGG - Intronic
966665060 3:182463225-182463247 CCAACATAGAGCTTGGGCCATGG + Intergenic
968982446 4:3857559-3857581 CTGAAGTAGTGCTGGGTGCAAGG + Intergenic
969837882 4:9858226-9858248 ATGAAGTAGACCTGGGGGCATGG + Intronic
970544781 4:17116263-17116285 CTGAAATCTAGCTAGGCCCAGGG + Intergenic
970976513 4:22048357-22048379 CCAACATAGAGCTGGAGCCATGG - Intergenic
974117128 4:57592609-57592631 CACACAAAGAGCTGGGGCCATGG - Intergenic
974494977 4:62614991-62615013 CCAACATAGAGCTCGGGCCATGG - Intergenic
974837144 4:67264747-67264769 CTGGAAGAGGGCTGGGCCCAAGG - Intergenic
976424368 4:84883700-84883722 CTCAACTAGAGCTGGGGAAAAGG + Intronic
978356304 4:107878318-107878340 CAGAAATGGAGCTGGGGAAAAGG + Intronic
979097857 4:116573719-116573741 CCAACATAGAGCTTGGGCCATGG - Intergenic
982730757 4:158953307-158953329 CCAACATAGAGCTTGGGCCATGG + Intronic
985429243 4:189862406-189862428 CTGGAACAGAGCTGGGCGCAGGG + Intergenic
986301142 5:6479219-6479241 CTGAGATAGCGATGGGGCCCTGG + Intronic
986706007 5:10455462-10455484 GGGAACTGGAGCTGGGGCCAGGG - Intronic
986992768 5:13572889-13572911 CTTATATGGAGCTGGGGCAATGG - Intergenic
987435000 5:17883733-17883755 CTGGATTTGAGCTGGGGACAAGG + Intergenic
987464206 5:18252843-18252865 CTAATGTAGAGCTGGGGCCATGG + Intergenic
987602093 5:20084768-20084790 CCAACATAGAGCTTGGGCCATGG - Intronic
988740116 5:34061651-34061673 CCAACATAGAGCTGGGGCCATGG - Intronic
990193315 5:53286425-53286447 CCAACATAGAGCTTGGGCCATGG - Intergenic
990595537 5:57309315-57309337 CCAATATAGAGCTTGGGCCATGG + Intergenic
991104940 5:62833026-62833048 CCAACATAGAGCTCGGGCCATGG - Intergenic
991613563 5:68472918-68472940 CTGGAATAGAGCTATGTCCAAGG - Intergenic
994614937 5:102092491-102092513 CTAACATAGAGCTTGGGCTATGG - Intergenic
994900442 5:105762830-105762852 CCAAAATAGAGCTTGGTCCATGG - Intergenic
995281610 5:110341792-110341814 GTGAAACAGAGCTGGGGACTTGG - Intronic
995930172 5:117432094-117432116 TTGAAAGAGAGCTGTGGACATGG + Intergenic
997645306 5:135477780-135477802 TTCAAACAGGGCTGGGGCCAGGG + Intergenic
998424832 5:142017767-142017789 CTAAAATAGTGCTGGGCACATGG - Intergenic
999241979 5:150133073-150133095 TTGAAATTGGGCTGGGGACAGGG + Intronic
999436370 5:151566622-151566644 TTGACATAGAGCTGGAGACAGGG - Exonic
1000769184 5:165330508-165330530 CTGAAAGAGAGCCGGAACCATGG - Intergenic
1001795498 5:174498891-174498913 CCAAAATAGAGCTCAGGCCATGG + Intergenic
1002288333 5:178180503-178180525 TTGAAATAGTGCTGGGTCCTGGG - Intergenic
1002617524 5:180464856-180464878 CTGCAACAGGCCTGGGGCCAAGG - Intergenic
1002763474 6:219305-219327 CAGAAGCAGAGCTGGAGCCAAGG + Intergenic
1005943374 6:30578019-30578041 CAGAAATACAGCAGGGGCCTGGG + Intronic
1006591166 6:35158792-35158814 CTGTAATAGTGCTGGGCACATGG + Intergenic
1009346086 6:62614243-62614265 CAAACATAGAGCTAGGGCCATGG + Intergenic
1009480977 6:64157642-64157664 CTAACATAGAGCTTGGGCCATGG + Intronic
1011503343 6:88014417-88014439 CTGAGATGCAACTGGGGCCAGGG - Intergenic
1011781691 6:90796680-90796702 CTGACCTAGACCAGGGGCCATGG + Intergenic
1015366760 6:132403926-132403948 CTCAATTACATCTGGGGCCAAGG - Intergenic
1016108165 6:140188449-140188471 CCAACATAGAGCTTGGGCCATGG + Intergenic
1017029209 6:150206064-150206086 CTGTATCAGAGTTGGGGCCATGG - Intronic
1017523409 6:155221808-155221830 CTGAATTAGAGATGGAGCTATGG + Intronic
1017561917 6:155637199-155637221 ATGCAGTAGAGCTGTGGCCAAGG + Intergenic
1021036852 7:15810049-15810071 CCAAAGTAGAGCTAGGGCCATGG - Intergenic
1023088745 7:36598258-36598280 CTGAATCACAACTGGGGCCAGGG + Intronic
1024465349 7:49706350-49706372 CTGAATTAGTGCTGGGCTCATGG - Intergenic
1025085412 7:56019567-56019589 CTGAAATACACCTGGAGCCGGGG + Intronic
1025608646 7:63057588-63057610 CTGAAATACACCTGGAGCCGGGG - Intergenic
1027489627 7:78806829-78806851 CTGAAATCCAGCCTGGGCCACGG + Intronic
1027624743 7:80531985-80532007 CCAACATAGAGCTCGGGCCACGG + Intronic
1029072992 7:97914988-97915010 CTGAAGAAGAGCGGGGGGCATGG + Intergenic
1029871141 7:103693845-103693867 ATGAAATAGAGTAGGGGCCTTGG - Intronic
1030170112 7:106592691-106592713 CTGACATAGAGTTTGTGCCAAGG - Intergenic
1030868756 7:114731406-114731428 CCAAAGTAGAGCTTGGGCCATGG + Intergenic
1030910233 7:115238850-115238872 TTGAATTAGGCCTGGGGCCAAGG - Intergenic
1031336596 7:120541048-120541070 CTGAAATAGAGCATGGGCTAGGG - Intronic
1031732856 7:125319886-125319908 CCAAAGTAGAGCTCGGGCCATGG + Intergenic
1032452896 7:132049649-132049671 CTGACATAGAGCTGGAGTCCTGG + Intergenic
1035334701 7:158120451-158120473 CTGAAATAGAGATTGGACGAAGG - Intronic
1035675238 8:1451448-1451470 CTGAAAGGGCGCTGGTGCCAGGG + Intergenic
1035988512 8:4461671-4461693 CTGCTGTATAGCTGGGGCCATGG + Intronic
1037062228 8:14528722-14528744 CAGAAATAGAAATTGGGCCAGGG - Intronic
1038201704 8:25418960-25418982 CAGAAGTTGAGGTGGGGCCACGG - Intergenic
1041811975 8:61921761-61921783 CTGAAAGAGACCTGGAGACAGGG - Intergenic
1043928112 8:86060967-86060989 CTGAAAAAGAGCAGGGGGCTGGG - Intronic
1047211390 8:122843013-122843035 CAGAAAATGAGCTGGGGCAATGG - Intronic
1047741910 8:127813467-127813489 CTAAAGTAGAGCTGGGTCTAGGG - Intergenic
1048203869 8:132400282-132400304 CTGACACAGAGCTGGGTTCATGG + Intronic
1048336425 8:133506031-133506053 TTGAAATTGAGCTGGTGCAACGG - Intronic
1048816936 8:138342919-138342941 CTAGCATACAGCTGGGGCCATGG - Intronic
1049233544 8:141496502-141496524 CTGAAATGGAGGAGGGGCCCTGG + Intergenic
1049248621 8:141576293-141576315 CTGCCATAGTGCTGGGGACAAGG - Intergenic
1049386152 8:142344071-142344093 CGGAACCAGGGCTGGGGCCATGG + Exonic
1049604174 8:143521408-143521430 CAGACATAGTGCTGGGGGCAGGG - Intronic
1049688039 8:143946784-143946806 CTGAAATACCGCTGGGCACATGG - Intronic
1051619504 9:19036555-19036577 CCAACATAGAGCTTGGGCCATGG + Intronic
1053096490 9:35332684-35332706 CTGAAATAGAGCTCGAGTCATGG + Intronic
1054793390 9:69276553-69276575 TTGAAATAGAGCAAGGGCGACGG + Intergenic
1055939765 9:81638246-81638268 TTGGAAGAGAGCTGGGGGCAAGG - Intronic
1056693229 9:88825572-88825594 CTACTATAGAGGTGGGGCCATGG + Intergenic
1056929732 9:90864121-90864143 GTGAAATAGCACTGGGGCCCTGG - Intronic
1057177431 9:93010379-93010401 CGGAGAGTGAGCTGGGGCCAAGG + Exonic
1057249394 9:93487938-93487960 GTGAAATAGAGCAGAGGCCCAGG - Intronic
1057810476 9:98253368-98253390 CTGAACTAGAGCTGTGGCTGTGG - Intronic
1057852465 9:98576051-98576073 ATGAAAGAGAGGTGGGGCCCGGG - Intronic
1059195393 9:112366499-112366521 CCAATATAGAGCTTGGGCCATGG + Intergenic
1059400954 9:114070589-114070611 CTGAGGCAGAGCTGGGCCCAGGG + Intronic
1060104472 9:120865238-120865260 CTGAGCCAGAGCTGGAGCCAGGG - Intronic
1061197334 9:129113912-129113934 CTGAAAGAGAGCTGTGCTCAGGG + Intronic
1061899409 9:133665385-133665407 CTGACACAGCCCTGGGGCCATGG - Intronic
1062262978 9:135672038-135672060 CTGAAATGGAGCTGTTGGCAGGG + Intergenic
1203785143 EBV:123436-123458 TTGGAATGCAGCTGGGGCCAGGG + Intergenic
1186186220 X:7022325-7022347 ATGAAATAGAGCTGGGAAAATGG + Intergenic
1186650896 X:11559014-11559036 CTGAAAAATAGCTGTGGACAGGG - Intronic
1186797666 X:13062413-13062435 CCAACATAGAGCTTGGGCCATGG - Intergenic
1187392009 X:18892202-18892224 CTGAAACAGAGATGAGGCTATGG - Intergenic
1188794227 X:34442161-34442183 CTGACATAGAGCTCAGGCCATGG - Intergenic
1190387916 X:49900854-49900876 CTCAAATAGGGCTGGGGCTTTGG + Intergenic
1190513300 X:51195777-51195799 CCAACATAGAGCTTGGGCCATGG - Intergenic
1192140855 X:68646519-68646541 CTGAAACAGAAGTGAGGCCAGGG + Intergenic
1192189124 X:68980023-68980045 CTGAAGTAAAGCTCGGCCCAGGG + Intergenic
1192265155 X:69532599-69532621 CTGACAGAGAGCTGGGCACAGGG - Intergenic
1192270560 X:69575420-69575442 CCAACATAGAGCTTGGGCCATGG - Intergenic
1192679674 X:73239207-73239229 CTGTGATTGAGATGGGGCCATGG + Intergenic
1192841915 X:74865742-74865764 CTAAAGTACAGCTTGGGCCATGG + Intronic
1193716583 X:84941371-84941393 GTGAAACAGATCTGGGCCCAGGG + Intergenic
1193842044 X:86418532-86418554 CCAACATAGAGCTGGGACCATGG - Intronic
1195097929 X:101524048-101524070 CTGCACCAGAGCTGGAGCCAGGG + Intronic
1197118358 X:122860752-122860774 CTCAGATAGACCTGGGGCTATGG - Intergenic
1197341011 X:125266440-125266462 CTAATGTAGAGCTCGGGCCATGG + Intergenic
1197756822 X:130001542-130001564 CTGAACTCGGGCTGGGGCTAGGG + Intronic
1199373210 X:147075656-147075678 CTGAGTTACAGCTGTGGCCAGGG + Intergenic
1200839572 Y:7767231-7767253 CTGCAAAAGAGCTGGGTTCAAGG - Intergenic