ID: 1096259183

View in Genome Browser
Species Human (GRCh38)
Location 12:50080488-50080510
Sequence CAGGATGTTCTCCCTGCACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096259183 Original CRISPR CAGGATGTTCTCCCTGCACA GGG (reversed) Exonic
900312692 1:2041788-2041810 CGGGGTCTGCTCCCTGCACAAGG + Intergenic
900748370 1:4377018-4377040 CAGGATGTCCTCGCAGCACAAGG - Intergenic
901848818 1:12002065-12002087 CATCATGGACTCCCTGCACATGG + Exonic
901853457 1:12030018-12030040 CGGGATGCTCACCCTGCGCAGGG - Exonic
902537206 1:17126524-17126546 CGTGATGTTCTTCCTACACAAGG - Intergenic
903422859 1:23231222-23231244 AAGGATGCTCTTCCTGCACACGG - Intergenic
904877742 1:33669590-33669612 CTGGAAGTTCCCCCTGCAAATGG + Intronic
911226824 1:95316123-95316145 CAGGATGTTCACCTTACAGAGGG - Intergenic
911281342 1:95933265-95933287 CAGGCTCCTCCCCCTGCACAAGG + Intergenic
913975122 1:143449849-143449871 CAGGATTTCCTCCCTGGAGAGGG - Intergenic
914069514 1:144275465-144275487 CAGGATTTCCTCCCTGGAGAGGG - Intergenic
914109641 1:144690889-144690911 CAGGATTTCCTCCCTGGAGAGGG + Intergenic
915805347 1:158843035-158843057 AAGCATGTTCTCACTGCAAAGGG + Intronic
915808464 1:158879788-158879810 AAGGATGTTCTCCGTGAACAGGG + Intergenic
915813226 1:158938158-158938180 AAGGATGTTCTCACTGCACAGGG + Intronic
916818318 1:168374389-168374411 CAGGATTTTCTCCAAACACAGGG - Intergenic
920529562 1:206692117-206692139 CAGGCTGTTCCCTGTGCACAGGG + Intronic
924558196 1:245135077-245135099 CATGATGTGCTCCTTTCACATGG - Intergenic
1064231794 10:13535798-13535820 CAGGATAATCTCCCTTCACAAGG + Intergenic
1064734723 10:18370217-18370239 CAAAATGTGCTCCCTGCACCAGG + Intronic
1064950692 10:20846544-20846566 CAGGATGTTCTCAATGCAACTGG - Intronic
1065013009 10:21436462-21436484 CAGGATGCCCTCGCTTCACAGGG + Intergenic
1066005828 10:31145433-31145455 TATGATATTCTGCCTGCACATGG + Intergenic
1068868266 10:61917537-61917559 CAGGCTGGTCTCACTGCACCTGG + Intronic
1069599651 10:69695237-69695259 CTGGAGGTGCTCCCTGCAAAAGG - Intergenic
1073779829 10:106825125-106825147 CAAGCTGTTCTCCCTTCACAAGG - Intronic
1073802438 10:107056973-107056995 CAGGAAAGTCTCCGTGCACACGG - Intronic
1075099421 10:119495657-119495679 CAGGCTGTGCTCTCTGCACATGG + Intergenic
1079011979 11:16836032-16836054 CATGATGTTGTCCCTGGCCATGG + Intronic
1080396126 11:31891653-31891675 CAAGATGTTCTCCCTATACCTGG - Intronic
1080580082 11:33635130-33635152 CAGGAAGTTCTCACTTCACCAGG - Intronic
1080642959 11:34168501-34168523 CAGGGTGATTTCCATGCACAGGG - Intronic
1081221122 11:40463367-40463389 CAGGATGTTGTGACAGCACATGG + Intronic
1081532166 11:43969593-43969615 CAGGATTCTCTCCCACCACAGGG - Intergenic
1081891417 11:46545500-46545522 CAGGTTGTTATCCCTGCTCAGGG - Intronic
1082712706 11:56573535-56573557 CAAAATTTTCTCCCTTCACATGG + Intergenic
1082715690 11:56610246-56610268 CAAAATTTTCTCCCTTCACATGG + Intergenic
1082913691 11:58407176-58407198 CGGGATGTTTTCCCTGAGCAGGG + Intergenic
1083878070 11:65535156-65535178 CAGGAGGCTGTTCCTGCACAAGG + Intronic
1084258098 11:67956014-67956036 CCCGATGGTCTCCCTGCCCAAGG + Intergenic
1084517778 11:69645797-69645819 CTGGGTGTTCTCCCTGCACTAGG + Intronic
1084568172 11:69943464-69943486 GTGGATGTTCCCACTGCACAGGG + Intergenic
1084814653 11:71639205-71639227 CCCGATGGTCTCCCTGCCCAAGG - Intergenic
1085096322 11:73763054-73763076 ATGCATGTTCTACCTGCACATGG - Intergenic
1089076483 11:115742679-115742701 CAGGCTGTGCCCCATGCACAGGG + Intergenic
1091510677 12:1121256-1121278 CACTATATTCTCTCTGCACAGGG - Intronic
1092429421 12:8396963-8396985 CCCGATGGTCTCCCTGCTCAAGG + Intergenic
1096259183 12:50080488-50080510 CAGGATGTTCTCCCTGCACAGGG - Exonic
1097130845 12:56809861-56809883 CAGGATGACCTGCCTGCAGAGGG - Intergenic
1100911959 12:99374447-99374469 CAGGATGCTGTCCCTTCACGGGG - Intronic
1101570822 12:105952044-105952066 CAGGATGTTCCCCCAGCAGGAGG - Intergenic
1102250638 12:111384790-111384812 CAGGCTGTTATCCTTGCTCACGG - Intergenic
1102951103 12:117032262-117032284 CAGGATGCCCTCCCATCACAGGG + Intergenic
1103883972 12:124187470-124187492 CAGGAGGTTCTCTGTGCCCAAGG - Intronic
1105628185 13:22134512-22134534 CAGGATTGTCTCACTTCACAAGG + Intergenic
1106255287 13:28016903-28016925 CTGGATGTTCACCCTGGACAAGG + Intronic
1107580375 13:41777357-41777379 CAGGAAGTTCTCCCTGCAGAAGG + Intronic
1108098520 13:46930236-46930258 CAGGAACTTCTCCATTCACATGG - Intergenic
1111866277 13:93772719-93772741 CAGAATGTTGGTCCTGCACAGGG + Intronic
1112168851 13:96948574-96948596 CAGCATTTTCTCCCAGAACAGGG + Intergenic
1114409659 14:22488894-22488916 CAGCACGTTCTCACTGCACACGG + Intergenic
1116167655 14:41354062-41354084 CAGGATGTTCCCCCTTCAACAGG + Intergenic
1118342212 14:64904265-64904287 CAGGGTGTTCCCCCGACACAAGG - Intergenic
1118751335 14:68809746-68809768 CCTGATGTTCTCCTGGCACAGGG - Intergenic
1119099816 14:71869416-71869438 AAGGATGGTCTCCCTCCACCTGG - Intergenic
1122392705 14:101401128-101401150 CAGGAAATTCTACGTGCACAGGG - Intergenic
1122954428 14:105063745-105063767 GAGGAACTGCTCCCTGCACATGG - Intronic
1126333301 15:47557536-47557558 CAGGCTGATTTCCCTGCACTTGG - Intronic
1127064040 15:55218647-55218669 GATGATGTTCTCCCTGCTGAAGG - Intronic
1127663631 15:61123406-61123428 CAGGATGTGTTCCCTGCCCTGGG + Intronic
1131271559 15:90950376-90950398 CAGGCTGTCCTCCCTGCCCCAGG - Intronic
1132030195 15:98432847-98432869 CAGGATGGGCTCCCAGCAGATGG - Intergenic
1133369878 16:5239542-5239564 CCCGATGGTCTCCCTGCCCAAGG - Intergenic
1133515080 16:6501027-6501049 TAGGATGGTCTCACTGCCCATGG + Intronic
1134752793 16:16639398-16639420 CAGGTTGTTTCCCCAGCACAGGG - Intergenic
1134820640 16:17244147-17244169 CAGGATGTTCTCCCAGGTCCGGG + Intronic
1134993265 16:18719678-18719700 CAGGTTGTTTCCCCAGCACAGGG + Intergenic
1135258883 16:20964122-20964144 CAGGATGTTACCCTTGGACATGG + Exonic
1136567960 16:31081218-31081240 CAGGTGGTTCTCCCTGGTCAAGG + Exonic
1137500909 16:49011056-49011078 CAGAAGCTTCTCCCAGCACAGGG - Intergenic
1138007652 16:53353256-53353278 CTGGATGTTTTCCATGTACAAGG - Intergenic
1138035374 16:53600074-53600096 CTGGTTCTTCTCCCTGCAGAAGG + Intronic
1138129702 16:54469429-54469451 CAGGATTTTTTCCCTACCCAGGG + Intergenic
1138522305 16:57577909-57577931 CAGGAAGTGGTCCCTGCCCAGGG - Intronic
1145275879 17:21430016-21430038 CAAGATGTTCTCCCTGGAAGAGG + Intergenic
1145313727 17:21715929-21715951 CAAGATGTTCTCCCTGGAAGAGG + Intergenic
1145712166 17:26987902-26987924 CAAGATGTTCTCCCTGGAAGAGG + Intergenic
1152383013 17:79951954-79951976 CAGGAGGTTCTCTTAGCACATGG - Intronic
1158465977 18:57690239-57690261 CTTGATATTCTTCCTGCACAGGG - Intronic
1159855075 18:73577132-73577154 CAGGATTTTCTCCCTTTGCATGG + Intergenic
1160757664 19:766111-766133 CAGGATGTTCTCCTGTCTCACGG + Intergenic
1161605825 19:5214360-5214382 CAGGACATTCTCTCTGCACAAGG - Exonic
1163632294 19:18423745-18423767 CAGGCAGCTCTCCCTGCAGAAGG - Intronic
1168267720 19:55231544-55231566 CAGGCTGCTCTCTCTGCCCAGGG + Intronic
925098462 2:1226324-1226346 CAGAATGTTCTCCATGTACATGG + Intronic
929267004 2:39929278-39929300 CAGGATGATCCCCCTGCAGAGGG + Intergenic
933047102 2:77553092-77553114 CAGGCTTGTCTCCCTGGACAGGG - Intronic
933274250 2:80266854-80266876 CTGGATGTTCTGCCTCCAGATGG + Intronic
933309918 2:80647755-80647777 CAGGCTTTTCTCTCTTCACAAGG - Exonic
934041053 2:88127771-88127793 CAGCAAGTCCTCACTGCACAAGG - Intronic
934290115 2:91685083-91685105 CAGGATTTCCTCCCTGGAGAGGG - Intergenic
936285725 2:111179777-111179799 CAGGATGCCCTCCCTGGGCAAGG - Intergenic
936329538 2:111535885-111535907 CATGATGTGATCTCTGCACAGGG - Intergenic
937095968 2:119235351-119235373 CAGAAAGTCCTCCCTGCTCACGG - Intronic
941844304 2:170118087-170118109 CAGTATGATCGCCCTGCAAATGG - Intergenic
945485446 2:210390131-210390153 CAGGATGTTAAACATGCACATGG + Intergenic
1169027781 20:2384895-2384917 CAGGATGAGCTCCCAGCCCAAGG - Intronic
1169336658 20:4762457-4762479 CAGGATGGTCTCTTTGCAAAGGG + Intergenic
1170946991 20:20900430-20900452 CAGGATCCTCCCCCTGCATAAGG + Intergenic
1172307385 20:33890356-33890378 AAGGATGTTCTCCAGGCAGAAGG - Intergenic
1174839811 20:53891143-53891165 AAGGATGTTCTCCCTGGCCAGGG - Intergenic
1176041420 20:63067883-63067905 CAGGAAGGGCTCCCTGCAAAGGG + Intergenic
1177447310 21:21214548-21214570 CAGGATGTGCTATCAGCACAAGG + Intronic
1177511671 21:22094675-22094697 CAAGATGTAATCCCTCCACAGGG + Intergenic
1177534394 21:22405402-22405424 CAAGATATTTTCCCTTCACAAGG - Intergenic
1178011898 21:28296798-28296820 TAGGATGTTATAGCTGCACAAGG - Intergenic
1178944118 21:36932032-36932054 CAGGATGCCCTCCCATCACAGGG - Intronic
1179158618 21:38873695-38873717 TCGGAGGTTCTCCCTGCATATGG - Intergenic
1180974860 22:19842722-19842744 CAGCATGTTTTCCTTGCCCAGGG - Intronic
1182143560 22:27982934-27982956 CAGGAGCTCCTCCCTGCCCAAGG - Exonic
1182430761 22:30297638-30297660 CAGGAGGTCCTGCCTGCCCAAGG + Intronic
1183278977 22:36922248-36922270 CAGGCTGCGCTCCCAGCACAGGG - Exonic
1183350680 22:37333059-37333081 CCCGACCTTCTCCCTGCACACGG + Intergenic
952820944 3:37485120-37485142 CAGGAAATTCTCTCTCCACACGG - Intronic
952998075 3:38904664-38904686 CAGGATTTACTCCCTGCAAGGGG - Intronic
953648113 3:44773980-44774002 CAGGCTTCTCTCCCTGCATAAGG + Intronic
954035962 3:47851347-47851369 CAGGACAGCCTCCCTGCACATGG + Intronic
955117207 3:56017570-56017592 CAGGGCTTTCTCCCTCCACAAGG + Intronic
957073041 3:75580522-75580544 CCCGATGGTCTCCCTGCCCAAGG + Intergenic
959293857 3:104510572-104510594 AAGGCTGTTCTCCCTGCCCTGGG - Intergenic
960473894 3:118100428-118100450 CAGGATTTTCTACCTCCCCAAGG - Intergenic
961207461 3:125096439-125096461 CAGCATGTTCCCCCAGCACTTGG + Intronic
961281042 3:125766255-125766277 CCCGATGGTCTCCCTGCCCAAGG - Intergenic
961873350 3:130003330-130003352 CCCGATGGTCTCCCTGCCCAAGG + Intergenic
962582596 3:136811856-136811878 CAGGCTCTTCCCCCTGCATAAGG + Intergenic
962815376 3:138992675-138992697 CAGGCTGTTCCCCCTGGCCAGGG + Intergenic
966819838 3:183915684-183915706 CAGGATGATCTCAGGGCACAGGG + Intergenic
968422895 4:499902-499924 CAAGATGTTTTCCCTGCCTAGGG + Intronic
969016644 4:4107819-4107841 CCCGATGGTCTCCCTGCCCAAGG + Intergenic
969737311 4:9000496-9000518 CCCGATGGTCTCCCTGCCCAAGG - Intergenic
969829455 4:9782800-9782822 CAGGATTTCCTCCCTGGAGAGGG + Exonic
970223109 4:13830648-13830670 CCTGTTGTTCTCCCTGCACGGGG + Intergenic
970385239 4:15549539-15549561 CAGGCTGTAATCCCAGCACATGG + Intronic
970921084 4:21395994-21396016 CAGCATGGTCTGCCTGCAAAGGG - Intronic
972421647 4:38893123-38893145 CAGGATGCTATCTCTTCACAAGG + Intronic
980433526 4:132737586-132737608 CAGGAGGTGCTCCCTCCACTTGG - Intergenic
980526026 4:133992187-133992209 CAGTATGGTCGCCCTGCAAATGG + Intergenic
984807632 4:183766293-183766315 CGGGATGCTGTCCCTTCACACGG - Intergenic
986199448 5:5568194-5568216 CAGGACGTTGTCCCATCACAGGG - Intergenic
986727826 5:10612619-10612641 CAGGAAGTTGTCCCCTCACAGGG + Intronic
987624698 5:20383354-20383376 CAGTATGTTTTCCCAGCATATGG - Intronic
988495442 5:31741729-31741751 GTGTTTGTTCTCCCTGCACAGGG + Intronic
990251155 5:53916460-53916482 CAGGTTGTTTTCCCTGCAGCAGG - Intronic
990555348 5:56928926-56928948 CAGTATGTTTTCCCTGTAAAAGG + Intronic
990998611 5:61758943-61758965 CAGGCAGTTCTCTCTGCCCAGGG - Intergenic
991501175 5:67278998-67279020 CAGTATGCTCCCCCTCCACAAGG + Intergenic
993689469 5:90981600-90981622 CAGGATGTCATCCCATCACAGGG - Intronic
995930133 5:117431590-117431612 CAGGATGCTATACCTTCACAGGG - Intergenic
999760736 5:154699041-154699063 CAGGATGTTCTGCCTGGAAAAGG + Intergenic
1000277966 5:159755883-159755905 CAGGATATTCTCACTTCACCTGG - Intergenic
1001436310 5:171702444-171702466 CAGGAAGTTTTCCCTTCTCAAGG + Intergenic
1002452416 5:179326439-179326461 TAGGATGCTCTCCCTGCCCCAGG - Intronic
1003276154 6:4655158-4655180 CGGGATGTTCTTCCTACGCAGGG - Intergenic
1006843346 6:37046103-37046125 CAGGATGTCCCCTCTGGACATGG - Intergenic
1014339011 6:120179298-120179320 CAGCATGTTCACATTGCACATGG + Intergenic
1018985479 6:168633401-168633423 AAGTAAGTGCTCCCTGCACATGG + Intronic
1020615329 7:10452653-10452675 CAGGTTGTTATCCTTGGACATGG - Intergenic
1022326048 7:29332946-29332968 GAAGATGTCCTCTCTGCACAGGG + Intronic
1022530636 7:31064874-31064896 CTGGATCTTCTCCAGGCACATGG - Exonic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023482026 7:40644729-40644751 CAGGAGCTTCCTCCTGCACACGG - Intronic
1029075121 7:97928619-97928641 CCCGATGGTCTCCCTGCTCAAGG + Intergenic
1029610550 7:101624428-101624450 CAGGACGTTTTCCCAGCCCATGG + Intronic
1030860637 7:114621609-114621631 TAGGATGCTCTCACTGCACTTGG - Intronic
1032433374 7:131880773-131880795 CAGGATGTTCTTCTTGTACCTGG + Intergenic
1035428207 7:158796695-158796717 CAGGATGGCCTCCCGGCAGATGG + Intronic
1035469872 7:159102880-159102902 CAGAGTGTGCTCCCTGCACAGGG - Intronic
1036258383 8:7222253-7222275 CCCGATGGTCTCCCTGCTCAAGG + Intergenic
1036259443 8:7228397-7228419 CCCGATGGTCTCCCTGCTCAAGG + Intergenic
1036307183 8:7611127-7611149 CCCGATGGTCTCCCTGCCCAAGG - Intergenic
1036310436 8:7680849-7680871 CCCGATGGTCTCCCTGCTCAAGG + Intergenic
1036311485 8:7686967-7686989 CCCGATGGTCTCCCTGCTCAAGG + Intergenic
1036358025 8:8059114-8059136 CCCGATGGTCTCCCTGCTCAAGG - Intergenic
1036359101 8:8065256-8065278 CCCGATGGTCTCCCTGCCCAAGG - Intergenic
1036830326 8:12015371-12015393 CCCGATGGTCTCCCTGCCCAAGG + Intronic
1036891857 8:12601696-12601718 CCCGATGGTCTCCCTGCCCAAGG + Intergenic
1036892922 8:12607832-12607854 CCCGATGGTCTCCCTGCCCAAGG + Intergenic
1037380946 8:18284516-18284538 CAGGATGTAGTCCCTGGCCAGGG - Intergenic
1038206457 8:25471277-25471299 CTGCATGGTCCCCCTGCACAGGG + Intronic
1039870261 8:41540010-41540032 CAGGACGTTCTCCCTGCAGGTGG + Intronic
1040059158 8:43089502-43089524 AAGGATGTTTTCACTGCATATGG + Intergenic
1044053726 8:87542470-87542492 CAGGATGACCTGCCTGCAGAAGG - Intronic
1046412129 8:113859283-113859305 CAGGCTCCTCCCCCTGCACAAGG - Intergenic
1047024323 8:120810689-120810711 CTGGACGTTCCCCCTGCAAATGG - Intronic
1049333520 8:142069034-142069056 CAGGATTTTCTTCCTGCTTAAGG - Intergenic
1049450621 8:142659554-142659576 CACGATGGCCTCCCTGCTCAAGG - Intronic
1050925219 9:11256066-11256088 CAGTATGATCACCCTGCAAATGG + Intergenic
1052396401 9:27943883-27943905 CAGGATGTTCTCCAGGGAGAAGG + Intergenic
1058774277 9:108268447-108268469 AAGGATGTTTTCCCTGGTCAAGG - Intergenic
1058979042 9:110152294-110152316 CAGGATGTTCTCATTGAAAATGG + Intronic
1060212768 9:121720611-121720633 CAGGGTGTGCTCACTGCCCAGGG - Intronic
1060259127 9:122058289-122058311 CAGGCTTTCCTCCCTCCACATGG - Intronic
1061743915 9:132726112-132726134 CAAGATGTGCTCCCCGCTCAAGG + Intronic
1061842161 9:133365088-133365110 CAGCAAGGTCTCCCTGCACCTGG - Intronic
1062400438 9:136370326-136370348 CACCATCTTCTCCCTGCGCAAGG - Exonic
1185814626 X:3143569-3143591 CAGGATGTTTCTCCTGCACATGG + Intergenic
1186319543 X:8409533-8409555 GAGGCTGGTTTCCCTGCACATGG + Intergenic
1197722524 X:129754989-129755011 CAGGATGCTCTCCCAGGACTGGG + Intronic
1199883497 X:151995695-151995717 CAGGCTGTCCTCCCTGAACAGGG + Intergenic
1200153000 X:153960389-153960411 CAGGATGGTCTCCCAGGCCATGG + Exonic
1201266692 Y:12213625-12213647 CAGGAAGTGTGCCCTGCACAGGG - Intergenic
1201520659 Y:14870194-14870216 CAGTATGGTCGCCCTGCAAATGG + Intergenic
1201719189 Y:17078430-17078452 CAGGAAGTTTGTCCTGCACAGGG + Intergenic