ID: 1096259420

View in Genome Browser
Species Human (GRCh38)
Location 12:50081547-50081569
Sequence GGCCCCGAAGGCTCTCGCAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096259420_1096259430 25 Left 1096259420 12:50081547-50081569 CCCGTGCGAGAGCCTTCGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1096259430 12:50081595-50081617 CAACATCCTACCTCACCATCCGG 0: 1
1: 0
2: 0
3: 7
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096259420 Original CRISPR GGCCCCGAAGGCTCTCGCAC GGG (reversed) Exonic