ID: 1096258526

View in Genome Browser
Species Human (GRCh38)
Location 12:50077079-50077101
Sequence TGGAGAATGGGCTGCACGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096258526 Original CRISPR TGGAGAATGGGCTGCACGGG AGG Intronic
900204559 1:1426506-1426528 GGGAGAAGGGGCTGCCAGGGAGG - Intronic
900298013 1:1961983-1962005 TGGAGCCTGGGCAGCAAGGGGGG + Intronic
900495670 1:2974939-2974961 TGGAGAAGGGGCCGCCAGGGAGG - Intergenic
900949984 1:5853131-5853153 TGGGGAGTGGGATGCAGGGGAGG + Intergenic
901877596 1:12175679-12175701 GGGAGAATGGGATGCAGGAGTGG - Intronic
902710431 1:18235799-18235821 TGGAGAATGGTTTGCAGAGGAGG + Intronic
903288470 1:22291914-22291936 TGGAGAATGGGCTGGAAAGGGGG + Intergenic
903468400 1:23568222-23568244 TGGACGAGGGGCTGCGCGGGGGG - Intergenic
903489169 1:23714862-23714884 TGGAGAATGAATTGCAGGGGTGG + Intergenic
904415743 1:30360150-30360172 TGGAGGATGGGCTGAGCAGGTGG - Intergenic
905913863 1:41671926-41671948 TGGAGAATGGCCTGAAGGGAGGG + Intronic
906154242 1:43604835-43604857 GGGTGAATGGGCTGGAAGGGTGG - Intronic
906694167 1:47812982-47813004 GGGATAATGGTCTACACGGGAGG + Intronic
907454525 1:54566689-54566711 TGGTGGATGGGCTGAACTGGGGG + Intronic
908420903 1:63957497-63957519 AGGAGAATAGGATGCAAGGGGGG - Intronic
910392221 1:86757036-86757058 TGGGGAGTGGGCTGGACAGGAGG + Intergenic
912056167 1:105600912-105600934 TGCAGAATGGCATGCACAGGTGG - Intergenic
912694313 1:111829509-111829531 TGGAGAATGGTCTTCAGGGATGG + Intronic
914916048 1:151819857-151819879 TGGAGGATGGGCTGACCAGGTGG - Intronic
916818489 1:168375575-168375597 TGGAGAAGTGTTTGCACGGGTGG + Intergenic
919674365 1:200366735-200366757 TAGAGAATGGGTTGCACAGAAGG + Intergenic
922691206 1:227693074-227693096 CAGAGAATGGGCTGCATGGAGGG - Intergenic
923637542 1:235715287-235715309 TAGTGATAGGGCTGCACGGGAGG + Exonic
1062811475 10:469674-469696 TGGAGCATGGGCTGAAAGTGGGG - Intronic
1064753277 10:18553526-18553548 TGGAGAATGGAATGAAAGGGAGG + Intronic
1064754610 10:18562797-18562819 TGGAGAATGGAATGAAAGGGAGG + Intronic
1064755024 10:18565770-18565792 TGGAGAATGGAATGAAAGGGAGG - Intronic
1064756847 10:18579260-18579282 AGGAGAATGGCATGAACGGGAGG - Intronic
1064912184 10:20414891-20414913 TGGGGTAGGGGATGCACGGGAGG + Intergenic
1065735999 10:28753019-28753041 TTGAGAATGGGCTAAAAGGGAGG + Intergenic
1070609911 10:77926261-77926283 TAGAGAATGGGCAGCAGGTGAGG + Exonic
1073057024 10:100709625-100709647 TGGAGGAGGGGCTGCAGGGAGGG - Intergenic
1073983581 10:109182796-109182818 TGGAGGAGAGGCTGCATGGGAGG - Intergenic
1074020797 10:109580583-109580605 TGGATAATGGGATGGATGGGTGG + Intergenic
1074051837 10:109887493-109887515 TGGAGGTGGGGCTGCAGGGGAGG - Intronic
1074125816 10:110528115-110528137 GGAAGAGTGGGCAGCACGGGAGG + Intergenic
1075862163 10:125686071-125686093 TGGGGAAGGGGCTGCCCGGCAGG - Intergenic
1080422197 11:32120329-32120351 TGGAGACTGGGCTTAATGGGAGG + Intergenic
1082078916 11:47996830-47996852 TGGAGATGGGGGTGCAGGGGTGG + Intronic
1083367841 11:62152163-62152185 TGGAGGATGGGCTGGGTGGGTGG + Exonic
1083733977 11:64669237-64669259 TGGAGATTGGGCTGCAGGGGTGG - Intronic
1084116198 11:67044469-67044491 TAGAGAAGTGGCTGCACTGGGGG - Intronic
1085395056 11:76202981-76203003 TGCAAGATGGGCTGCACAGGTGG - Intronic
1085741743 11:79083161-79083183 TGGAGAAGAGGCTGCTGGGGTGG + Intronic
1086392031 11:86375061-86375083 TGGAGAAGGGGCTGGAGGGTGGG + Exonic
1089091748 11:115883858-115883880 TGAAGAATGGACTGGACTGGAGG - Intergenic
1091193228 11:133711653-133711675 TGGAGAGTGGTTTGCACTGGAGG - Intergenic
1092337812 12:7649258-7649280 TGGAGAATGTGCTTCCCAGGTGG - Intergenic
1096258526 12:50077079-50077101 TGGAGAATGGGCTGCACGGGAGG + Intronic
1097195683 12:57241421-57241443 GGAAGACTGGGCAGCACGGGGGG - Intergenic
1097874755 12:64632646-64632668 TGTGGAATGGGGAGCACGGGAGG + Intronic
1102726703 12:115071876-115071898 TAGATAATGGGATGCATGGGTGG - Intergenic
1102762452 12:115400072-115400094 TGGAGAGTGGGCTGGTCTGGAGG + Intergenic
1104912022 12:132244268-132244290 TGGTGATGGGGCTGGACGGGGGG + Intronic
1104912051 12:132244343-132244365 TGGTGATGGGGCTGGACGGGGGG + Intronic
1104912080 12:132244417-132244439 TGGTGATGGGGCTGGACGGGGGG + Intronic
1104912184 12:132244686-132244708 TGGTGATGGGGCTGGACGGGGGG + Intronic
1107892322 13:44924996-44925018 TTGAGAATAGGCTGCAGAGGTGG - Intergenic
1108475510 13:50812248-50812270 TGTAGAAGGGGCTGCAGGAGTGG + Intronic
1110415793 13:75250910-75250932 TGGAGGATGGGGTGGACGAGGGG - Intergenic
1113483207 13:110636741-110636763 TGGAGTGTGGGCTGCAGGTGAGG + Intronic
1121454591 14:94030158-94030180 TGGAGAATGGGCTGGGATGGGGG + Intronic
1123869104 15:24553412-24553434 TGCAAAATGAGCTGCTCGGGAGG - Intergenic
1125860729 15:42997029-42997051 TTGGGAATGGGCTGCACAGCAGG + Intronic
1128818370 15:70630403-70630425 TGGAGGATGCCCTGCACTGGTGG + Intergenic
1128819371 15:70638180-70638202 CGGAGAATGGTTTGCAAGGGTGG + Intergenic
1129053833 15:72805915-72805937 AGGAGAAGGGGCTGCAAGGCTGG - Intergenic
1129104059 15:73293484-73293506 TGGGCCATGGGCTGCCCGGGTGG - Exonic
1129233105 15:74207693-74207715 AGGGGACTGGGCTGCACAGGTGG - Intronic
1129514226 15:76147125-76147147 TCGAGGAAGAGCTGCACGGGAGG + Intronic
1130175941 15:81570918-81570940 TGAAGAATGGGTTGCAGGAGGGG - Intergenic
1130228241 15:82076451-82076473 TGGAGAATGGTCTAAAAGGGAGG - Intergenic
1131830003 15:96348065-96348087 TGGAGAAGGGGCCGCACTAGAGG - Intergenic
1133358212 16:5152731-5152753 TGGAGGATGGACTGCAGGGGAGG + Intergenic
1133838730 16:9389261-9389283 TGGAGAATGGGTTGTAGGGGAGG + Intergenic
1136374105 16:29854913-29854935 AGGAGAAAGGGCTGCAGGGCAGG + Intergenic
1138393205 16:56684882-56684904 TGGAAAGGGGGCTGCAGGGGTGG - Intronic
1138771785 16:59674144-59674166 TAGAAACTGGGCTGCACGGCAGG + Intergenic
1139229544 16:65270336-65270358 TGAGGAATGGGCTGTATGGGTGG - Intergenic
1140034589 16:71362534-71362556 GGGAGAATGTGCTTCACTGGGGG + Intronic
1140317984 16:73918019-73918041 AAGAGAATGGGCAGGACGGGAGG - Intergenic
1140662715 16:77203264-77203286 TGGAGAAGGGGCTGCTGGTGAGG + Intronic
1141204576 16:81923606-81923628 TGGAGGCTGGGCTGCTCGGCAGG + Intronic
1142513226 17:410814-410836 TGGTGGATGGTCTCCACGGGTGG - Intronic
1147975731 17:44247235-44247257 TGGAGCTTGGGCAGCAGGGGAGG - Intergenic
1148253880 17:46111298-46111320 AGGAGAATGGCTTGCCCGGGAGG - Intronic
1151260963 17:72915599-72915621 TGGAGAAAGGCCAGCACGGTTGG - Intronic
1152425085 17:80214318-80214340 GGAAGAAAGGCCTGCACGGGAGG + Exonic
1152665730 17:81568156-81568178 TGGAGAGTGGGCTGCGGGAGGGG + Intronic
1155577486 18:27263894-27263916 TGGAGACTGGCCTGCAGGGATGG - Intergenic
1158348903 18:56544281-56544303 TGGAGGATGGCCTGCTGGGGAGG - Intergenic
1162351351 19:10151665-10151687 TGGAGAAGGGCCTGCATGTGTGG - Intronic
1164590748 19:29505464-29505486 TGGAGAATGGGTTGAGCTGGTGG - Intergenic
1165391199 19:35539965-35539987 TGGAGAGGGGGCTGGAGGGGCGG - Intronic
1166382368 19:42361793-42361815 TGGGCAAGGGGCTGCAGGGGTGG + Intronic
1166541360 19:43607917-43607939 CGGGGGCTGGGCTGCACGGGGGG + Exonic
1166565076 19:43759638-43759660 AGGAGAATGGCCTGCAGGGGCGG + Intergenic
1167056393 19:47113537-47113559 AAGAGAATGAGCTGAACGGGCGG + Intronic
1167074859 19:47242127-47242149 TGGACAATGCGGTGCACGGTGGG + Intergenic
925730568 2:6917431-6917453 GGGAGAAGCGGCTGCGCGGGCGG - Exonic
925832877 2:7913217-7913239 TGTAGAATGAGCTACTCGGGAGG + Intergenic
925917150 2:8614910-8614932 TGGAGAATGAGCAGGACTGGGGG + Intergenic
926306796 2:11643163-11643185 TGGAGCATGGGAAGCACGGCGGG - Intergenic
926737125 2:16082161-16082183 TGGAGGAGGGGCTGCCCAGGTGG + Intergenic
927261816 2:21099361-21099383 TGGAGAATGGGCTCTACCTGGGG + Intergenic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
933690829 2:85178450-85178472 TGGAGACTTGGGTGCACAGGAGG - Intronic
933744517 2:85561131-85561153 TGGAGAGGGGGCTGCACTGCAGG - Intronic
934747251 2:96767524-96767546 TGGAAGGTGGGCTGCAAGGGGGG - Intronic
935707119 2:105866692-105866714 TTAGGAATGGGCTGCACGGCAGG - Intronic
935934459 2:108166736-108166758 TGGGGAATGGGCTCTACTGGAGG - Intergenic
937198288 2:120179882-120179904 TGGAGGATGGGCAGCAGTGGAGG + Intergenic
937224874 2:120363066-120363088 TGGAGACGGGGCTGCCCGCGGGG - Intergenic
937274408 2:120674723-120674745 TGGAGAGTGGGCTGAACAGGGGG - Intergenic
937962252 2:127469210-127469232 GGGAGAGCGTGCTGCACGGGAGG + Intronic
937992556 2:127672686-127672708 TGGAGAAAGGGCTGCTGGGAAGG - Intronic
941697049 2:168563875-168563897 TGTAGGTTGGGGTGCACGGGGGG + Intronic
945435880 2:209817031-209817053 AGGAGAATGTGCTGCGCGTGGGG - Exonic
1168896648 20:1328352-1328374 TGGAGGATGGGCTACAGGGCAGG + Intronic
1168968367 20:1913876-1913898 GAGAGATTGGGGTGCACGGGGGG - Intronic
1170367197 20:15610772-15610794 TGGAGAACAGGCTGCAGTGGAGG - Intronic
1171368514 20:24644726-24644748 TGGAGAATGGGCTGTTCTGGAGG - Intronic
1172993181 20:39050706-39050728 TGGAGAGAGGGCTGCGCGGGTGG - Intergenic
1173349979 20:42235824-42235846 TGGAGAATGGGTAGCCCTGGGGG - Intronic
1174641494 20:52048484-52048506 TGGATTATGGGCTGCACAGCGGG - Intergenic
1176414637 21:6467624-6467646 TGGAGGAGGGGCTGGGCGGGCGG - Intergenic
1179258702 21:39739738-39739760 TGGAGCATGGGCTGTCAGGGTGG + Intergenic
1179487150 21:41717632-41717654 TGGAACACGGCCTGCACGGGTGG - Intergenic
1179945665 21:44672732-44672754 TGGAGAAGGGGCTGAGGGGGAGG + Intronic
1180716977 22:17878391-17878413 TGGAGACTGGGCTGGAGGTGGGG - Intronic
1181770030 22:25118654-25118676 AGGAGAATGGACTGGATGGGAGG - Intronic
1185178325 22:49344367-49344389 TGGGGCTTGGGCTGCCCGGGGGG + Intergenic
950080664 3:10219815-10219837 TGGGGCCTGGGCTGCAAGGGTGG + Intronic
950270341 3:11609732-11609754 TGGGGTGTGGGCTGCATGGGAGG + Intronic
950409695 3:12827468-12827490 TGGACGATGGGCTGGACGTGCGG + Exonic
950666363 3:14497695-14497717 TGAAGACTGGGCTGCAGGAGCGG + Intronic
952191271 3:31025779-31025801 TGGAGAATGGATTGCATTGGAGG - Intergenic
954407105 3:50351331-50351353 TGGAGAAAAGGCTGCAAGGCAGG - Exonic
954518086 3:51197938-51197960 TGGAGACTGGGATGCAAGTGGGG - Intronic
954676057 3:52315982-52316004 TGGAGAATGGACTTGAGGGGTGG - Intergenic
954699555 3:52444075-52444097 TGGGAAGTGGGCTGCAAGGGGGG + Intronic
954813835 3:53264994-53265016 TGGAGAAAGGGCTCCACTGAAGG - Intergenic
954910368 3:54101742-54101764 TGGAGGATGGGTTGGGCGGGAGG + Intergenic
955493472 3:59506574-59506596 TGGAGAATGGATTGCACTGCCGG + Intergenic
956785036 3:72635334-72635356 TGGAGAAGGGGCTACAAAGGTGG + Intergenic
957062733 3:75495320-75495342 TGGAGGATGAACTGCAGGGGAGG + Intergenic
959121670 3:102240378-102240400 TGGAGAATGGACTGGAGTGGGGG - Intronic
959739853 3:109705432-109705454 TGGAGGATGGGCCTCATGGGAGG - Intergenic
961007748 3:123416183-123416205 AGGAGAATGGGCCCCACGGAGGG - Intronic
961009188 3:123424625-123424647 TGGAGGAAGGGCTGTAAGGGTGG - Intronic
961290665 3:125844097-125844119 TGGAGGATGAACTGCAGGGGAGG - Intergenic
961485009 3:127210281-127210303 TGGTGAATGGCCCGCTCGGGGGG - Intergenic
962182524 3:133223443-133223465 TGGAGCATGGGTTGCAAGGGTGG + Intronic
962929346 3:140022676-140022698 TGGAGAATGGGATGGAGGTGGGG + Intronic
963623487 3:147641568-147641590 TGGAAAATGAGCTGCTCTGGAGG - Intergenic
963705018 3:148676273-148676295 TGGAGAATGGGCTTCCCAGAAGG + Intergenic
963932249 3:151015465-151015487 TGGAGAATAAGGTGCACGGTAGG - Intergenic
966207056 3:177415649-177415671 TGGAGAATGGGTAGCAATGGTGG + Intergenic
967101303 3:186218090-186218112 TGGAGACTGTGCTGCACCAGCGG + Intronic
967917132 3:194587130-194587152 TGTAGTATGGGCTGTAGGGGTGG - Intergenic
968542049 4:1172720-1172742 AGGAGAAGGGGCTGCGGGGGCGG + Intronic
969696873 4:8740002-8740024 TGGGGCATGGGCAACACGGGTGG + Intergenic
970105692 4:12580710-12580732 TGAAGGAGGGGCTGCACGGGTGG - Intergenic
971720612 4:30240860-30240882 AGGAGAATGGCGTGAACGGGAGG - Intergenic
972438911 4:39065443-39065465 AGGAGAATGGCTTGAACGGGAGG - Intronic
978885579 4:113762414-113762436 TGCAGAAGGGGCTGCGGGGGAGG - Intergenic
982296757 4:153836808-153836830 TAGAGAATGTGCTGCATGGATGG - Intergenic
982707209 4:158723336-158723358 TGGAGTTTGGGCGGCCCGGGCGG - Exonic
983956382 4:173703413-173703435 TAGAGAATGGGTTGAACTGGTGG + Intergenic
984467902 4:180124694-180124716 TGGAGAATGTGCTGTAATGGAGG - Intergenic
985988695 5:3538137-3538159 TGGGGCATGGGCTGCAGGGGAGG - Intergenic
986331436 5:6718871-6718893 TGGAGAAGGGGCTGCCCAGGAGG + Intronic
986536519 5:8793729-8793751 TGGAGGATGAGCTGGAGGGGTGG - Intergenic
986623387 5:9700468-9700490 TGGAAAATGGGGTGCATGGGTGG - Intronic
986758253 5:10857420-10857442 TGGAGAGGGGGCTGCAAGGAAGG - Intergenic
987979066 5:25056262-25056284 TGGACTATGAGCTGAACGGGGGG + Intergenic
990479446 5:56194648-56194670 TGGAGAATGGTATTCAAGGGTGG - Intronic
992145211 5:73840204-73840226 AGGAGAATGGCCTGAATGGGAGG - Intronic
998874335 5:146584090-146584112 TGGGGAATGAGCAGCAGGGGCGG + Intronic
1001269858 5:170302948-170302970 TGGAGGATGCGTTGCACGGGAGG - Intergenic
1002803705 6:551691-551713 TGGAGACAGGGCTGCAGGAGAGG - Intronic
1003016003 6:2468069-2468091 GGGAGTCTGGGCTGCAGGGGTGG + Intergenic
1003016022 6:2468160-2468182 CGGAGTCTGGGCTGCAGGGGTGG + Intergenic
1003090539 6:3098772-3098794 TGGAGATTGGGGTGCAAGGAAGG + Intronic
1003703294 6:8494742-8494764 TGGAGACTGGGCTGCACAGTGGG - Intergenic
1006719277 6:36139589-36139611 TGGAGAATCGCCTGCAGGTGGGG + Exonic
1010259225 6:73796161-73796183 TGGAGAATGTACTGAAGGGGAGG - Intronic
1011082912 6:83509181-83509203 TGGAGGAGGGGCTGCACTGAGGG + Intergenic
1016846798 6:148576241-148576263 TGGAGAATGGGCACTACAGGGGG - Intergenic
1017183595 6:151577702-151577724 TAGGAAATGGGCTGCACAGGAGG + Intronic
1017728769 6:157295899-157295921 TAGAGAATGGGCTCCACAGAAGG + Intronic
1018427325 6:163695140-163695162 TGGAGAATGGGGTGCGGGGTGGG - Intergenic
1018450360 6:163901630-163901652 TGGAGAATGTTCTGCCTGGGCGG + Intergenic
1019463388 7:1173169-1173191 AGGAGTTTGGCCTGCACGGGAGG - Intergenic
1019472265 7:1227350-1227372 AGGAGAAGGGGCTGCCCGGCGGG - Intergenic
1019563241 7:1667997-1668019 TGGAGGCCGGGCTGCACGGCAGG - Intergenic
1022450938 7:30514082-30514104 TGGAGATAGGGTTGCAGGGGAGG + Intronic
1024301815 7:47892746-47892768 TGGAGACAGGGCTGCAGGGGAGG + Intronic
1024869988 7:53953959-53953981 TGGAGATGGGGCTGAATGGGAGG - Intergenic
1024966324 7:55025220-55025242 TGGGGAATGGACTGCAGGAGTGG + Intronic
1026111140 7:67459726-67459748 TGGAGAACGGGCTGGGCAGGAGG - Intergenic
1026165033 7:67902011-67902033 TGGAGACTTGGCTGGAAGGGGGG - Intergenic
1026672041 7:72399183-72399205 AGGACAATGGGCTGCAAGGCTGG + Intronic
1027580900 7:79993861-79993883 AGGAGAATGGCGTGAACGGGAGG + Intergenic
1028525668 7:91783183-91783205 AGGAGAAGGGGCTGCAGGTGTGG - Intronic
1028872881 7:95788181-95788203 GTGGGAATGGGCTGCAAGGGAGG + Intronic
1030126521 7:106157750-106157772 AGGAGAATGGCGTGAACGGGAGG + Intergenic
1031647572 7:124245531-124245553 AGGAGAATTGACTGAACGGGAGG - Intergenic
1032378567 7:131450166-131450188 TGGAGAATGGGTTGCAGGGAGGG - Intronic
1032526617 7:132582625-132582647 TGGAGGATGGGCTCCTAGGGTGG - Intronic
1034137020 7:148780231-148780253 TGGAGACTGGGCTGGTCGTGCGG + Intronic
1034325810 7:150231284-150231306 TGGAGATGGGGCTTCATGGGAGG + Intergenic
1034439399 7:151078925-151078947 CGGAGAAGGGGCTGCAAAGGGGG + Exonic
1034767396 7:153737973-153737995 TGGAGATGGGGCTTCATGGGAGG - Intergenic
1036107667 8:5858062-5858084 TTGAGAGAGGGCTGCATGGGTGG - Intergenic
1037736383 8:21570231-21570253 TTAAGAATGGGCTGCACAGCAGG - Intergenic
1037788870 8:21919567-21919589 TGGAGAATGCGCAGCACCGCTGG - Intergenic
1037898565 8:22674306-22674328 TGGTGAATGGGATGAAGGGGTGG - Intergenic
1039559767 8:38503766-38503788 AGGAGACTGGTCTGCACGGTGGG - Intergenic
1039581153 8:38667851-38667873 TGGAGAGTGGGCTGGACTGTTGG - Intergenic
1044094992 8:88052491-88052513 TGAAGAATGGGCTCCAAGAGTGG - Intronic
1044692750 8:94895743-94895765 TGGCCAATGGGAGGCACGGGCGG + Intronic
1045031206 8:98138135-98138157 TGGAGAATGGGCTGAAAAGGAGG - Intronic
1047088647 8:121548297-121548319 TAGAGAAAGGGCTGCAATGGGGG + Intergenic
1047308608 8:123673735-123673757 TTGAGCATGGGCTGCAGGTGGGG + Intergenic
1050839578 9:10131080-10131102 TGGAGGCTGGGCTGCAGAGGAGG + Intronic
1054455903 9:65430296-65430318 TGGGGAATGGTCTGCAGGGCAGG - Intergenic
1056454743 9:86748950-86748972 TGGAGAATGGGTTGGATGGTAGG - Intergenic
1057755770 9:97833875-97833897 TGGAGAGTTGGCTGTATGGGAGG + Intergenic
1057794107 9:98143406-98143428 TGGAGACTGGGAGGCAGGGGTGG + Intronic
1058286532 9:103186927-103186949 TGGGAACTGGGCTGCACGCGGGG + Intergenic
1058893367 9:109380005-109380027 AGGAGGAGGGGCTGCACAGGTGG + Intronic
1059422462 9:114200805-114200827 TGGGGTGTGGGCTGCCCGGGAGG + Intronic
1060947509 9:127578921-127578943 TGGAGGATGGGGTGGATGGGAGG - Intronic
1060952026 9:127610054-127610076 TGGAGAAGGGGCTGTAAGAGTGG - Intergenic
1060972289 9:127745062-127745084 GGCAGAAGGGGCTGCAGGGGCGG + Exonic
1061131997 9:128713509-128713531 TGGAGATTGGGGTACACTGGCGG + Exonic
1061159152 9:128883122-128883144 TGGAGACTTGGCTGGAAGGGTGG + Intronic
1185513846 X:683595-683617 TGGAGACTGGATTGCAGGGGAGG + Intergenic
1197160157 X:123313877-123313899 TGGAGAAGGGGCAGCAGGGTGGG + Intronic
1198379500 X:136070587-136070609 GGGAGAGTGGGCTGTAGGGGAGG + Intergenic
1199854681 X:151750790-151750812 TGGAGAGTGGGTTGGAGGGGAGG - Intergenic
1200945126 Y:8827711-8827733 TGGAGCATGTGATGCACGTGTGG - Intergenic