ID: 1096259420 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:50081547-50081569 |
| Sequence | GGCCCCGAAGGCTCTCGCAC GGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 85 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 75} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1096259420_1096259430 | 25 | Left | 1096259420 | 12:50081547-50081569 | CCCGTGCGAGAGCCTTCGGGGCC | 0: 1 1: 0 2: 0 3: 9 4: 75 |
||
| Right | 1096259430 | 12:50081595-50081617 | CAACATCCTACCTCACCATCCGG | 0: 1 1: 0 2: 0 3: 7 4: 132 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1096259420 | Original CRISPR | GGCCCCGAAGGCTCTCGCAC GGG (reversed) | Exonic | ||