ID: 1096280531

View in Genome Browser
Species Human (GRCh38)
Location 12:50249008-50249030
Sequence CCAATTGATGTTTGCACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096280531_1096280537 17 Left 1096280531 12:50249008-50249030 CCCACTGTGCAAACATCAATTGG 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1096280537 12:50249048-50249070 GTCTGTTCCAAAGTCACATTTGG 0: 1
1: 0
2: 0
3: 6
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096280531 Original CRISPR CCAATTGATGTTTGCACAGT GGG (reversed) Intronic
901034213 1:6326536-6326558 CCAATCAATGTCTGAACAGTGGG + Intronic
906247737 1:44289027-44289049 CCAGATGATGTTTGGGCAGTTGG - Intronic
906657810 1:47561421-47561443 CCAAATGCAGTCTGCACAGTAGG + Intergenic
909293636 1:73915361-73915383 CAAATTGTTATTTGCAAAGTGGG + Intergenic
920551833 1:206868119-206868141 TCAACTGATGTGTGCACCGTAGG + Intronic
922532451 1:226354788-226354810 AAAATTGATGTTTGCAGCGTTGG - Intergenic
922972567 1:229755294-229755316 CCTACTGATGTTTGCTCACTGGG - Intergenic
923401094 1:233615480-233615502 TCAATTGGTATTTGGACAGTGGG + Intronic
924294422 1:242570879-242570901 CCATGTGATCTCTGCACAGTTGG - Intergenic
1065979329 10:30875938-30875960 CATATTGTTGTTTGCATAGTAGG - Intronic
1066081061 10:31930358-31930380 CCAATTCAGGTTTGGAGAGTAGG - Intergenic
1066374471 10:34844847-34844869 CCAGTTGGTGTCTGCAGAGTTGG + Intergenic
1067104148 10:43354485-43354507 CCAATGGATGATATCACAGTGGG - Intergenic
1070527102 10:77304730-77304752 CCAATTAATATTTGCCCAGTGGG + Intronic
1072433033 10:95390415-95390437 CCAAATGATGTTGGCTCACTTGG - Intronic
1077293000 11:1808308-1808330 CAAATTAATGTTTACAAAGTTGG + Intergenic
1080747579 11:35122364-35122386 CTAGTTGTTGTTTGCAAAGTTGG - Intergenic
1082113600 11:48304612-48304634 CTTATTGATGTCTGCACATTTGG + Intergenic
1082939366 11:58687754-58687776 CAAATTGTTTTCTGCACAGTTGG - Intronic
1085195125 11:74666070-74666092 ATAATTGATGTTTGTACATTGGG - Intronic
1086333382 11:85776133-85776155 CCAAGTGATCTCTGCACAGCTGG + Intronic
1086391574 11:86370391-86370413 CCAAGTGATCTCTGCACAGCTGG + Intergenic
1095682576 12:44996077-44996099 TCATTTGATGTTAGCAAAGTTGG - Intergenic
1096280531 12:50249008-50249030 CCAATTGATGTTTGCACAGTGGG - Intronic
1097675543 12:62598502-62598524 GCAAATGAAATTTGCACAGTTGG - Exonic
1098745296 12:74230354-74230376 CCAATGGATGTTTTCTTAGTAGG - Intergenic
1098977090 12:76913877-76913899 CCAGTTGATGTCTGGAGAGTTGG + Intergenic
1104194455 12:126519707-126519729 AGAATTCATGTTTTCACAGTTGG - Intergenic
1104218661 12:126760448-126760470 CCAACAGATATTTACACAGTGGG - Intergenic
1105652489 13:22394770-22394792 CCAATTGAAGTTAGCAGAATTGG - Intergenic
1106961916 13:35008928-35008950 CCAACTGTTGTTTTTACAGTGGG + Intronic
1111957140 13:94771695-94771717 GCAATTGATGTTTTCACCTTAGG + Intergenic
1115982458 14:39069199-39069221 CCAAGTGATGGTAGCACAGATGG - Intronic
1116607992 14:47027288-47027310 TGAATTCATTTTTGCACAGTTGG + Intronic
1117463345 14:55968413-55968435 GCCATTGATAATTGCACAGTAGG + Intergenic
1118039545 14:61902093-61902115 CCAAATTATGTTGGCACAGCAGG - Intergenic
1120089555 14:80315244-80315266 CCAATCAATGCTTGCACAGATGG - Intronic
1127325910 15:57895350-57895372 CCATTTAACGTTTGCAAAGTAGG + Intergenic
1129255358 15:74331141-74331163 CCAACTGATGATGGCAGAGTAGG + Intronic
1137660089 16:50197782-50197804 CAAGTTGAGGTTTGTACAGTTGG + Intronic
1141489402 16:84361934-84361956 CCAATGGATGGTTGTCCAGTAGG - Intergenic
1143098263 17:4490100-4490122 CCAATGCATGTTTGTAGAGTTGG - Intergenic
1145833882 17:27939215-27939237 CCAATAAATGCTTGCAGAGTGGG + Intergenic
1147121597 17:38338288-38338310 CCTATTGATGTTTGCCCGGCAGG + Intronic
1149856409 17:60087002-60087024 CCATTTCATGTTTGCACCCTGGG + Intergenic
1152192075 17:78894573-78894595 ACAAATGATGCTGGCACAGTTGG + Intronic
1154042881 18:10875761-10875783 CAAAGTGATGTTTGCAAATTGGG - Intronic
1160212296 18:76891736-76891758 ACAAATGATGTTTGCACATCTGG - Intronic
1164893999 19:31853547-31853569 AAAATTGATGTTTGCACTTTAGG - Intergenic
1168363263 19:55761186-55761208 CCACATGCAGTTTGCACAGTTGG + Intronic
1168364212 19:55771191-55771213 CCACATGCAGTTTGCACAGTTGG + Intronic
925245976 2:2383419-2383441 CACATTGATGTGTGCAGAGTGGG - Intergenic
926166104 2:10522822-10522844 TCACTTGATGTTTTCACTGTGGG + Intergenic
926769771 2:16359704-16359726 CCAATAGATGTTTGCAAAATGGG - Intergenic
926881239 2:17545947-17545969 ACAATTGATGGTTACACAGCAGG - Intronic
927900282 2:26813965-26813987 CCAATAGATGTTTGCGGAGGAGG - Intergenic
928674976 2:33641757-33641779 CCAATTGATGTTCAGAGAGTTGG - Intergenic
929951419 2:46412506-46412528 CTATTTGTTATTTGCACAGTGGG - Intergenic
934332600 2:92084586-92084608 CCAACGGATATTTGCATAGTTGG + Intergenic
935493319 2:103747075-103747097 CCAGTTGATGTCTGGAGAGTTGG + Intergenic
935841912 2:107122678-107122700 CCATTTGATGTTTACACCTTAGG - Intergenic
941889718 2:170567072-170567094 CAAATTGTTGTTTCCACAGAAGG - Intronic
943231663 2:185261250-185261272 CCTATTCAGGTTTGCAGAGTAGG + Intergenic
944875263 2:203958153-203958175 CCCATTGATGTTTCAAAAGTTGG + Intronic
946157650 2:217817793-217817815 CCCATTGATGGTGGCATAGTTGG + Exonic
946646636 2:221844365-221844387 TCAAAAGAAGTTTGCACAGTTGG - Intergenic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1171936455 20:31278993-31279015 CAAATTGATGTTTCCACAGTGGG + Intergenic
1185283449 22:49987734-49987756 CCAAACTATGTTTGCAAAGTCGG - Intergenic
1202727019 2_KI270716v1_random:11194-11216 CCAACGGATATTTGCATAGTTGG + Intergenic
951061631 3:18214738-18214760 CCAATTGATTTTTGTACACTTGG - Intronic
953071919 3:39529387-39529409 CCACTTGATTTTTGCATATTTGG - Intronic
954758286 3:52854854-52854876 CCAAGTGGTATTTGCAGAGTTGG + Intronic
959783218 3:110261540-110261562 GCAATTGACATTTGGACAGTGGG + Intergenic
962222610 3:133576162-133576184 CAAAATGATGTTTTCACAGTAGG - Intronic
973994304 4:56441075-56441097 CCCATTGAAGTTAGCACATTTGG - Intronic
977454111 4:97235839-97235861 CCAGTTCATTTTTGCACAGCAGG + Intronic
978151232 4:105437957-105437979 CCTATTGATGTTTGCGAAATAGG - Exonic
979171598 4:117607345-117607367 GCAATTGGTGTTTGCAAATTTGG + Intergenic
983126910 4:163964519-163964541 CCAAGTGATGCTGGCACTGTAGG + Intronic
989147936 5:38266951-38266973 CCTATTGATGTTTCCTCAGCTGG + Intronic
989628730 5:43459338-43459360 CCTATTGCTTTTTGCAGAGTGGG - Intronic
990040430 5:51372569-51372591 CTAATTGGTGTTTGGTCAGTGGG - Intergenic
991009465 5:61867950-61867972 CCAACTGGTGTTTGGACACTGGG - Intergenic
992166300 5:74055438-74055460 TCAATTGTTGTTTCCACATTGGG - Intergenic
992308478 5:75468169-75468191 CAAAATGATGTTTCCACAGGGGG - Intronic
993428123 5:87795739-87795761 CCAGTTGACTTTTGCACATTAGG - Intergenic
993801996 5:92353327-92353349 CCTATTAATGTTTGCATATTGGG + Intergenic
997603987 5:135160233-135160255 CCAAATGAAGTTTGCCCAGCTGG - Intronic
1000771784 5:165364048-165364070 CCAGTTGGTGTTCACACAGTTGG - Intergenic
1002796125 6:472259-472281 CAAGATGATGTCTGCACAGTTGG + Intergenic
1002821355 6:727840-727862 AAAATTTATCTTTGCACAGTTGG - Intergenic
1004044114 6:12010507-12010529 ACAATTCAAGTTTGCACAGATGG + Intronic
1005354510 6:24969559-24969581 ACAATTCAAGTTTGCACATTGGG - Intronic
1005684614 6:28241200-28241222 CCAATTAATGGTTGAACATTGGG - Intergenic
1005742266 6:28803242-28803264 ATAATTGTTGTTTGCTCAGTCGG + Intergenic
1006711507 6:36076533-36076555 CCAGTTGATATTTGGTCAGTGGG + Exonic
1011880555 6:92018869-92018891 CAAAATGAAGTTTGCACATTAGG + Intergenic
1011991784 6:93529607-93529629 CCAAGTGATGTTTACATGGTAGG - Intergenic
1018674040 6:166203528-166203550 CCATCTGATGTTACCACAGTTGG + Intergenic
1019136621 6:169912473-169912495 CCCCTTGAGGTTTGCGCAGTGGG + Intergenic
1022326559 7:29337382-29337404 CCTCTTGCTGTTTGCACAGTGGG - Intronic
1022485586 7:30775110-30775132 CCAATTGGTGTCTGGAGAGTTGG - Intronic
1023467425 7:40472091-40472113 ACAATTGCTTTTTGCACAGCAGG - Intronic
1026145376 7:67741951-67741973 CCAATTGTAGTTTCCAAAGTTGG + Intergenic
1026294663 7:69040773-69040795 CCAAGTGATTTTTCCACATTTGG + Intergenic
1027469888 7:78560300-78560322 CCAACTGACATTTGGACAGTTGG + Intronic
1030824985 7:114144009-114144031 GCATTTGATCTTTGCACTGTGGG - Intronic
1040724275 8:50362945-50362967 CCAATAGATGATTGCCCTGTGGG + Intronic
1041571699 8:59344400-59344422 CCATTTGATGTTTGATCACTTGG + Intergenic
1041809149 8:61887877-61887899 CAAATTGATGTTTCTGCAGTGGG + Intergenic
1044602295 8:94017531-94017553 CCTACTGATATTTGCCCAGTGGG - Intergenic
1045727668 8:105194973-105194995 CCAAATGATGCTGGCACAGAAGG - Intronic
1050313330 9:4375131-4375153 CAAATTCATTTTTGCAAAGTGGG - Intergenic
1052338260 9:27340838-27340860 CCCATGGAGGTCTGCACAGTTGG + Intronic
1055094960 9:72403162-72403184 CCACGTGATTTTGGCACAGTGGG + Intergenic
1057223936 9:93276352-93276374 TCAATAGATGTTGGAACAGTCGG + Intronic
1058993488 9:110276905-110276927 CCTGTTTATGTTTGCACTGTAGG - Intergenic
1059542259 9:115142724-115142746 CAAATTGATCTTTTCACAGCTGG + Intronic
1060083037 9:120670605-120670627 CCATTTGCTGGTTGTACAGTGGG - Intronic
1060910186 9:127343290-127343312 CCAATTGAGGTTTGCTCTTTAGG - Intronic
1190036721 X:47032045-47032067 TCAACTGTTGTTTGCATAGTTGG - Intronic
1194746053 X:97629539-97629561 CTAATTGATGTTTGAAGAGGGGG + Intergenic