ID: 1096258872

View in Genome Browser
Species Human (GRCh38)
Location 12:50078725-50078747
Sequence CCGCCTGCACCCCCAGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 243}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096258865_1096258872 6 Left 1096258865 12:50078696-50078718 CCTGGCTCATGTCTCTCTGACCT 0: 1
1: 0
2: 4
3: 22
4: 311
Right 1096258872 12:50078725-50078747 CCGCCTGCACCCCCAGGGATGGG 0: 1
1: 0
2: 3
3: 17
4: 243
1096258859_1096258872 21 Left 1096258859 12:50078681-50078703 CCCATCCCACACCCACCTGGCTC 0: 1
1: 0
2: 0
3: 73
4: 621
Right 1096258872 12:50078725-50078747 CCGCCTGCACCCCCAGGGATGGG 0: 1
1: 0
2: 3
3: 17
4: 243
1096258864_1096258872 9 Left 1096258864 12:50078693-50078715 CCACCTGGCTCATGTCTCTCTGA 0: 1
1: 0
2: 5
3: 30
4: 282
Right 1096258872 12:50078725-50078747 CCGCCTGCACCCCCAGGGATGGG 0: 1
1: 0
2: 3
3: 17
4: 243
1096258858_1096258872 22 Left 1096258858 12:50078680-50078702 CCCCATCCCACACCCACCTGGCT 0: 1
1: 0
2: 6
3: 63
4: 633
Right 1096258872 12:50078725-50078747 CCGCCTGCACCCCCAGGGATGGG 0: 1
1: 0
2: 3
3: 17
4: 243
1096258862_1096258872 15 Left 1096258862 12:50078687-50078709 CCACACCCACCTGGCTCATGTCT 0: 1
1: 1
2: 2
3: 41
4: 432
Right 1096258872 12:50078725-50078747 CCGCCTGCACCCCCAGGGATGGG 0: 1
1: 0
2: 3
3: 17
4: 243
1096258860_1096258872 20 Left 1096258860 12:50078682-50078704 CCATCCCACACCCACCTGGCTCA 0: 1
1: 0
2: 4
3: 62
4: 508
Right 1096258872 12:50078725-50078747 CCGCCTGCACCCCCAGGGATGGG 0: 1
1: 0
2: 3
3: 17
4: 243
1096258855_1096258872 26 Left 1096258855 12:50078676-50078698 CCCACCCCATCCCACACCCACCT 0: 1
1: 0
2: 14
3: 245
4: 1616
Right 1096258872 12:50078725-50078747 CCGCCTGCACCCCCAGGGATGGG 0: 1
1: 0
2: 3
3: 17
4: 243
1096258854_1096258872 30 Left 1096258854 12:50078672-50078694 CCAGCCCACCCCATCCCACACCC 0: 1
1: 0
2: 25
3: 336
4: 2294
Right 1096258872 12:50078725-50078747 CCGCCTGCACCCCCAGGGATGGG 0: 1
1: 0
2: 3
3: 17
4: 243
1096258861_1096258872 16 Left 1096258861 12:50078686-50078708 CCCACACCCACCTGGCTCATGTC 0: 1
1: 0
2: 1
3: 25
4: 271
Right 1096258872 12:50078725-50078747 CCGCCTGCACCCCCAGGGATGGG 0: 1
1: 0
2: 3
3: 17
4: 243
1096258856_1096258872 25 Left 1096258856 12:50078677-50078699 CCACCCCATCCCACACCCACCTG 0: 1
1: 0
2: 22
3: 178
4: 1471
Right 1096258872 12:50078725-50078747 CCGCCTGCACCCCCAGGGATGGG 0: 1
1: 0
2: 3
3: 17
4: 243
1096258863_1096258872 10 Left 1096258863 12:50078692-50078714 CCCACCTGGCTCATGTCTCTCTG 0: 1
1: 0
2: 4
3: 18
4: 305
Right 1096258872 12:50078725-50078747 CCGCCTGCACCCCCAGGGATGGG 0: 1
1: 0
2: 3
3: 17
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096258872 Original CRISPR CCGCCTGCACCCCCAGGGAT GGG Intronic
900404867 1:2488278-2488300 CCACCTACAGTCCCAGGGATGGG - Intronic
900418994 1:2547492-2547514 CCGACTGCAGCCCCTGAGATTGG + Intergenic
900624647 1:3602659-3602681 CCTCCTGCACCCCCAGCCTTGGG + Intronic
900977507 1:6026583-6026605 CCGCATGCCCGCCTAGGGATTGG + Intronic
901006055 1:6171986-6172008 CCGCCTCCACCCCCAGGAGGTGG - Intronic
901628753 1:10638346-10638368 CCGGCTGCTCCCCCAGGCCTGGG - Exonic
901776695 1:11565177-11565199 CCTCCTGCACCCACAGGGCAAGG + Intergenic
903080390 1:20806413-20806435 CAGACAGCACCCCCAGGAATGGG + Intronic
903807817 1:26017866-26017888 CAGCCAGCATCCCCAGGGCTGGG + Intergenic
904604514 1:31691433-31691455 CTCCCTGGACCCCCTGGGATAGG - Exonic
905447155 1:38034852-38034874 CCGCCTGCCTCCCCAGTGAGGGG + Intergenic
905632700 1:39527494-39527516 CGTGCTGCACCCCCAGGGAGGGG + Intergenic
905665116 1:39758923-39758945 CGTGCTGCACCCCCAGGGAGGGG - Exonic
905909386 1:41643402-41643424 CCGTCTGTACCCCCAGTGCTTGG + Intronic
906376984 1:45303878-45303900 CCGCCGGCGCCCCCTGGGATTGG + Intronic
910426181 1:87121935-87121957 CCGCCTCCACCCCCTAGGATTGG + Intronic
912467414 1:109883540-109883562 CCCCATGCACACCCAGGGCTGGG + Intergenic
913550761 1:119915373-119915395 CCTCCAGCACCCCCAGGGGTAGG + Exonic
914172066 1:145234097-145234119 TCTCCTGCACCGCCAGGGAAGGG + Intergenic
916037091 1:160932014-160932036 CAGTCTGCCCACCCAGGGATCGG - Intergenic
918181407 1:182088168-182088190 CCTCCTGCAGCCCCAGGCACAGG - Intergenic
919670457 1:200333001-200333023 CCACCTTCACCTCCAGGGAGGGG + Intergenic
920117144 1:203629005-203629027 CTGCCTTCAGCCCCAGGGCTTGG + Intronic
920386809 1:205575434-205575456 CTGCCTGCCACCCCAGGGGTGGG - Intronic
920857138 1:209672395-209672417 CTGCCTGGAGCCCCAGGGGTGGG + Intergenic
922721449 1:227902085-227902107 TCTCCAGCATCCCCAGGGATGGG + Intergenic
922740120 1:228009819-228009841 CCACCTGCCTCCCCAGGGCTGGG + Intronic
923226745 1:231944683-231944705 CCCCCTGCACCCTCAGGCCTAGG + Intronic
923256303 1:232224317-232224339 CAGCCTGCATTCCAAGGGATGGG - Intergenic
1062844446 10:692992-693014 CCACCTGCTCTCCCTGGGATTGG + Intergenic
1064769572 10:18710420-18710442 CCGCCTGCACGCCCGGGTAGGGG - Intergenic
1066351352 10:34640195-34640217 CAGCCTCCAGGCCCAGGGATGGG - Intronic
1069943985 10:71973495-71973517 CCGGCTGCCTCCCCAGGGGTGGG + Intronic
1070691706 10:78531951-78531973 CAGTCTGCAACCCCAGGGGTTGG + Intergenic
1070954518 10:80455110-80455132 TCTCCTCCACCCCCAGGGGTGGG + Intronic
1071565136 10:86667780-86667802 CTGCCTGCACCCCTTGGCATAGG - Intergenic
1073139886 10:101240031-101240053 CAGCCCCCACTCCCAGGGATGGG - Intergenic
1073188897 10:101635908-101635930 CCGCCCGCCCCCCCAGGGTAGGG - Intronic
1073327414 10:102650770-102650792 CCACCTGCCTCCCCAGGGAATGG - Intronic
1075396882 10:122133969-122133991 CTGCCTGCACCCCAAGGAAGAGG - Intronic
1075522747 10:123153921-123153943 GCGTGTGCACGCCCAGGGATAGG + Intergenic
1075541591 10:123318535-123318557 CCTTCTGCACCCCAAGTGATGGG + Intergenic
1076478120 10:130766679-130766701 GAGACTGCACCCTCAGGGATGGG + Intergenic
1076691343 10:132225203-132225225 CCCCCTGCAGCCCCTGGGCTTGG - Intronic
1076835903 10:133020858-133020880 CCGCCTTCCCCCCCAGGGGACGG + Intergenic
1076835915 10:133020881-133020903 CCGCCTTCTCCCCCAGGGGACGG + Intergenic
1076906904 10:133366984-133367006 CCGCCCGCACCTGCAGGGAGGGG + Exonic
1077044444 11:538176-538198 CCCCTTGCACCCCCAGGCCTTGG + Intronic
1077187577 11:1242275-1242297 CCGCCTGCAACCCCTGAGGTTGG - Exonic
1077596301 11:3534596-3534618 CCACCTGGAGGCCCAGGGATTGG + Intergenic
1078536740 11:12181026-12181048 TCGCTTGAACCCCCAGGGGTGGG - Intronic
1078568980 11:12441157-12441179 CCACCTCCACCCCCAAGGCTGGG - Intronic
1082224634 11:49689994-49690016 CAGCCTGCACTCCCATGGATAGG - Intergenic
1084252209 11:67908573-67908595 CCACCTGGAGGCCCAGGGATTGG + Intergenic
1084656982 11:70525434-70525456 CAGCCAGCAGGCCCAGGGATGGG + Intronic
1084820640 11:71687460-71687482 CCACCTGGAGGCCCAGGGATTGG - Intergenic
1085534851 11:77211687-77211709 CCGTCTGCACCCTCAGGGCCAGG - Intronic
1086624411 11:88929185-88929207 CAGCCTGCACTCCCATGGATAGG + Intronic
1087269027 11:96092523-96092545 CCGCCAGCTACCCCAGGCATGGG + Exonic
1089346526 11:117795162-117795184 CCTCCTGCACTCCCCGGGAATGG + Intronic
1089661700 11:119990316-119990338 CACCCTGCAGCTCCAGGGATGGG - Intergenic
1092422476 12:8343367-8343389 CCACCTGGAGGCCCAGGGATTGG + Intergenic
1096258872 12:50078725-50078747 CCGCCTGCACCCCCAGGGATGGG + Intronic
1103701749 12:122851727-122851749 GTCCCTGCACCTCCAGGGATAGG + Intronic
1105804820 13:23946754-23946776 CCTCCTGCACCCCCCAGGATGGG + Intergenic
1106799395 13:33241665-33241687 GCGCCTGCAATCCCAGGCATTGG - Intronic
1112103613 13:96217023-96217045 CCGCCTGCACCCCCAGGGTGTGG + Intronic
1113846435 13:113394222-113394244 CCTCCTGCACCTGCAGGGACAGG - Intergenic
1114318040 14:21525210-21525232 CCCCCTCCGCCCCCAGGGGTAGG - Exonic
1115965068 14:38878833-38878855 ACTCCTGTACCCACAGGGATGGG - Intergenic
1122038807 14:98967372-98967394 CCACCTGCACACCCAGCAATCGG + Intergenic
1122436946 14:101706857-101706879 CTGCCTGCACACCCTGGGACAGG + Intergenic
1124591805 15:31060681-31060703 ACGCCTGGACCGCCAGGGTTTGG + Intronic
1125506031 15:40268093-40268115 CCGCCTGCTCCCACAAGTATGGG - Intronic
1127679558 15:61279962-61279984 CCTCCTTCACTCCCAGGGAATGG + Intergenic
1128547774 15:68579315-68579337 GCGCCTGCATCCCCCGGGCTAGG + Intronic
1129458590 15:75688769-75688791 CCACCTGCACCTCCAGGGCCAGG + Exonic
1129725202 15:77898103-77898125 CCACCTGCACCTCCAGGGCCAGG - Intergenic
1130869800 15:87961639-87961661 CAGACTGCACCCTCAGGAATTGG - Intronic
1130993163 15:88888874-88888896 CCCCCAGCACCCCCAGGCTTGGG - Intronic
1132247975 15:100312002-100312024 CCTCCTGCAGCCTCAGGGCTGGG - Intronic
1132625172 16:888144-888166 CCCCCTGCACCCCAAGGCTTGGG - Intronic
1132670523 16:1100568-1100590 CCTCCCGCACCCCCCAGGATGGG - Intergenic
1133328317 16:4955995-4956017 CCTCCTCCAGCCCCAGGGAAGGG - Intronic
1133375805 16:5286234-5286256 CCACCTGGAGGCCCAGGGATTGG - Intergenic
1135047153 16:19165352-19165374 CAGCCTGCATTCCAAGGGATAGG - Intronic
1135539734 16:23320779-23320801 AGGCCTGGAGCCCCAGGGATGGG + Intronic
1136143630 16:28302552-28302574 CTGCCTGCACCCCCAGAGAAGGG - Intronic
1136230465 16:28882791-28882813 CTGCCTGCAGCCTCAGGGACAGG - Intronic
1136568953 16:31085537-31085559 CCGTCTGCACCCTCCAGGATGGG + Intronic
1139423823 16:66866529-66866551 CAGCCTGCTCCCCCAGGATTTGG - Intronic
1140225643 16:73074459-73074481 CCGCTTGCTTCCCCAAGGATAGG + Intergenic
1141148811 16:81550413-81550435 CCTCCTGCACCTCCATGGACAGG - Intronic
1142215923 16:88829793-88829815 GCGCCTGAAGGCCCAGGGATTGG - Intronic
1142557535 17:790001-790023 GCGCCTGCACCCCCAGCCACGGG - Intronic
1143473705 17:7191594-7191616 CAGCCTTCAGCCCCAGAGATGGG + Intronic
1144963543 17:19060867-19060889 CAGCCTTGACCCCCAGGGCTCGG - Intergenic
1144964147 17:19065173-19065195 CAGCCTTGACCCCCAGGGCTCGG + Intergenic
1144971616 17:19113659-19113681 CAGCCTTGACCCCCAGGGCTCGG + Intergenic
1144983819 17:19186971-19186993 CAGCCTTGACCCCCAGGGCTCGG - Intergenic
1144984406 17:19191268-19191290 CAGCCTTGACCCCCAGGGCTCGG + Intergenic
1145101270 17:20079855-20079877 CCTCCTGCCCACCCAGGGAAAGG - Intronic
1148547819 17:48530623-48530645 CCGCCTGCAGCCCCAGCTACGGG - Exonic
1148722510 17:49763968-49763990 CCGCCGGCTCCCCCCGGGCTGGG - Exonic
1149775361 17:59352886-59352908 CCACCTACAGCCCCAGGGAGAGG - Intronic
1150620942 17:66807337-66807359 CGGCCTGCAGCCTCAGGGAAAGG - Exonic
1151943446 17:77306631-77306653 CCCCCTTCACTCCCAGGGCTGGG - Intronic
1152516446 17:80827581-80827603 CCACCTGCACCCCCAGGGAGGGG + Intronic
1152627204 17:81393282-81393304 CCGCCTGCACCCGCGGGGCCGGG + Intergenic
1157975652 18:52324089-52324111 CCCCCTCCACCTCCAGGGAGAGG + Intergenic
1161495834 19:4585062-4585084 CCGCCTGGAGCCCCGGGGCTGGG + Intergenic
1161712222 19:5855299-5855321 CCACCTTCACCCACAGGGAGGGG + Intergenic
1161800861 19:6416199-6416221 CCGCCTGCACTTCTAGGGAAAGG + Intronic
1161840131 19:6675064-6675086 CCGGCTGGAGCCCCAGGGAGGGG - Intergenic
1162066972 19:8131734-8131756 CCGCCAGCCCCCCCAGGCACTGG + Exonic
1162986994 19:14277323-14277345 CCGCCAGCAACCCCAGGCACAGG - Intergenic
1163282454 19:16325777-16325799 CCGCCTGCGCCCCCAGCCTTCGG + Exonic
1163522888 19:17802429-17802451 CAGCCTGAAGCCCCAGGGCTGGG - Intronic
1166078198 19:40426056-40426078 CCGCCCTCCGCCCCAGGGATTGG + Intergenic
1166259077 19:41625566-41625588 CCGCCAGCACCCAGAGGTATGGG + Intronic
1166705457 19:44905728-44905750 CCGCCCCCTCCCCCAGGGATAGG - Intergenic
1166851921 19:45765348-45765370 CCCCCAGCACCACCAGGGCTTGG + Exonic
1166915814 19:46195633-46195655 CCACTTGCACCCCCAGGGCCGGG + Intergenic
1166965400 19:46526845-46526867 CCACCCCCACCCCCAGGGAATGG + Intronic
1167103166 19:47416572-47416594 CCCCCACCAACCCCAGGGATGGG + Intronic
1167151537 19:47713225-47713247 CCGCCTCCACCTCCAGCGTTGGG - Intergenic
1167499059 19:49835543-49835565 CAGCAGGCACCCCCAGGGCTGGG + Exonic
1167569283 19:50276856-50276878 CCGCCAGCTCCCCCAGGGCCTGG - Exonic
1168296085 19:55377911-55377933 GCGCCTGCACCCCCAGGGGGAGG + Intronic
924999823 2:396059-396081 CTGACTGCACCCACAGGGCTCGG - Intergenic
928522860 2:32107334-32107356 TCGCTTGAACCCACAGGGATGGG - Intronic
929053581 2:37857600-37857622 CCGCGGTCACCCCCAGGGGTAGG + Intergenic
929540814 2:42819322-42819344 CGGCCTGTACCCCCAGGGTGGGG - Intergenic
932779121 2:74549112-74549134 CCGCCTGCCCGCCCAGGCGTCGG + Intronic
933984226 2:87577225-87577247 CCTCCCGCACCCCCAGGGGCCGG - Intergenic
934563144 2:95323504-95323526 ACTCCTGCACCCGCAGGGAGGGG - Intronic
934738148 2:96700390-96700412 CCTCCTGCACACCCAGGGGCTGG + Intergenic
935128288 2:100242759-100242781 CCTCCTGCACCCCCAGGCTCTGG + Intergenic
936309628 2:111373571-111373593 CCTCCCGCACCCCCAGGGGCCGG + Intergenic
936531994 2:113282966-113282988 ACGCCTGCACCCACAGGCACGGG - Intergenic
939503414 2:143013997-143014019 ATTCCTGCTCCCCCAGGGATAGG - Intronic
939563087 2:143754648-143754670 CAGCCTGCACTCCCAGGGAACGG + Intronic
941857962 2:170249522-170249544 CTGTCTGCACTCCAAGGGATTGG - Intronic
942314231 2:174683022-174683044 CCGCCTGCCCCGCCAGCAATGGG + Intergenic
942890315 2:180980443-180980465 ACGCGTGCACCCCCAGGGTGAGG + Intronic
948518557 2:238521736-238521758 CAGCCTGCACCCTCAGGCCTGGG + Intergenic
949002907 2:241627746-241627768 CAGACTGCAACCCCAGGGAGAGG + Intronic
949073672 2:242041530-242041552 CCGCCTCCACCCACAGGGTGTGG - Intergenic
1169382382 20:5119521-5119543 CCGCCTGCACCTCCGGTGCTTGG - Intronic
1172181394 20:33005969-33005991 TTGCCTGCATCCGCAGGGATGGG - Intergenic
1172934476 20:38609860-38609882 CCGGCTGCAACCCCAGGGCCAGG + Intronic
1174376322 20:50128908-50128930 CTGGGTGCACCCCCAGGGAAGGG + Intronic
1174503882 20:51004485-51004507 GCGTCTGCAGCCCCAGGGAGTGG + Exonic
1176037086 20:63044798-63044820 CCGGCCTCACCCCCAGGGCTGGG + Intergenic
1176287574 21:5026575-5026597 CCTCCTGGAATCCCAGGGATTGG - Exonic
1176380084 21:6107994-6108016 CCCCCTCCACCCTCAGGGAATGG - Intergenic
1176384876 21:6134283-6134305 CTGCCTGCACCCCTGGGCATGGG - Intergenic
1177494649 21:21873157-21873179 CCTCCTCCAACCCCAGGCATTGG - Intergenic
1178703132 21:34851048-34851070 CCAGCTGCTCCCCCAGGAATCGG + Intronic
1179738596 21:43403969-43403991 CTGCCTGCACCCCTGGGCATGGG + Intergenic
1179743390 21:43430244-43430266 CCCCCTCCACCCTCAGGGAATGG + Intergenic
1179869607 21:44236900-44236922 CCTCCTGGAATCCCAGGGATTGG + Exonic
1180929476 22:19579185-19579207 CAGCCTCCAGCCCCAGGGACAGG - Intergenic
1181058751 22:20272069-20272091 CCCTCTGCAGCCCCGGGGATGGG - Intronic
1182335552 22:29581118-29581140 CCGCCTCCGCCACCAGGGCTTGG - Exonic
1182944057 22:34305610-34305632 CTGCCTGTACCCCCTGGGAAAGG + Intergenic
1183746572 22:39695191-39695213 CCGCCTGCAACCACAGGGAGGGG + Intergenic
1184147972 22:42622598-42622620 GCGGCTGCTCCCTCAGGGATGGG + Intronic
1184608208 22:45586364-45586386 CCTGCTGAACCCCCAGGGGTCGG + Intronic
1184775734 22:46621780-46621802 CAGCCTTCACCACCAGGGATGGG - Intronic
1184847852 22:47100129-47100151 CGGCCTGCAGCTGCAGGGATGGG - Intronic
1184916757 22:47574710-47574732 CACCCTGCACCCACAGGGACAGG - Intergenic
950076888 3:10193737-10193759 CTGCTGGGACCCCCAGGGATAGG - Intronic
950382996 3:12633354-12633376 ACGCCTGTACTCCCAGGTATAGG + Intronic
950478111 3:13226896-13226918 CAGCCTCCACCCCCAAGGACTGG + Intergenic
952103597 3:30043523-30043545 CCTCCTGCACCCCTTGGTATAGG - Intergenic
953687415 3:45088861-45088883 CCCCCCTCACCCCCAGGCATGGG + Intronic
956787923 3:72657834-72657856 CTGACTGCACCCACAGTGATGGG - Intergenic
957623342 3:82624147-82624169 CCATCTGCAGCCCCAGGGTTGGG - Intergenic
960020691 3:112948683-112948705 CAGTCTGCAGCCCCAGGGTTGGG + Intronic
960096692 3:113696496-113696518 CCGCCTGCTCCTCCGGGGCTGGG + Exonic
961519644 3:127459536-127459558 CAGACTGGACCCCCAGAGATGGG + Intergenic
968730482 4:2267213-2267235 ACGCCTGTACCACCAGGGCTAGG - Intergenic
968982040 4:3855557-3855579 CACCTTGCACCCCCAGGGCTGGG - Intergenic
969010880 4:4061040-4061062 CCACCTGGAGGCCCAGGGATTGG + Intergenic
970447918 4:16139656-16139678 CAGCCTGCACCCCCAGAGACTGG + Intergenic
974877399 4:67716124-67716146 CCGACTGCTGCCCCAGGGCTGGG - Intergenic
975327538 4:73077034-73077056 CCTCCAGCACCATCAGGGATAGG + Exonic
981104295 4:140863191-140863213 TCGCCTGAGCCCCCAGGGTTAGG - Exonic
982169104 4:152643979-152644001 CAGCAAGAACCCCCAGGGATGGG - Intronic
984992623 4:185396223-185396245 CCGCCTTCACCTCCCGGGTTGGG + Intronic
986661461 5:10063819-10063841 CTGACAGCACCCCCAGGAATGGG + Intergenic
986872151 5:12061247-12061269 CTGGCTGCTTCCCCAGGGATAGG + Intergenic
993069670 5:83144558-83144580 CCCCCCCCACCCCCACGGATTGG + Intronic
994163631 5:96584646-96584668 CAGCCTTCACCTCTAGGGATGGG + Intronic
996978164 5:129459915-129459937 CCGCCTGCACCCGCGCGGAACGG - Intergenic
997336785 5:133114282-133114304 CGGCATCCACCCCCAGGAATGGG + Intergenic
1001382137 5:171311869-171311891 CCGCCCGCACCCCCCGGGCCGGG + Exonic
1003060798 6:2860555-2860577 CCACCTGCACCCCCAGTGTGGGG + Intergenic
1005997780 6:30941901-30941923 CCACCTGTCCCCCCAGGGCTGGG - Intronic
1006121687 6:31810751-31810773 CCGTCTCCAGCCCCAGGGACAGG + Exonic
1006512861 6:34531032-34531054 CTGTCTGCAGCCCCAGGGTTGGG + Intronic
1006515864 6:34545251-34545273 CCGCATGCTCCTCCAGGCATCGG - Intronic
1006775906 6:36592424-36592446 ACACCTGCATCCCCAGGGCTTGG - Intergenic
1007485409 6:42177864-42177886 AGAACTGCACCCCCAGGGATGGG - Intronic
1007581128 6:42960791-42960813 CGGCCGCCACCCCCAGGGAGCGG - Exonic
1007829019 6:44624370-44624392 CCGCCTCCACCCCCAAGGCCAGG + Intergenic
1008460106 6:51759014-51759036 TCACCTGCACCTCCAGGAATAGG + Intronic
1010975406 6:82307175-82307197 CCGCCTGGACCACATGGGATGGG - Intergenic
1016461619 6:144285166-144285188 CCGCCCCCACCCCCCGGGAAGGG - Intergenic
1017499333 6:155009180-155009202 CAGCCTCCACCTCCAGGGTTCGG + Intronic
1017683496 6:156887677-156887699 CCTCCTGCACCCTCAGAGAGTGG + Intronic
1017857812 6:158366444-158366466 CCTCCTGCTGCCCCAGGGATGGG + Intronic
1019257586 7:61933-61955 CTGCTTGCACCCCCAGGGCCAGG + Intergenic
1019292370 7:257101-257123 GCCCCTGCACACCCAGGGAAGGG + Intronic
1019538710 7:1541854-1541876 CCGCCAGCTCCCCCAGGCAGGGG - Exonic
1019635847 7:2075176-2075198 CTTCCTGCACCTCCAGGGCTTGG - Intronic
1019687298 7:2388864-2388886 CCTCCTGGAGCCCCTGGGATGGG - Intergenic
1019687310 7:2388901-2388923 CCTCCTGGAACCCCTGGGATGGG - Intergenic
1019687333 7:2388989-2389011 CCTCCTGGAACCCCTGGGATGGG - Intergenic
1019687360 7:2389075-2389097 CCTCCTGCCACCCCTGGGATGGG - Intergenic
1019687371 7:2389116-2389138 CCTCCTGGAACCCCTGGGATGGG - Intergenic
1019687394 7:2389198-2389220 CCTCCTGCCACCCCTGGGATGGG - Intergenic
1019687405 7:2389239-2389261 CCTCCTGGAACCCCTGGGATGGG - Intergenic
1019687443 7:2389366-2389388 CCTCCTGGAACCCCTGGGATGGG - Intergenic
1019687595 7:2390378-2390400 CCTCCTGGAACCCCTGGGATGGG - Intergenic
1023054158 7:36278441-36278463 CCTTCTCCACCCCCAGGGCTGGG + Intronic
1024286091 7:47758834-47758856 ACCCCTGCACCCCCAGGGCACGG - Intronic
1025019822 7:55472255-55472277 TCTCCTGCACCGCCAGGGAAGGG - Exonic
1025236637 7:57239243-57239265 CTGCCTGCACTCCCAGGACTCGG + Intergenic
1026450497 7:70525139-70525161 CTGCCTGTACCTCCAGGGATGGG + Intronic
1026794924 7:73359900-73359922 CAGCCTGCTCCCCCAGGACTTGG - Intergenic
1029070160 7:97889050-97889072 CCACCTGGAGGCCCAGGGATTGG + Intergenic
1033595634 7:142856051-142856073 ATGCCAGCTCCCCCAGGGATGGG - Intronic
1034488584 7:151381275-151381297 CCGCCTGCAGCCCCTGAGGTGGG + Exonic
1034880626 7:154759749-154759771 CCTTCTGCAACCCCATGGATTGG - Intronic
1034946197 7:155263376-155263398 AAGGCTGCACCCCCAGGGAAGGG - Intergenic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035621332 8:1037433-1037455 GCTCCTGCACCCCCAGGGCCTGG + Intergenic
1036248395 8:7140637-7140659 CCACCTGGAGGCCCAGGGATTGG - Intergenic
1036252413 8:7173700-7173722 CCACCTGGAGGCCCAGGGATTGG + Intergenic
1036365081 8:8113760-8113782 CCACCTGGAGGCCCAGGGATTGG - Intergenic
1036643672 8:10599324-10599346 TGGCCTGCACCCCCTGGGCTGGG - Intergenic
1036650305 8:10637945-10637967 CTGCCTGCAGCCCCAGGGCTGGG + Intronic
1036885844 8:12552328-12552350 CCACCTGGAGTCCCAGGGATTGG + Intergenic
1038443808 8:27589233-27589255 CCGCCTCCAGCTGCAGGGATTGG - Intergenic
1044492613 8:92837311-92837333 CCTCCCGCTGCCCCAGGGATTGG + Intergenic
1046292129 8:112176653-112176675 CCTCCTCCACCCCCACTGATGGG - Intergenic
1048251715 8:132871566-132871588 GCGCCTGCACCCCTAGAGCTGGG + Intronic
1049566038 8:143339714-143339736 CCGCCTCCCCCACCAGGGACAGG + Intronic
1049600464 8:143505147-143505169 CCGCCAGCCCCTCCAGGGATGGG + Intronic
1049729549 8:144168867-144168889 CTTCCTGCACCCTCAGGGAGGGG + Intronic
1050602536 9:7267303-7267325 CTGCCTGCACGCCCAGGGATGGG + Intergenic
1053150568 9:35740395-35740417 GCCCCTTCAGCCCCAGGGATAGG + Intronic
1053175179 9:35917473-35917495 CAGCCTGCACCTCCTGGGACAGG + Intergenic
1056097672 9:83272228-83272250 CCGCCTGCAATCCCAGGCACTGG - Intronic
1059142213 9:111864285-111864307 ACACCTGCACCCCCAAGGGTGGG + Intergenic
1061196113 9:129108164-129108186 CCGTCTCTGCCCCCAGGGATGGG - Intronic
1061880493 9:133566570-133566592 CTGCCTGTCCACCCAGGGATGGG + Intronic
1062393264 9:136342480-136342502 ACGCCTCCTCCCCCAGGGCTGGG + Intronic
1062518068 9:136945913-136945935 CTCCCCGCCCCCCCAGGGATGGG + Exonic
1186422271 X:9435806-9435828 CCCCCTGCACTCCCTGAGATCGG + Intergenic
1198047013 X:132913303-132913325 CAGCCCGCAGCCCCAGGGCTAGG - Intronic
1200875093 Y:8146223-8146245 CCGCCTCAGCCCCCAAGGATTGG - Intergenic