ID: 1096293028

View in Genome Browser
Species Human (GRCh38)
Location 12:50358537-50358559
Sequence TGTACCAATGCACCCCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90809
Summary {0: 1, 1: 2, 2: 292, 3: 7898, 4: 82616}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096293026_1096293028 8 Left 1096293026 12:50358506-50358528 CCAGGAATTCCAGGCGGCAGTGT 0: 1
1: 1
2: 78
3: 1296
4: 9726
Right 1096293028 12:50358537-50358559 TGTACCAATGCACCCCAGCTTGG 0: 1
1: 2
2: 292
3: 7898
4: 82616
1096293025_1096293028 9 Left 1096293025 12:50358505-50358527 CCCAGGAATTCCAGGCGGCAGTG 0: 1
1: 50
2: 1004
3: 8129
4: 24929
Right 1096293028 12:50358537-50358559 TGTACCAATGCACCCCAGCTTGG 0: 1
1: 2
2: 292
3: 7898
4: 82616
1096293021_1096293028 17 Left 1096293021 12:50358497-50358519 CCCTTGAGCCCAGGAATTCCAGG 0: 8
1: 102
2: 932
3: 3191
4: 5738
Right 1096293028 12:50358537-50358559 TGTACCAATGCACCCCAGCTTGG 0: 1
1: 2
2: 292
3: 7898
4: 82616
1096293027_1096293028 -1 Left 1096293027 12:50358515-50358537 CCAGGCGGCAGTGTACTATTATT 0: 1
1: 0
2: 2
3: 26
4: 302
Right 1096293028 12:50358537-50358559 TGTACCAATGCACCCCAGCTTGG 0: 1
1: 2
2: 292
3: 7898
4: 82616
1096293023_1096293028 16 Left 1096293023 12:50358498-50358520 CCTTGAGCCCAGGAATTCCAGGC 0: 6
1: 98
2: 850
3: 3312
4: 6299
Right 1096293028 12:50358537-50358559 TGTACCAATGCACCCCAGCTTGG 0: 1
1: 2
2: 292
3: 7898
4: 82616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096293028 Original CRISPR TGTACCAATGCACCCCAGCT TGG Intronic
Too many off-targets to display for this crispr