ID: 1096290262

View in Genome Browser
Species Human (GRCh38)
Location 12:50336282-50336304
Sequence CCTCTTCTGTAGAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 890
Summary {0: 1, 1: 1, 2: 15, 3: 142, 4: 731}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096290262 Original CRISPR CCTCTTCTGTAGAATGAGGA TGG (reversed) Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900722126 1:4183725-4183747 CCTTTCCTGAAGATTGAGGACGG + Intergenic
900841193 1:5049888-5049910 CCTTTCCTGAAGATTGAGGACGG - Intergenic
901214484 1:7548296-7548318 CCTCTTCTGTAGACTGTGGGAGG + Intronic
901241598 1:7697334-7697356 CCTCGTCAATAGAATGGGGATGG - Intronic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902700218 1:18167348-18167370 CCTCCTCTGTACAATAAGGCCGG - Intronic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902719441 1:18294473-18294495 CCTCTTCTGTAGTAAGAACAGGG - Intronic
902721267 1:18305839-18305861 TCCTTTCTGTAAAATGAGGACGG - Intronic
902833510 1:19032963-19032985 CCCCTCCTGGAGGATGAGGAGGG - Intergenic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903185137 1:21624618-21624640 CCTCTCCTGTCAAAGGAGGATGG + Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903230363 1:21918621-21918643 CCTCCTCTATAGAATGAGGGTGG - Intronic
903260783 1:22130666-22130688 CCTCATCTGTAGTAAGAGAAGGG + Intronic
903310611 1:22452196-22452218 GCTCTGCTGTAGACTGCGGAGGG + Intronic
903320225 1:22538721-22538743 CATCTTCTGTGAAATGGGGAGGG + Intergenic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903619601 1:24688349-24688371 CCTCTTCTGTTAAATGGGCATGG + Intergenic
903624240 1:24719912-24719934 CCTCATCTGTAAAATAACGATGG - Intergenic
903659669 1:24969458-24969480 CCTCCTCTGAAAAGTGAGGAGGG - Intergenic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903859226 1:26355003-26355025 CCTCTTACGTAGAATGGGAAGGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904203616 1:28838001-28838023 CCTCCTCTGTACACTGAGGATGG + Intronic
904416221 1:30362598-30362620 TTTCTTCTGTAAAATGGGGATGG - Intergenic
904424314 1:30413813-30413835 CCTCATCTGTGGGATGAGGGTGG - Intergenic
904529029 1:31155685-31155707 CCGCTTCTGTGAAATGACGATGG + Intergenic
904917223 1:33978912-33978934 CCTCTTCTGTAAAATAGAGATGG - Intronic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905922640 1:41729603-41729625 CTCCTTCTGTAAAATGAGTAGGG - Intronic
906118740 1:43373273-43373295 TCTCTTCTTGAGAAAGAGGATGG - Intergenic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906960335 1:50416089-50416111 CCTCCTCTGTAAAATGGGGCCGG + Intergenic
907318635 1:53588879-53588901 CTTCTTCTGTAAAATGGGCATGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907394646 1:54180687-54180709 CCTAATCTCTAGAATGAGGGTGG - Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907818427 1:57943038-57943060 CCTTTTCTGTATAATAAGGATGG - Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909248295 1:73318748-73318770 CCCATTTTGTAGACTGAGGAAGG + Intergenic
910002367 1:82355772-82355794 CCTTTCCTGAAGATTGAGGACGG + Intergenic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
911071590 1:93836020-93836042 CCTTTCCTGAAGATTGAGGATGG - Intronic
911494769 1:98617349-98617371 CCTCTTTGGGAGACTGAGGATGG - Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911642082 1:100300321-100300343 CCTCTTTTTTAGGAAGAGGATGG - Intergenic
911654452 1:100427497-100427519 CCTCTCCAGAAAAATGAGGAAGG - Intronic
912459517 1:109821639-109821661 CCTCTTCTCTACACTGAGGCTGG + Intergenic
912466584 1:109878876-109878898 TCTCTTCTGTAAAATGGGAAGGG - Intergenic
912556555 1:110520423-110520445 CCTCAGTTGTGGAATGAGGAAGG + Intergenic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
915172995 1:153991129-153991151 CCTCTTCTGGAGAGGGATGAAGG - Exonic
915364690 1:155308425-155308447 CCTCATCTGTTGAATGAGGGTGG - Intergenic
915629933 1:157145238-157145260 CCTATTCTGTAGAACATGGAAGG + Intergenic
915723015 1:157997696-157997718 GCTCTTGTGTGAAATGAGGAGGG + Intronic
916329207 1:163595599-163595621 CCTTTCCTGAAGATTGAGGATGG - Intergenic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
917317595 1:173741695-173741717 CCTCTTCTGGAGAGGGATGAAGG - Intronic
917526343 1:175791702-175791724 GAGCTTCTGTACAATGAGGAGGG + Intergenic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
917965765 1:180177617-180177639 CCTCTTCTGAAGTCTGAGGGTGG + Intronic
918220489 1:182432207-182432229 CCTCCACTATAAAATGAGGACGG - Intergenic
918655140 1:187016097-187016119 CCTCATCTCTAAAATGAGAATGG + Intergenic
918703039 1:187629567-187629589 CCTTTACTGAAGAATGGGGATGG + Intergenic
919961287 1:202472075-202472097 CCTCTTCTGGAGAGGGATGAAGG + Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920095584 1:203484348-203484370 CCTCATCTGTAAAGTGAGAATGG + Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
920908470 1:210192526-210192548 CCTTTCCTGAAGATTGAGGACGG - Intergenic
921260959 1:213384689-213384711 CCTTGTCTGTAGAATGGAGATGG - Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921327896 1:214005889-214005911 AATATTCTGTAGAATGAGGGAGG - Intronic
921520395 1:216149422-216149444 CCTTTCCTGAAGATTGAGGACGG - Intronic
922363137 1:224841121-224841143 CCTTTCCTGAAGACTGAGGATGG + Intergenic
922368921 1:224890460-224890482 CCTTTCCTGAAGATTGAGGACGG - Intergenic
922567024 1:226607634-226607656 CCTCTGCGGTAGCATCAGGAGGG - Exonic
923075557 1:230605879-230605901 CCTTTCCTGAAGATTGAGGATGG - Intergenic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
923401996 1:233624603-233624625 CCTTTTCTGAAAAATGAAGAAGG + Intronic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923854536 1:237831701-237831723 CCTGTTATGTTGAATGAGTATGG + Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
1063371796 10:5527019-5527041 CCTCGTTTGTAAGATGAGGAAGG - Intergenic
1063510247 10:6637646-6637668 CCCCTTCCCTAGAATGTGGATGG - Intergenic
1063749986 10:8933209-8933231 CCTCTTTTCTCGAATAAGGAAGG + Intergenic
1064281189 10:13953027-13953049 TCTCTTCTGTAGGATGAGGATGG + Intronic
1064893349 10:20205789-20205811 CCTCATCTGTAAGATGAGGTGGG - Intronic
1067185708 10:44025344-44025366 GCCCCTCTGTAGAATGAGGATGG + Intergenic
1067209993 10:44252108-44252130 CCAGATCTGAAGAATGAGGATGG + Intergenic
1067295357 10:44972450-44972472 CCTCTTCTGAAAAATCAGAAAGG - Intronic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1068714458 10:60172993-60173015 CCCATTCTGTAGAAGGAAGATGG + Exonic
1068870379 10:61937065-61937087 CCTCATCAGTAAAATGAGAAAGG + Intronic
1069740729 10:70685534-70685556 CCTCTACTGGAAAATGAAGAGGG - Intronic
1069918982 10:71804850-71804872 TCTCTTTTGTGGAATGAGGCAGG + Intronic
1069971564 10:72174816-72174838 CCTCCTCTGTAAAATAAGGGAGG + Intronic
1070678539 10:78432974-78432996 CCTCAGCTGTAGAATGAGTCAGG - Intergenic
1070958983 10:80485812-80485834 CCTCTTCTGTGGGTTGAGGATGG + Intronic
1071275133 10:84047253-84047275 CCTGTTCTGTAAAATGGAGATGG + Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071305072 10:84292499-84292521 CTTCATCTATAAAATGAGGATGG - Intergenic
1071661710 10:87510119-87510141 CCTTTTCTGTAAAATGAACATGG + Intronic
1071932499 10:90488253-90488275 CCTCTTATGTAAAGTGGGGAAGG - Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072706739 10:97686652-97686674 CTGCTTCTGTAGATTGTGGAAGG + Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1072922415 10:99587600-99587622 GCTCTTTTGGAGCATGAGGAGGG + Intergenic
1073069765 10:100785923-100785945 TCTCCTCTGTAAAATGAAGATGG + Intronic
1073130507 10:101185896-101185918 CCTTTCCTGAAGATTGAGGATGG + Intergenic
1073683910 10:105732229-105732251 CCTTTTCTGAAGATTGAGGATGG - Intergenic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074390878 10:113057279-113057301 GCTCTTCTGGAGACTGAGGCAGG - Intronic
1074526194 10:114265478-114265500 CCTCCTCTGTAAAATAAGGGAGG - Intronic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074662951 10:115682990-115683012 CATCTTCTGTAAAAGGGGGATGG + Intronic
1074760543 10:116664420-116664442 TCTCTTCTGCGAAATGAGGAGGG - Intronic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1076161755 10:128249333-128249355 CTTCATCTGTTGAATGAAGAAGG + Intergenic
1077735913 11:4790598-4790620 TCTCTTCTCCAGAATGAGGGTGG + Intronic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078779126 11:14420577-14420599 CCTCATCTGTAGAACAAGGATGG + Intergenic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1079327776 11:19509158-19509180 CCTCTTCTGTAAAATGGGGTTGG + Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1080659552 11:34284992-34285014 CCTCTTTTGCTGACTGAGGATGG - Intronic
1080682643 11:34490650-34490672 TCTCCTCTGTAGAATGGGGTGGG + Intronic
1080801169 11:35611643-35611665 ACTCATCTGTAGAATGGAGATGG - Intergenic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1081607527 11:44536798-44536820 CCTCTTCTGTGGAATGAAAGGGG + Intergenic
1081689769 11:45069954-45069976 CCTTTTCTGTAAAATGAGAGAGG - Intergenic
1081800381 11:45854833-45854855 CCTCATCTATAAAATAAGGATGG + Intronic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1082226682 11:49715940-49715962 CCTCCTCTATATAATGAGGATGG - Intergenic
1082821654 11:57548053-57548075 CCTCTTCTGCTGGCTGAGGATGG + Intronic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083700507 11:64474447-64474469 CCTTTTCTACAAAATGAGGATGG + Intergenic
1083739096 11:64698478-64698500 CCTCTTCTGCAAAATGAGAGGGG + Intronic
1083792876 11:64997134-64997156 CCCCTTCTCTGGAAAGAGGATGG + Intergenic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1083924993 11:65800694-65800716 CCTCATCTATAAAATGAGGTGGG + Intergenic
1084769239 11:71331930-71331952 CCCCTCCTGTAGAAGGAGAATGG + Intergenic
1084801267 11:71545733-71545755 CCTCTTCCGTAGAATGGCCAGGG - Intronic
1085067479 11:73510555-73510577 CTTCCTCTGTAAAATGAGCAGGG + Intronic
1085456284 11:76667212-76667234 TCCCTTCTGTAAAATGATGATGG - Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1086550642 11:88048415-88048437 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1086622743 11:88907141-88907163 CCTCATCTATATAATGAGGATGG + Intronic
1087197319 11:95314547-95314569 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1088915889 11:114227403-114227425 ACTCTTCTGTAACATGAGGGGGG - Intronic
1088938273 11:114426358-114426380 TCTCTTCTCGAGAATAAGGAAGG + Intronic
1089015038 11:115158633-115158655 CATCATCTGTAAAATGAGGCTGG - Intergenic
1089064037 11:115648842-115648864 CCTCGTCTGTGAACTGAGGAGGG - Intergenic
1089343396 11:117774854-117774876 CCTCTTCTGTAAAGTGGAGAGGG + Intronic
1089350454 11:117818998-117819020 CCCCTTCTGTAAATTGAAGACGG + Intronic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089953774 11:122552367-122552389 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1091341910 11:134822701-134822723 CCTCATCTATAAAGTGAGGATGG - Intergenic
1091780547 12:3211875-3211897 CCTCTTCTGGAGAGGGATGAAGG + Intronic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1093302984 12:17477465-17477487 CCTTTCCTGAAGAATGAGGACGG - Intergenic
1093662630 12:21774800-21774822 CCACTTCAGTGGAAGGAGGAGGG + Exonic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1094563342 12:31576634-31576656 GCACTTTTGTAGGATGAGGAGGG + Intronic
1095395131 12:41754190-41754212 CCCCTTCTGCCAAATGAGGATGG + Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096844158 12:54396227-54396249 CCTTTTCAGTAGAATGAGGGTGG + Exonic
1097335864 12:58382637-58382659 CCTTTTCTGGAGAATGCAGAAGG + Intergenic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1100183467 12:92110414-92110436 TCTCTTCTGAACAATGAGAATGG - Intronic
1100361910 12:93886963-93886985 TCTCTTCTGCAGAATCAGAATGG - Intronic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1100546605 12:95608994-95609016 GCTCTTCTGGAGGCTGAGGAGGG + Intergenic
1100585257 12:95973417-95973439 CCTTATCTGTGAAATGAGGAAGG + Exonic
1100882031 12:99029875-99029897 CCTCTGCTGTAAAATGGGAATGG + Intronic
1101013277 12:100473212-100473234 CCTCATCTGTAGAATGGATATGG - Intergenic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101876631 12:108600336-108600358 CCTCCTCTGTAAAATGGAGATGG + Intergenic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102187911 12:110964327-110964349 CCACATCTGTAGAATGGAGATGG - Intergenic
1102735961 12:115159723-115159745 TCTCCTCTGTACAATGAAGATGG + Intergenic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1103165107 12:118763666-118763688 CCTCTTCTGTAGAATATGGTAGG - Intergenic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103364514 12:120371408-120371430 TCTCTTCTGGAGAAGGATGAAGG - Intergenic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104156827 12:126141573-126141595 CACCTTCTGTGGAATTAGGAAGG + Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104586760 12:130053908-130053930 CCTCTTCTGTGGCAGGAGAAAGG - Intergenic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1106025671 13:25953318-25953340 TTTCTTCTGTAAAATGGGGACGG + Intronic
1106750200 13:32756349-32756371 CTTCCTCTGTAGAAGGAGAATGG + Intronic
1106784664 13:33094639-33094661 CATCTTCTGTACGATGGGGAGGG + Intergenic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107540604 13:41385683-41385705 CCTCGCCTGTAGCGTGAGGAGGG + Intergenic
1107577063 13:41736953-41736975 CCTCTTCTGGAGGCTGAGGCAGG - Intronic
1107811058 13:44200069-44200091 CCTCCTCTGTAGAATGTGAGTGG - Intergenic
1109287507 13:60427630-60427652 CCTTTTCTGTATAATAAGAAGGG + Intronic
1110167436 13:72460324-72460346 CTTGGTCTGTAGAATGGGGAGGG + Intergenic
1111971581 13:94922680-94922702 TCTCTTCTGTAAAATGAAAATGG + Intergenic
1113103438 13:106746401-106746423 CCTCTACTGGTGGATGAGGAGGG - Intergenic
1114234950 14:20815454-20815476 CCTTTCCTGAAGATTGAGGATGG + Intergenic
1114267215 14:21079942-21079964 CCTCATCTATAGAATGCGGATGG + Intronic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114634163 14:24178074-24178096 CCTCCTCTGTTGAGTGGGGAGGG - Exonic
1115415008 14:33122334-33122356 CCTCTTCTGGAGAAAGGTGATGG - Intronic
1116419009 14:44711749-44711771 TCTCATCTGTAGCATAAGGAAGG - Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1117653546 14:57931080-57931102 CTTCCTCTGTAAAATGAGGGAGG - Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1118936872 14:70296650-70296672 CCTTTCCTGAAGATTGAGGATGG + Intergenic
1119026347 14:71155895-71155917 TTTCTTCTGGACAATGAGGATGG + Intergenic
1119158147 14:72430457-72430479 TCTCTTCTGCAGACAGAGGAGGG + Intronic
1119174590 14:72559849-72559871 CCCATTCTGTAGAAAGGGGAAGG + Intronic
1119803446 14:77465737-77465759 CCTCTTCTGTACACTGCTGAAGG - Intronic
1119926332 14:78497831-78497853 CTTCCTCTGTAGGATGAGAATGG + Intronic
1119951887 14:78753670-78753692 CCTCTTCTGTAAAATGCTGGAGG - Intronic
1119996950 14:79263587-79263609 TCTCCTCTGTAAAATGAGGGAGG + Intronic
1120112030 14:80568540-80568562 CCTCTAGTGTAGAATGCTGAGGG - Intronic
1120618570 14:86735838-86735860 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1120983301 14:90310382-90310404 CCTCATTTGTAAAATGAAGAGGG + Intronic
1121192843 14:92045236-92045258 CCTTTCCTGAAGATTGAGGACGG + Exonic
1121248468 14:92482164-92482186 CCTCATCTGTTAAATGAGAAAGG - Intronic
1121389559 14:93562587-93562609 CCTTTCCTGAAGATTGAGGACGG + Intronic
1121601083 14:95203329-95203351 CCTCTTCCTCATAATGAGGACGG + Exonic
1122041329 14:98989678-98989700 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1122242094 14:100375881-100375903 CCTCATCTGTGGAATGGGCATGG + Intronic
1122252764 14:100451650-100451672 GCTCTTCTGTAAAACAAGGATGG - Intronic
1122380926 14:101306470-101306492 CCTTTCCTGAAGATTGAGGATGG + Intergenic
1122508084 14:102244869-102244891 CCTTTCCTGAAGATTGAGGATGG - Intronic
1122886320 14:104712014-104712036 CCTCATCTATACAATGAGGGAGG - Intronic
1123446594 15:20335228-20335250 GCTCTTCTGTAGGTTGAGGCAGG - Intergenic
1123882139 15:24686552-24686574 CCTCTCCTGAAGACTGAGGACGG + Intergenic
1123904828 15:24911083-24911105 CCTCTTCTGGAGAGGGATGAAGG + Intronic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1125212886 15:37237420-37237442 CCTTTCCTGAAGATTGAGGACGG + Intergenic
1125421051 15:39504420-39504442 CTTCCTCTGTAAAATGAGGCTGG - Intergenic
1125591320 15:40856259-40856281 CCTTCTCTGCAGAATGATGAGGG - Exonic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1125849488 15:42889498-42889520 CCTTTCCTGAAGATTGAGGACGG - Intronic
1127830909 15:62750390-62750412 CTTCTTCTGTAGACTGTGAAGGG + Exonic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1127997006 15:64158961-64158983 CCTGTTCTGTACAGTGAGGGTGG - Intronic
1128346007 15:66852779-66852801 CCCCTTCTGTGAAATGGGGACGG - Intergenic
1128725703 15:69987023-69987045 CCCCATCTGTGAAATGAGGAGGG - Intergenic
1128732669 15:70031655-70031677 CCTCTTCTGTAAAATGGAGCTGG + Intergenic
1128793005 15:70446893-70446915 CCTCATCTGTAAAACAAGGATGG + Intergenic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1130094158 15:80843899-80843921 CTTCTTCTGTAAAACAAGGAGGG - Intronic
1130149428 15:81299946-81299968 CCTCTTGGGAAGCATGAGGAAGG + Exonic
1130304954 15:82707201-82707223 CCTTTTCTGAAGATTGAGGATGG - Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131165142 15:90136713-90136735 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1131469672 15:92685002-92685024 CCTCCCCTGTAAAATAAGGATGG + Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132122145 15:99185170-99185192 CCTTTTGTTTAGAATTAGGAAGG - Intronic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132406319 15:101543561-101543583 CCTCAGCTGTAGAAGGACGAGGG - Intergenic
1132564180 16:613189-613211 CCTCACCTGTAGAATCAGCAGGG + Intronic
1133218205 16:4306348-4306370 GCTCTGCTGTAAAATGAGGCTGG - Intergenic
1133378577 16:5310515-5310537 CCTCATCTGTATATGGAGGAGGG + Intergenic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133921675 16:10159129-10159151 CCTCCTCTCTACAATGAGGGTGG + Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134341486 16:13350844-13350866 CCTCTTTTGAAGAATAAAGAGGG - Intergenic
1135051794 16:19199278-19199300 CCTCCTGTGTAGAATGAAGGAGG - Intronic
1135422915 16:22316774-22316796 CCCCTCCTGTAGCATGAGGGTGG + Intronic
1135659841 16:24286711-24286733 CCACTTTTGTAAAATAAGGATGG - Intronic
1135981037 16:27147577-27147599 CCACTTCTGGAGAATTAGGAAGG - Intergenic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136112043 16:28069737-28069759 CCTCGTCTGTGAAATGAGGGCGG + Intergenic
1136180138 16:28546132-28546154 CCTCTTCTGTTAAATGGGGTCGG - Intergenic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1137456416 16:48621347-48621369 CCTCTTCTGTAAATTAAAGAAGG - Intergenic
1137563354 16:49517016-49517038 GCTCCTCTGTACAAGGAGGAAGG - Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138131681 16:54485154-54485176 CCTCGTCTGTAGAATGGATATGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138382252 16:56610788-56610810 CCTCATCTGTAGAAAAAAGATGG + Intergenic
1138537537 16:57667901-57667923 CCTCCTCTGTAAAGTGAAGATGG - Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1138758671 16:59518180-59518202 CCTTTCCTGAAGACTGAGGATGG + Intergenic
1138855143 16:60681697-60681719 CCTCCTCTGTAAAATGAAGCAGG + Intergenic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1140231023 16:73117231-73117253 TCTATTCTGTTGAAAGAGGAAGG - Intergenic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1141199719 16:81888100-81888122 CCTTTTCTGTAAAATGACAATGG + Intronic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141901980 16:86996877-86996899 CCTCATCTTTAGAGTGGGGATGG + Intergenic
1141929202 16:87190039-87190061 TATCTTCTGTAGAATGAAGCTGG - Intronic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1142236096 16:88923278-88923300 CCTCCTCTGTGCGATGAGGAGGG - Intronic
1142401819 16:89862899-89862921 TCTCTTCTGTAAAATGGGGCTGG - Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1142895187 17:2971664-2971686 CCTCATCTGTGAAATGATGATGG + Intronic
1143385852 17:6530073-6530095 CCTCATCTGTAGAATGGCAAGGG - Intronic
1143735952 17:8912128-8912150 TCTCCTCAGTAGGATGAGGAAGG - Intronic
1143833804 17:9673908-9673930 CTTCTTCTGTACAATAAGGAGGG + Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144454959 17:15411370-15411392 CCTCCTCCTTAAAATGAGGAAGG + Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144764888 17:17727253-17727275 CCTCTTCTGTCAAAGGAGGGAGG - Intronic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144769357 17:17750985-17751007 CCTCCTCTGTGGAAGGCGGAAGG - Intronic
1144889811 17:18488160-18488182 TGTCATCTGTAGAATGAGCATGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145142403 17:20456157-20456179 CGTCATCTGTAGAATGAGCATGG - Intronic
1145249315 17:21288681-21288703 CCTCATCTGCAGACTGAGAATGG + Intronic
1145823345 17:27857542-27857564 CCTCATCAGTAGAATGGGGGTGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147033539 17:37662065-37662087 CATATTCTGTTGATTGAGGAAGG - Intergenic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1149585474 17:57783326-57783348 ACTCTGATGCAGAATGAGGAAGG + Intergenic
1150233319 17:63571626-63571648 CCTTTTCTGAAAAATGAGGATGG + Intronic
1151461216 17:74255255-74255277 CCCCATCTATAGAATGAGTATGG + Intronic
1151501506 17:74492786-74492808 GCTCTTCTGTAAAATAAAGAAGG - Intergenic
1151999409 17:77636194-77636216 CCTCTTCTGTAAAACGGGGGTGG - Intergenic
1152498629 17:80693478-80693500 CCTCTTCTGCAAATTAAGGAAGG + Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153265393 18:3263732-3263754 GCTAATGTGTAGAATGAGGAAGG - Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1153694242 18:7624369-7624391 CCTCTACTGAACTATGAGGATGG + Intronic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1154999832 18:21675240-21675262 CCTCATCTGTGGAATGAGGTGGG + Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1156923705 18:42553589-42553611 CCTTTCCTGAAGATTGAGGACGG + Intergenic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157971031 18:52269418-52269440 CCTTTTGTGTAGAGTGAGAAAGG + Intergenic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1160117968 18:76099810-76099832 CCTCATCTGTACAGTGAAGAGGG + Intergenic
1160159462 18:76460259-76460281 CCTCGTCTGTGAAATGAGGGTGG - Intronic
1160280148 18:77482201-77482223 CCTGTTCTAGAGGATGAGGAAGG + Intergenic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1161827168 19:6575786-6575808 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1162918963 19:13889289-13889311 CCTGGTCTGCAGAATGAGGCAGG + Exonic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1163210136 19:15834201-15834223 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1163899745 19:20090918-20090940 CCTTTCCTGAAGATTGAGGATGG + Intronic
1164153382 19:22573279-22573301 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1164687957 19:30182238-30182260 CCTATTCTGTACTATGAGAATGG - Intergenic
1165299345 19:34958697-34958719 CCTCTTATGATGAATGAGGTTGG + Exonic
1165299354 19:34958781-34958803 CCTCTTATGCTGAATGAGGTTGG + Exonic
1165362151 19:35343471-35343493 CCTCGTCTGTGTCATGAGGAAGG - Intronic
1165394542 19:35557263-35557285 CCTCATCTGTAAGATGAGAATGG - Intronic
1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG + Intronic
1166032805 19:40145774-40145796 CCACTTTTGGAGAAGGAGGAGGG - Intergenic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166727545 19:45037885-45037907 CCACTTCAGAAGCATGAGGAAGG - Exonic
1166891874 19:45999051-45999073 CATCCTCTGTATAATGGGGATGG + Intronic
1166905326 19:46104363-46104385 CCTTTCCTGAAGATTGAGGACGG + Intergenic
1167145181 19:47677080-47677102 CCTCGTCTGTGAAATGAGGAAGG + Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167520060 19:49949344-49949366 CCTCTTCTGAAGGAAGAGCATGG + Exonic
1167536864 19:50059235-50059257 CCTCTGGTGTTGAATGAGGTGGG + Intergenic
1167917719 19:52755653-52755675 CCTTTTCTGAAGATTGAGGACGG - Intergenic
1168182316 19:54670721-54670743 CCCTTTCTGTAGGAGGAGGATGG - Intronic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
1168492289 19:56821160-56821182 CCTCATCTGTAAAATGAATATGG - Intronic
924977051 2:187317-187339 CCTCATCTAAAGACTGAGGAAGG - Intergenic
925291705 2:2752307-2752329 TCTCTTCTATAGAATGCAGAGGG - Intergenic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925420756 2:3709374-3709396 CCGCTTCTGTAAGATGTGGAGGG - Intronic
925641853 2:5993038-5993060 CTTCTCCTGTAGAAAGGGGAAGG - Intergenic
926034601 2:9625795-9625817 TCTCTTCTGTAAATTGATGATGG - Intronic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926247589 2:11132533-11132555 CCTCATCTGTAGAATGGCGTTGG + Intergenic
926753251 2:16216370-16216392 CCTTTTCTGTAAAATGATAATGG - Intergenic
926809012 2:16740075-16740097 CTTCATCTATAAAATGAGGAAGG - Intergenic
926928406 2:18011770-18011792 CCTCTTCTGTGAAATGGGGATGG + Intronic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
927562474 2:24083867-24083889 CCTTATCTGTAGAATTAAGATGG + Intronic
927693047 2:25221916-25221938 CCTCTTCTCTAGACAGTGGAGGG - Intergenic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
929107928 2:38382152-38382174 CCGTTTCTGTAGAATGCTGATGG - Intergenic
929309295 2:40403427-40403449 CCTGTTGTGTAGAAAGAGGGTGG - Intronic
929420250 2:41783044-41783066 CCTTTTCTATAAAATGAGGAGGG - Intergenic
929538857 2:42804220-42804242 CCTCTGCTGAGGAATGGGGAGGG - Intergenic
929996587 2:46829856-46829878 CGTCTTCTGTAAAATGTGCATGG - Intronic
930667544 2:54114856-54114878 GCTCTTCTGTACAGTCAGGAAGG - Intronic
930884907 2:56314391-56314413 CCTCATCTGTGGAATGAGAAGGG + Intronic
931014630 2:57962204-57962226 CCTTATCTGTAGGATGAAGAGGG - Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
931859326 2:66337665-66337687 CCTTATCTGTAATATGAGGAGGG + Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932298372 2:70645356-70645378 CCTCATCTGTAGAATGGAGGAGG + Intronic
933138356 2:78762903-78762925 CCTTTCCTGAAGATTGAGGACGG - Intergenic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933299048 2:80522292-80522314 AGTCTTCTGTAGCAAGAGGATGG + Intronic
933806135 2:85999026-85999048 CCTCTTCTTTAACATGGGGAAGG + Intergenic
934141754 2:89053748-89053770 CCTTTCCTGAAGACTGAGGATGG - Intergenic
934227489 2:90146798-90146820 CCTTTCCTGAAGACTGAGGATGG + Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935555661 2:104507215-104507237 CCTCGTCTGTAAAATGGAGATGG - Intergenic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937425008 2:121791363-121791385 TCTCTTCTGTCGAATGTGGGCGG + Intergenic
937850111 2:126624370-126624392 CCTCATCTGGAAAATAAGGATGG - Intergenic
939620493 2:144413025-144413047 CCTCATCTGTAAAATGAGCCAGG + Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941203510 2:162543743-162543765 CCTCATCTATAAAATAAGGAAGG + Intronic
941455729 2:165710793-165710815 CCTTTCCTGAAGATTGAGGACGG + Intergenic
943061964 2:183048811-183048833 CCTTTCCTGAAGATTGAGGATGG - Intergenic
943272515 2:185825312-185825334 CCTCATCTATAAAATGAGTATGG - Intronic
943412525 2:187561153-187561175 CCTTTCCTGAAGATTGAGGATGG + Intronic
943450509 2:188037913-188037935 CCTTTCCTGAAGATTGAGGATGG - Intergenic
944251494 2:197583524-197583546 CCTTTCCTGAAGACTGAGGATGG - Intronic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944736496 2:202571661-202571683 CCTGTACTGTAAAATGAGCATGG + Intergenic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945064082 2:205933753-205933775 CCTCTTCCCTAGCATAAGGAGGG + Intergenic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945363152 2:208916771-208916793 CATCTTGTGTAGAATGAGGAAGG - Intergenic
945608271 2:211964228-211964250 CCTCTTCTGGAGAATGAATGGGG + Intronic
945840529 2:214882319-214882341 CCTCTGCTGTCAAATGAGGAAGG - Intergenic
945884066 2:215355927-215355949 ATTCTTCTGTAAAATGGGGATGG + Intergenic
946748634 2:222870863-222870885 CCCCTTTTGGACAATGAGGAGGG + Intronic
946830282 2:223721710-223721732 CCGTTTCTGTAGTATCAGGAAGG + Intergenic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948537838 2:238659199-238659221 CCTCTTCTGAACAATGAAGACGG + Intergenic
948685352 2:239666432-239666454 CCCCATTTGTAGAATGACGATGG + Intergenic
948731359 2:239965853-239965875 CCTCTACTGTACAATGCGAACGG + Intronic
948794928 2:240397628-240397650 CCTCGTCTGTAGAAAGGGGTTGG - Intergenic
1168826588 20:818447-818469 CCTCATCTGTAGAATGAGTGAGG + Intergenic
1169268079 20:4179746-4179768 CCTCTTCTGTAAAATGGGCATGG + Intronic
1171009718 20:21502483-21502505 CCTCTTCTGAGGAATGAGAGTGG + Intergenic
1172131563 20:32659495-32659517 GCTCATCTGTACAATGAAGATGG - Intergenic
1172311468 20:33921571-33921593 TCTCGTCTGTAAAATGAGGACGG - Intergenic
1172406023 20:34689897-34689919 CCCCTTCTGCAGAATCTGGATGG - Intergenic
1172907538 20:38380040-38380062 CCTCTCCTGTCAAATGAGGCTGG + Intergenic
1172933366 20:38601475-38601497 CCTCCTCTGTGAAATGGGGATGG - Intergenic
1173367002 20:42395322-42395344 CTTCTGCTGTAGAAAAAGGAGGG - Intronic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173756288 20:45519303-45519325 TCTCTTTTGTAGAAGGAAGAAGG + Intergenic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174817015 20:53695969-53695991 CCTCATCTGTGGGATGAGAATGG - Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175729837 20:61346764-61346786 CCTCTGCTGTGGCATGAGAATGG + Intronic
1176201792 20:63864265-63864287 CCTCATCTGTGGAGTGGGGAGGG + Intergenic
1176297300 21:5080909-5080931 CCTCATCTGGAGCATAAGGATGG - Intergenic
1176690149 21:9897176-9897198 TCTGTTCTGAAGAATGAGCATGG + Intergenic
1177918100 21:27116047-27116069 CCTCTTCTATAAAATGAGGAAGG + Intergenic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1179331053 21:40401871-40401893 CGACTTCTGGAGAAAGAGGAAGG - Intronic
1179396938 21:41049061-41049083 CCTCTTCTGCTGAATGAGATGGG + Intergenic
1179859729 21:44181039-44181061 CCTCATCTGGAGCATAAGGATGG + Intergenic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1182086381 22:27563917-27563939 CCCCATCTGTAAAATGAAGAGGG + Intergenic
1182131039 22:27850864-27850886 TCTCATCTATACAATGAGGATGG + Intergenic
1182247554 22:28971615-28971637 CCTCATCTGTAAAATAAGAATGG - Intronic
1182461286 22:30485735-30485757 CCTCATCTGTAGGCTGCGGATGG + Intergenic
1182686523 22:32124356-32124378 CCACTTCTGCAGAATCTGGAGGG + Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182897089 22:33867959-33867981 CCTCTCCTCTTGAATGAGGAGGG - Intronic
1183273298 22:36875519-36875541 CTTCTTCTGTAGAGGGAGGAGGG - Intronic
1183345688 22:37306414-37306436 CCTCTGCTGTAAACTGGGGACGG - Intronic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
1183389710 22:37538579-37538601 CCTCTTCTGTAAAGGGGGGAAGG - Intergenic
1183424664 22:37733115-37733137 CCCCTTCTGAAAAATGGGGATGG - Intronic
1183630291 22:39028431-39028453 CCTCCTCTGTAAAATAGGGATGG + Intronic
1183641955 22:39098122-39098144 CCTCCTCTGTAAGATGAGAATGG + Intronic
1183740492 22:39666138-39666160 CCTCTTCTGCAAAATGGGTAAGG + Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184180364 22:42819212-42819234 CCTGTTCTGTAGGAAGAGTAAGG - Intronic
1184272636 22:43393389-43393411 CCTCTTCAGCAGAAAGAGGCCGG - Intergenic
1184469040 22:44685114-44685136 CCTCTTCTGAAAAATGTGGGTGG + Intronic
1184581754 22:45422677-45422699 CTTCTTCTGTAACATGAGGATGG + Intronic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949671496 3:6402161-6402183 CCTTTCCTGAAGATTGAGGATGG - Intergenic
949807279 3:7969623-7969645 CCTCCTCTGTAAAATGAAGGTGG - Intergenic
949943104 3:9169930-9169952 CCTCTCCTGTAAAATGAAGGGGG + Intronic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
950230528 3:11272082-11272104 CCTCTCCTGGAGAATGACCATGG + Intergenic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950481940 3:13249690-13249712 CCTCTTCTGAAAAACGAGGTGGG + Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950569194 3:13789529-13789551 CCCCATCTGTAGAACAAGGAGGG + Intergenic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951463610 3:22977700-22977722 CTTTATCTGTACAATGAGGACGG + Intergenic
951793122 3:26508484-26508506 CCTCCTGTGTAAAATGAGGTCGG - Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952297342 3:32072992-32073014 CCTTTCCTGAAGATTGAGGACGG - Intronic
953199068 3:40761565-40761587 CCTCTTCTGGAGAGGGATGAAGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953599080 3:44346183-44346205 CCTTTTCCGAAGATTGAGGACGG + Intronic
953656082 3:44855981-44856003 CCTTTCCTGAAGATTGAGGATGG + Intronic
954161279 3:48724471-48724493 CCTTTCCTGAAGATTGAGGACGG + Intronic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955191865 3:56769292-56769314 CCTCTGGTGTGGAGTGAGGAAGG - Intronic
955401186 3:58592663-58592685 CCTTTCCTGAAGATTGAGGATGG - Intronic
955669056 3:61383175-61383197 CCTCTTCTTAATAAAGAGGAAGG + Intergenic
955842573 3:63128012-63128034 CCTCATCTGTGAAATGAGCATGG - Intergenic
955867801 3:63403545-63403567 TCTCATCTGTTAAATGAGGATGG - Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
957451860 3:80389902-80389924 CCTTTCCTGAAGATTGAGGATGG - Intergenic
957559447 3:81803264-81803286 CCACTTTTGGAGAATGAGGTAGG + Intergenic
957734484 3:84188629-84188651 CCTTTCCTGAAGATTGAGGATGG + Intergenic
957904393 3:86538677-86538699 CTTTTTCTGAAGATTGAGGATGG + Intergenic
960576309 3:119233246-119233268 CCCACTCTGTAGAATGAGGGAGG - Intronic
960952619 3:123009373-123009395 CTTCTTCTGTGGGATGAGGGAGG + Intronic
960997238 3:123348281-123348303 GCTCGTCTGTAAAATGAGGATGG + Intronic
961485144 3:127210910-127210932 CCCCCTCTGTGGAATGGGGAGGG - Intergenic
961539385 3:127589895-127589917 CCTCTTCTCTGCAGTGAGGAGGG - Intronic
962013579 3:131418240-131418262 CTGTATCTGTAGAATGAGGAAGG - Intergenic
962233790 3:133691181-133691203 CCTCTTCTCCACAATGAGGTTGG - Intergenic
962237246 3:133717161-133717183 TTTCTTCTGTAGAATGAACAAGG + Intergenic
962505151 3:136039218-136039240 TTTCCTCTGTAGAATGATGAGGG + Intronic
962848569 3:139290766-139290788 CCTCTTCTCTTGAATGAGCCAGG + Intronic
962869666 3:139477014-139477036 TCTCATCTGTAAAATAAGGATGG - Intronic
963348368 3:144123571-144123593 CCTCGTCTATAAAATCAGGAGGG - Intergenic
964299830 3:155275639-155275661 CCTTTCCTGAAGATTGAGGACGG + Intergenic
964451332 3:156816351-156816373 CGTCTTTTGAAGAATGAGAACGG - Intergenic
965507714 3:169534755-169534777 CCTCCTCTGTAAAATAGGGATGG - Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
966669256 3:182508717-182508739 CCTCTTCTTAAGAAAGAGGCCGG - Intergenic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
967278109 3:187796081-187796103 CCTCATCTGTTGAATGATGAGGG - Intergenic
967991550 3:195135310-195135332 CCTCCTGTGTAAAATGAGAAAGG - Intronic
968072038 3:195790093-195790115 CCTTTGCTGGAGAATGAGGAAGG + Exonic
968277793 3:197454197-197454219 CATCTGCTGTAGAAGGAGGGAGG + Intergenic
968412575 4:402765-402787 CCTTTCCTGAAGATTGAGGACGG + Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969350160 4:6593656-6593678 CCTCCGCTGTAAAATGGGGATGG + Intronic
969524327 4:7696494-7696516 CCTCATCTGTAACATGAGGTTGG + Intronic
970200345 4:13598531-13598553 CCTCGTTTGTAAAATGAGGGTGG + Intronic
970206317 4:13659039-13659061 CATCAGCTGTAAAATGAGGAGGG - Intergenic
970322494 4:14888579-14888601 CCTCCTCTAGAGAATGAGGATGG - Intergenic
970376018 4:15457861-15457883 CCTCTTCTGGAATATGAGGTGGG - Intergenic
970511292 4:16784347-16784369 CCTCATCTGTAGACTGGGGCTGG + Intronic
970560355 4:17276170-17276192 CCTCGTCTGTAAAATGGGAAGGG + Intergenic
970991307 4:22216338-22216360 CCTCAGCTATAAAATGAGGATGG + Intergenic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
971567162 4:28159985-28160007 CCTCTTCCTTAAATTGAGGATGG + Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972724144 4:41731522-41731544 TCTCATCTGTGAAATGAGGATGG + Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973552960 4:52053325-52053347 CCTCTACTGTAGAGAGATGAAGG - Intronic
973960213 4:56102393-56102415 CCTCATTTGTAAAATGAAGAAGG - Intergenic
975438664 4:74384185-74384207 CTTCATCTGTAAGATGAGGATGG + Intronic
976071565 4:81246216-81246238 CCTCATCTGTAAAATGAGTGTGG + Intergenic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976719162 4:88153521-88153543 CCTTTCCTGAAGATTGAGGATGG + Intronic
976781901 4:88769461-88769483 CCTCATCTGGAAAATGAAGATGG + Intronic
976793579 4:88907867-88907889 CCTCATCTGTAAAATCAGGGAGG - Intronic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
977704402 4:100054998-100055020 CTTCTCCTGTAGAATCAGCAGGG + Intergenic
978142634 4:105335029-105335051 TCTCATCTGTACAATGATGAAGG + Intergenic
978302888 4:107291525-107291547 CCTTTCCTGAAGATTGAGGACGG + Intergenic
979353218 4:119670423-119670445 CCTTGTCTGTAAAATGAGAATGG + Intergenic
979624674 4:122831101-122831123 CCTCTTCTGTAAAAAGAGATGGG - Intronic
980714870 4:136615681-136615703 CCTTTCCTGAAGATTGAGGATGG - Intergenic
982138369 4:152294365-152294387 TGACGTCTGTAGAATGAGGAGGG + Intergenic
983056211 4:163101543-163101565 CCTTTCCTGAAGATTGAGGATGG + Intergenic
983711887 4:170728245-170728267 CCTTTCCTGTATAATGAGGAAGG - Intergenic
984247039 4:177287133-177287155 AGTCACCTGTAGAATGAGGAAGG - Intergenic
984322588 4:178212116-178212138 CCTTTCCTGAAGATTGAGGATGG - Intergenic
984412166 4:179408400-179408422 CCTTTCCTGAAGATTGAGGATGG - Intergenic
984512510 4:180695681-180695703 CTTCTTCTGTAGTAAGAGGAGGG - Intergenic
984649755 4:182257736-182257758 TCTCTTCAGTAAAATGAGGGTGG - Intronic
984958005 4:185065037-185065059 CATCTTCTATTGAATGAGTAAGG - Intergenic
985078585 4:186242828-186242850 CCTTTCCTGAAGATTGAGGATGG + Intronic
985952820 5:3236465-3236487 CCTCCTCTGTTCAAAGAGGAGGG + Intergenic
986367587 5:7048864-7048886 TCTGTTCTGGACAATGAGGAAGG + Intergenic
986535830 5:8785911-8785933 CCTCTTCTGTAGAATCACCTGGG + Intergenic
987370318 5:17187072-17187094 ACTCTTCTATAAAATGTGGACGG + Intronic
987738757 5:21877787-21877809 ACTCTTCTGTAGACTTAGCATGG - Intronic
987756158 5:22099324-22099346 CCTTTCCTGAAGATTGAGGATGG - Intronic
987769660 5:22284398-22284420 TCTCATCTGAAGACTGAGGATGG + Intronic
988001688 5:25358127-25358149 CCTCTTCTGAAGCAGAAGGAAGG - Intergenic
988665401 5:33321860-33321882 CCACTTCTGCATGATGAGGAAGG + Intergenic
989110451 5:37902109-37902131 CCTCCTCTCTAAAATGAGGAAGG + Intergenic
989157904 5:38361804-38361826 CCTCTGCTGTAAAATACGGATGG + Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
991005318 5:61822873-61822895 CCCCTACAGTAGAATGTGGAGGG + Intergenic
991086738 5:62654576-62654598 CCTCCTCTGTAAAATGGAGATGG + Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
995435571 5:112131286-112131308 CCTCCTTTGTAAAATGAGTATGG + Intergenic
995441146 5:112193599-112193621 TCTCTTCTGAAAAATGAGGAAGG - Intronic
996546596 5:124685680-124685702 CCTCCTCTGGAGAATCAGGCTGG - Intronic
996616963 5:125453558-125453580 CCTCTGCTGTTCAATGAAGACGG + Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997025765 5:130059104-130059126 TATCTTCTGTAAAATGTGGATGG + Intronic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
997708327 5:135979985-135980007 CCTTTTGTGTAGTATGAGGGGGG - Intergenic
998157207 5:139793865-139793887 CCTCATCTGCCCAATGAGGATGG - Intergenic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999571305 5:152923037-152923059 CCTCATCTGTAATATGAGGGTGG - Intergenic
999769815 5:154766879-154766901 CCTCTTCTCTGAAAGGAGGAAGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
999926139 5:156380392-156380414 CCCCTTCTGTTGTAGGAGGAAGG - Intronic
1001003715 5:168031259-168031281 CCTCTTTTGTAAAATGAGTCTGG + Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001109336 5:168882948-168882970 CATCTTCTGTAAAATGGGGATGG - Intronic
1001274085 5:170337597-170337619 CCTCTTCTGTAAAATGGAAAAGG + Intergenic
1001353832 5:171001688-171001710 CCTTTCCTGAAGATTGAGGATGG + Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001699117 5:173694054-173694076 CCTCCTCTCTAAAATGGGGATGG - Intergenic
1001879992 5:175235017-175235039 CCTCGTCAGCAGAATGAGGTTGG - Intergenic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002105909 5:176879392-176879414 TATCTTCTGCCGAATGAGGAAGG - Exonic
1002638751 5:180620608-180620630 CATCTTCTGTAACATGAGGAGGG - Exonic
1002827911 6:790479-790501 CCTCATCTGTAAAATGAAGGTGG - Intergenic
1003100468 6:3172638-3172660 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1003333824 6:5152154-5152176 CCTCATCTATAGAATGAAGTTGG - Intronic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004121905 6:12831917-12831939 CCTCCTCCATAAAATGAGGAGGG - Intronic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1006325237 6:33348688-33348710 CTTTTTCTGAAGATTGAGGATGG - Intergenic
1006453064 6:34116277-34116299 CCTCTCCTGTAAAATGGGGCCGG + Intronic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1007084299 6:39132437-39132459 CCTTTCCTGAAGATTGAGGATGG + Intergenic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007296228 6:40823469-40823491 CCCATTCTGTAGGTTGAGGAGGG - Intergenic
1007630930 6:43273272-43273294 TCTTTTCTATAGACTGAGGAGGG - Intronic
1007707410 6:43799298-43799320 CATCTTCAGGAGAATGGGGATGG - Intergenic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1009270203 6:61604995-61605017 CCTTTTCTGAAGATTGAGGATGG - Intergenic
1009343660 6:62588543-62588565 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1009379522 6:63010208-63010230 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1009749855 6:67869341-67869363 CCTTTCCTGAAGACTGAGGATGG + Intergenic
1009914651 6:69978110-69978132 CCTCTTCTCAGGAATCAGGAGGG - Intronic
1010241321 6:73618363-73618385 CCTCTTCTGGAGAGGGATGAAGG - Intronic
1010793322 6:80090142-80090164 CCTCTGCTGTGCAGTGAGGAGGG + Intergenic
1011035331 6:82967887-82967909 CCTATTCTGGAGACTGAGGTGGG - Intronic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1013807644 6:114012788-114012810 CCTTTCCTGAAGATTGAGGACGG + Intergenic
1014182962 6:118405694-118405716 TCTCTTCTGTCTGATGAGGATGG - Intergenic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1016124907 6:140387937-140387959 CCCCTTCTCTTGAAAGAGGACGG + Intergenic
1016204889 6:141457509-141457531 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1017732675 6:157331473-157331495 CTTCCTCTGTAAAGTGAGGAAGG + Intergenic
1017916955 6:158838424-158838446 ATTCTTCTGTGGAAAGAGGATGG + Intergenic
1019102856 6:169646221-169646243 CCTCTTCTGTTAAGGGAGGATGG - Intronic
1019501413 7:1366701-1366723 CTTCCTCTGTAGAATGGGGTGGG - Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019900104 7:4013835-4013857 CCCCTTCTTTGAAATGAGGAAGG - Intronic
1019972428 7:4551795-4551817 CCTCTTCTGCAAATTGAAGATGG + Intergenic
1020816652 7:12913905-12913927 CCTCCTGTGTAGAACAAGGAAGG - Intergenic
1021393241 7:20120182-20120204 TCTCTTTTGTAGAATAAGCATGG + Intergenic
1021797174 7:24267747-24267769 CCTCTGCTGTAGAGTGTGGAAGG + Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022266182 7:28757193-28757215 CCTCCTCTGTAAAATAAGAATGG - Intronic
1023144738 7:37139107-37139129 CCTATTCAGTAGAATGTTGATGG - Intronic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023821714 7:43984312-43984334 CCCTATCTGTAAAATGAGGATGG - Intergenic
1024198983 7:47087786-47087808 CAACTTCTGTAGAAGGAGGTAGG + Intergenic
1024499518 7:50089497-50089519 CCACTTCTGTAGAAAGAAAAGGG + Intronic
1024803666 7:53110686-53110708 CCTATTCTATAAAATGAGGAAGG + Intergenic
1025790622 7:64684070-64684092 CCTTTCCTGAGGAATGAGGATGG - Intronic
1026052918 7:66961851-66961873 CCTCATCTGTAAAACAAGGATGG + Intergenic
1026840336 7:73667453-73667475 TCTCTTCTGTAAAATGGGGTTGG - Intergenic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1027158786 7:75787302-75787324 CCTTTCCTGAAGATTGAGGATGG - Intronic
1027354764 7:77344269-77344291 CCTTTCCTGAAGATTGAGGATGG - Intronic
1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG + Intergenic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1028660017 7:93260805-93260827 GCTATTCTGGAGAATGAGGCAGG - Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029527266 7:101102622-101102644 CCTCATCTTTAAAACGAGGATGG - Intergenic
1029749976 7:102537731-102537753 CCCTATCTGTAAAATGAGGATGG - Intergenic
1029767926 7:102636837-102636859 CCCTATCTGTAAAATGAGGATGG - Intronic
1030046802 7:105504548-105504570 CCTCATTTGTAAAATGAAGATGG - Intronic
1030081565 7:105783082-105783104 CCTCGTCTATAAAATAAGGATGG - Intronic
1030193952 7:106835082-106835104 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1030445462 7:109643304-109643326 CCTTTCCTGAAGACTGAGGATGG + Intergenic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1031704222 7:124961572-124961594 CCTTTCCTGAAGATTGAGGACGG + Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032488575 7:132306837-132306859 CCCTTTCTGCAGAATGAGAAAGG - Intronic
1032675374 7:134125375-134125397 TCTCATCTGTCTAATGAGGATGG + Intergenic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1032717558 7:134523190-134523212 CCTTTTCAGTAGAAAGAGGTAGG - Intergenic
1033025142 7:137764909-137764931 CCTCTTGGGTAAAATGTGGAAGG - Intronic
1033435428 7:141329320-141329342 CCTCTTGTCTTGTATGAGGAGGG - Intronic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033464601 7:141579286-141579308 CCTTTTCTGAAGATTGAGGAAGG + Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035905851 8:3509497-3509519 CCTCATCTTTAAAATGAAGAAGG + Intronic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037030804 8:14102378-14102400 CCCCTTCTGTAGATTGCAGATGG + Exonic
1037272612 8:17146209-17146231 TCTCATCTGTAGCATGAGAAAGG + Intergenic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1038352214 8:26787032-26787054 CCTCATCTGTAAGATGAGGTTGG - Intronic
1038500547 8:28040035-28040057 CCTCTTCTGGAGAAGGTAGATGG - Intronic
1039180693 8:34862625-34862647 GCTCTTCTGGAGAATGGGGTAGG + Intergenic
1039783670 8:40813324-40813346 CTTCTTCTGTAACATGAGGTTGG - Intronic
1041062208 8:54045127-54045149 CCTCTTCTGTAAAATCAAGATGG + Intergenic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1042105820 8:65325508-65325530 CCTCTTCAGTACCCTGAGGAAGG + Intergenic
1042892153 8:73624552-73624574 CCTCATCTGTAAAATGAAGTGGG - Intronic
1042944902 8:74144983-74145005 TCTCTTCTGGAGAATGAGAAGGG + Intergenic
1043077160 8:75716367-75716389 CCTCTTCCTTAGCTTGAGGAAGG - Intergenic
1043721248 8:83548587-83548609 CCTTTCCTGGAGATTGAGGATGG - Intergenic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1044999981 8:97870175-97870197 CCTCATCTGTCTAATGAGGATGG + Intronic
1045411480 8:101925087-101925109 TCTCTTCTCTGGAATGAGGTTGG - Intronic
1045645117 8:104290415-104290437 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1046793141 8:118343079-118343101 CCTCATCTGTAAGATGAGAAGGG + Intronic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047411596 8:124628794-124628816 CCCCATCTTTAAAATGAGGATGG - Intronic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047742081 8:127814587-127814609 CAACATCTGTAAAATGAGGATGG - Intergenic
1047770516 8:128026867-128026889 TCTCTTCTATGGAATGAGGCCGG - Intergenic
1048291290 8:133183576-133183598 CCTCTTTTATAAAAAGAGGATGG - Intergenic
1048338843 8:133523466-133523488 CCTCCTCTGTAAAGTGAAGATGG + Intronic
1049168573 8:141142787-141142809 CCTCTTCTGTAAAATGTAGATGG + Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1049967257 9:790904-790926 CCTCTTTTTTAAAATGAGGATGG - Intergenic
1050140929 9:2514890-2514912 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1050298020 9:4226740-4226762 CCTCTACTGAAAAATGAGTAAGG + Intronic
1050351218 9:4741967-4741989 CCTCTCCTGTAAAATGAGGTAGG - Intronic
1050896431 9:10889497-10889519 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1051296493 9:15601423-15601445 CCTCTTCTGTAGAATCTGGAAGG + Intronic
1051694420 9:19752785-19752807 CCTCATCTGTAGTATGGGCATGG - Intronic
1051922392 9:22283205-22283227 CCTCTTCTGTAAAATGAAGTTGG - Intergenic
1052653749 9:31331430-31331452 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1053206765 9:36192675-36192697 TCTCTTCTATTAAATGAGGAAGG - Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1055446695 9:76391070-76391092 ACCATTCTGTTGAATGAGGAAGG - Intronic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1055631559 9:78229714-78229736 CCTCTTGTGTTTAATGAGTATGG + Intergenic
1055995340 9:82151674-82151696 TCTTTATTGTAGAATGAGGAGGG + Intergenic
1056363283 9:85880121-85880143 CCTTTTCTGAAGATTGAGGACGG + Intergenic
1056386965 9:86104935-86104957 CATCTACTCTAGAATGAGGATGG - Intergenic
1056820555 9:89838796-89838818 CCTCGTCTGTAGATTGGGGATGG + Intergenic
1057298657 9:93863859-93863881 CCCTTTCTATAGAATGGGGAGGG - Intergenic
1057695569 9:97320600-97320622 CCTCCTCTGTAAAATAGGGATGG + Intronic
1057847908 9:98539545-98539567 CCCCTTCTACAAAATGAGGAGGG + Intronic
1058059434 9:100479142-100479164 CCTGTTGTGTAAAATGTGGATGG + Intronic
1058083463 9:100723355-100723377 TCTCTTTTGAAGAATGAGCATGG - Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058542196 9:106023100-106023122 ATTCTTCTGTAAAATGAGGTAGG - Intergenic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1059993291 9:119885419-119885441 TCTCATTTGTAGAATGAGGGGGG - Intergenic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060226545 9:121794809-121794831 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1060238445 9:121883251-121883273 TCTCTTCTGTAAAATGGAGATGG + Intronic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1060962910 9:127693790-127693812 CCTCATCTGTAGAATGGGAGAGG - Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061205997 9:129163784-129163806 CCTCTGCTGTAGGTTGAGGTGGG - Intergenic
1061390215 9:130313485-130313507 CCTCGTCTGTGAAACGAGGAGGG + Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062235241 9:135504879-135504901 CCTGTTCTGCTGAATGAGGCTGG - Intergenic
1062692432 9:137849520-137849542 CCTTTCCTGAAGATTGAGGACGG - Intronic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1185922878 X:4113853-4113875 CCTATTCTGTTGAATAAAGAGGG + Intergenic
1186397736 X:9226557-9226579 CCTCTTCAGTACAATGAGAATGG - Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1187031630 X:15493713-15493735 CCTCCTCTATAAAATGAGGATGG + Intronic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1188200485 X:27289439-27289461 CCTTTCCTGAAGATTGAGGACGG + Intergenic
1188300705 X:28503595-28503617 CCTTTCCTGAAGATTGAGGACGG + Intergenic
1188928328 X:36073630-36073652 CCTCATCTGTGATATGAGGAAGG + Intronic
1189092938 X:38106485-38106507 CCTGTTCTTTATAATGAGCATGG - Intronic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189546019 X:42043358-42043380 CCTATTCTGAAAAATGAGGATGG - Intergenic
1189571528 X:42302913-42302935 CCTCTTTTGTTTAAAGAGGATGG - Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190227606 X:48558285-48558307 CATCGTCTGTAAAATGAGAATGG + Intronic
1190335584 X:49259738-49259760 CCCCTTCTGTATAATGGGGTTGG - Intronic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG + Intronic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1191761749 X:64654377-64654399 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1191826010 X:65365137-65365159 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192455225 X:71270347-71270369 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1192731098 X:73803428-73803450 CCTCTCCTGAAGATTGAGAATGG + Intergenic
1193223021 X:78949411-78949433 CCTCTTTTGTAAAATTAGAATGG - Intronic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193845283 X:86462662-86462684 CCTGCTCTGAAGAATGAGCAGGG - Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1195016658 X:100787945-100787967 CCTTTCCTGAAGATTGAGGATGG + Intergenic
1195290758 X:103430244-103430266 CCTTTCCTGAAGATTGAGGATGG + Intergenic
1195326443 X:103762342-103762364 CCTTTTCTGAAGATTGAGGATGG + Intergenic
1195467030 X:105190881-105190903 CCTCTTCAGTACAACCAGGAAGG - Intronic
1195522261 X:105844821-105844843 CCTGTTTTGTAGAGTGAGGAAGG - Intronic
1196264040 X:113620334-113620356 CCTTTTCTGAAGAATTAGGTAGG - Intergenic
1196497228 X:116335607-116335629 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1196936915 X:120739485-120739507 CCACATCTGTAGTATGATGAAGG + Intergenic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197500156 X:127231822-127231844 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1198059157 X:133026527-133026549 CCTCTTCCCTTGAGTGAGGATGG - Exonic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198502042 X:137259951-137259973 CCTCTTGAGTGGAAAGAGGAAGG - Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1201233847 Y:11891596-11891618 CCTTTCCTGAAGACTGAGGATGG + Intergenic