ID: 1096299208

View in Genome Browser
Species Human (GRCh38)
Location 12:50411109-50411131
Sequence TTTCTACTGTAACAAACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096299208 Original CRISPR TTTCTACTGTAACAAACCCC TGG (reversed) Intronic
901136294 1:6998679-6998701 TTTGTCCTGTAACATATCCCTGG + Intronic
901899391 1:12345677-12345699 TTTCTACTGAAACTAACCATTGG - Intronic
906233631 1:44188398-44188420 ACTCTACTGTAACAAAGCCTTGG - Intergenic
908690738 1:66776768-66776790 TTTCTATTTTTACAAACCCCAGG + Intronic
909721105 1:78770914-78770936 TTTCTCCTGTAACCAGCCTCCGG - Intergenic
909796195 1:79739413-79739435 TTTCAAGTGTAAAAAACCACTGG - Intergenic
916442516 1:164841547-164841569 TTTCCACTGTAAAATTCCCCAGG + Intronic
916612999 1:166411235-166411257 TATCTACTTTAAGAAACCACAGG - Intergenic
916854682 1:168737465-168737487 TTTCTACTGTAACCAACGACAGG - Intergenic
918247512 1:182672648-182672670 TTTCTACTGTAGGAAAAACCAGG - Intronic
918884984 1:190181060-190181082 TTCCAACTGTACCTAACCCCTGG + Intronic
921921434 1:220674525-220674547 TTACTTCTGTACCACACCCCAGG - Intergenic
922021746 1:221712186-221712208 TTCCTACTGTAAAATACCCAAGG + Intronic
924065658 1:240219206-240219228 TTTCTAGTATGACAAACCCGAGG - Intronic
924796273 1:247294707-247294729 TTTCTCCTGCCACAAACCTCAGG - Intergenic
1063133759 10:3199277-3199299 TTTCTACTAAAACTAAACCCAGG - Intergenic
1064161494 10:12950400-12950422 TTTTAATTGAAACAAACCCCTGG - Intronic
1064328307 10:14371565-14371587 TTTGTAGTGGCACAAACCCCGGG - Intronic
1065314517 10:24449621-24449643 TTCCTTCTGTAAAAAACCCAAGG + Intronic
1065634644 10:27718544-27718566 TTTTTACTTTAAAAAATCCCAGG + Intronic
1075180112 10:120203833-120203855 TTTCTACTGTAACAACCCCTAGG - Intergenic
1075219977 10:120576396-120576418 TTACCACTGCAACAAACCCCCGG - Intronic
1075592232 10:123700774-123700796 TTTCTCCTGCAACAAAACCTAGG - Intergenic
1081344298 11:41963614-41963636 TTTCTCTTGTAATAAATCCCTGG - Intergenic
1092733669 12:11558565-11558587 TTCCTACTGCCACCAACCCCTGG + Intergenic
1093283115 12:17220954-17220976 TTATTACTGTAACAAACACAGGG + Intergenic
1094012652 12:25825554-25825576 GTTCTACTGTAACAAGGACCTGG - Intergenic
1094415667 12:30212469-30212491 TTTCAATTGCAACAGACCCCCGG + Intergenic
1095464103 12:42472686-42472708 TTACTACTGTCACCACCCCCAGG + Intronic
1096299208 12:50411109-50411131 TTTCTACTGTAACAAACCCCTGG - Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1098630263 12:72713870-72713892 TTTCTCATGTAACAAACAGCAGG + Intergenic
1100172853 12:91996366-91996388 TATCTACAGTAACAAAACCCAGG - Intronic
1101625944 12:106441716-106441738 TTTCTACTGTTATAAACAACAGG + Intronic
1110582816 13:77152245-77152267 TTTGGACTGACACAAACCCCTGG + Intronic
1113699504 13:112374263-112374285 TTTCTGCTGTGACCAAGCCCAGG + Intergenic
1113923132 13:113925588-113925610 TTTCTACTTAAAAAAACTCCAGG - Intergenic
1115714990 14:36093782-36093804 CTTCTACTATAACAAACCTGAGG - Intergenic
1116143824 14:41037681-41037703 TTTCAGCTGGAACAAGCCCCTGG + Intergenic
1117299351 14:54408515-54408537 TTTCTTCTGTAACAAGTACCTGG - Intronic
1117450209 14:55842665-55842687 TTTCCACTTTAAAGAACCCCTGG + Intergenic
1117911265 14:60640445-60640467 TTTCTACTGTAAATAAGCCATGG + Intergenic
1119108349 14:71946202-71946224 TGTCTCCTGTCACATACCCCTGG - Intronic
1120386877 14:83857657-83857679 TTTTTATTGTAACCAACACCTGG + Intergenic
1120805574 14:88745792-88745814 TTTTTACTGAAGCAAACACCAGG + Intronic
1120988245 14:90353024-90353046 TTACAAATGTAACTAACCCCAGG + Intergenic
1127425022 15:58847323-58847345 TCTCTTCAGTAAGAAACCCCTGG - Exonic
1128373246 15:67056530-67056552 TTTCTCCTGTCACACACCCAGGG + Intergenic
1129143974 15:73631956-73631978 TTTCTACTGTACCACCTCCCAGG + Intronic
1134079381 16:11314545-11314567 ATTCTACTGTACAAGACCCCGGG - Intronic
1135237866 16:20775268-20775290 GTCCTCCTGCAACAAACCCCAGG - Intronic
1148588769 17:48799851-48799873 TGTCTAATGTGACAAATCCCTGG + Intronic
1152039514 17:77893913-77893935 TGTCTTCTTTAACAAATCCCTGG - Intergenic
1155460767 18:26079910-26079932 TTTCTCCTGTTACAAACAACAGG + Intronic
1159178500 18:64870199-64870221 TTTCTACTGCATCAAACCATAGG + Intergenic
1164074986 19:21807115-21807137 TTTATATTGGAAAAAACCCCTGG - Intronic
1164295566 19:23906711-23906733 TGGCTACTGTAACATATCCCTGG + Intergenic
1164384665 19:27762584-27762606 ATTCTACTGAAAGAAACTCCTGG - Intergenic
1164385179 19:27765820-27765842 TTTCTACTGATAGAGACCCCTGG - Intergenic
1164408654 19:27977532-27977554 CCTCTACTGTAACAACTCCCTGG - Intergenic
925264616 2:2558261-2558283 TTTCTAGTTTAACGAACCCATGG + Intergenic
930177019 2:48312155-48312177 TTTTTACTGTTGCAAACTCCTGG + Intergenic
930378105 2:50592992-50593014 TTACTACTCTAAAAAGCCCCTGG + Intronic
930864450 2:56108829-56108851 TTTCAGCGGTCACAAACCCCAGG - Intergenic
932125829 2:69144927-69144949 TCTCTATTTTAACTAACCCCAGG - Intronic
932459735 2:71874535-71874557 CTTCTACTATAAATAACCCCCGG - Intergenic
932596618 2:73097605-73097627 TTTCTACTGCTACAAACCCATGG + Intronic
935484665 2:103638910-103638932 CTTCTACTCTAACAGACCCTGGG + Intergenic
935805034 2:106737227-106737249 TTTTTAGTTTAACAAACCGCAGG + Intergenic
936810103 2:116388206-116388228 TTTCCATTGTTATAAACCCCAGG + Intergenic
937348908 2:121147211-121147233 TTTCTGCCAGAACAAACCCCTGG + Intergenic
937647055 2:124277191-124277213 TTTATAGAGAAACAAACCCCAGG - Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
946488799 2:220127526-220127548 TTTCTGCTGTTACTAATCCCTGG + Intergenic
1177693831 21:24545990-24546012 TTTAGACTGTAACAGACCCCTGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1179406592 21:41131606-41131628 TTGCTACAGAAACACACCCCTGG + Intergenic
1183695555 22:39419932-39419954 TTTCTACAGTACCCAACTCCTGG - Intronic
949444010 3:4114308-4114330 CATCTACAGTTACAAACCCCTGG + Intronic
953303234 3:41800200-41800222 TTTCTCCTGTAATAAAGCCCTGG + Exonic
955192973 3:56779001-56779023 TTTTTACTGTAACATACCCAAGG + Intronic
955864064 3:63363194-63363216 TTTCTACTGAAACATATGCCGGG - Intronic
956142962 3:66164241-66164263 TTTCTCTTGTAACAAACATCTGG + Intronic
956531449 3:70224061-70224083 TAGATACTGTAACAAACACCAGG + Intergenic
956710611 3:72035554-72035576 TTCCTACTGTGGCAAATCCCTGG + Intergenic
959560129 3:107769831-107769853 TTTCTACTTTAACCTACCCAAGG - Intronic
962867666 3:139460998-139461020 TTCCCACTGTAACGAACCCCAGG - Intronic
965088082 3:164125416-164125438 TTTTTACTGTAACACATCCATGG + Intergenic
965123119 3:164589313-164589335 TTTCTACAGTAACAAAGACATGG - Intergenic
966357433 3:179096069-179096091 TTTCTCCTGGAACAAAGCCCAGG + Intergenic
967368540 3:188716174-188716196 GTTCCACTGGAACAAACTCCTGG - Intronic
970004653 4:11399249-11399271 CTTCTACTTTAACAAAACCAAGG - Exonic
970767617 4:19569051-19569073 TTTCTACAGCAACAAAACACAGG + Intergenic
970934892 4:21557824-21557846 TTTCTATAGTTACAAAGCCCAGG - Intronic
972770141 4:42190028-42190050 TCTCTACTGTAACAACTCCTTGG + Intergenic
976274497 4:83262160-83262182 TTTCAACTATCACAAACTCCTGG + Intronic
976451770 4:85199112-85199134 TTCCTGCTGTAACAACTCCCTGG + Intergenic
976536589 4:86224286-86224308 TTTCAACTGTGACAAATGCCGGG + Intronic
980019190 4:127688550-127688572 TTTCTACTGTAACATAGCCTAGG - Intronic
980559646 4:134456410-134456432 TTTTTATTGGAACAAACACCAGG - Intergenic
980658313 4:135819600-135819622 TTTTTAATATAACAAAGCCCAGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982107865 4:152026410-152026432 ATTCTACCGAATCAAACCCCGGG + Intergenic
983833400 4:172359727-172359749 TTTCTCCTGTAAAAAACATCTGG + Intronic
984007938 4:174336185-174336207 TCTATTCTTTAACAAACCCCTGG + Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987885036 5:23801629-23801651 TTTTTAGTGTAACAATCACCAGG - Intergenic
990679197 5:58222143-58222165 TTTCCAGTGTAAGAAACACCAGG + Intergenic
991082845 5:62619924-62619946 TGTCTTCTGTAACAGACCTCTGG + Intronic
991098696 5:62767710-62767732 CTTCTCCTTTAACAAAGCCCAGG + Intergenic
993764387 5:91837619-91837641 TTTCCAATGTAACAGACCTCTGG - Intergenic
995059862 5:107802144-107802166 TTCCTCCTGGAACAAATCCCAGG - Intergenic
996170567 5:120284962-120284984 ATTCTAATGTGACAAACCACTGG - Intergenic
997144205 5:131414380-131414402 TTTCTACTGTATCATCCCCTTGG - Intergenic
998697874 5:144661344-144661366 TTTATACTGTAATATACCCAGGG + Intergenic
999081969 5:148853076-148853098 TTTCTACTGGCACAAAGTCCAGG + Intergenic
1000396946 5:160785945-160785967 TTTCTACTGAAACAACTTCCTGG - Intronic
1002018602 5:176346957-176346979 TTTGTACTGTTCCAAAACCCAGG - Exonic
1002204917 5:177555811-177555833 ATTCTTCTGTACCAAACACCAGG + Intergenic
1004524600 6:16394880-16394902 TTTGTACTGTAACACAGCCAAGG + Intronic
1009638670 6:66301467-66301489 TTTTAACTGTAATAAACTCCAGG + Intergenic
1013079605 6:106800949-106800971 TTTCTACTGTTAAAGCCCCCTGG + Intergenic
1013297885 6:108775923-108775945 TAACTGCTATAACAAACCCCAGG + Intergenic
1014837409 6:126175137-126175159 ACTCTACTGTTTCAAACCCCTGG + Intergenic
1017447557 6:154521438-154521460 TTTCTTCTGGATCACACCCCAGG + Intergenic
1020030913 7:4932067-4932089 CTGCTCCTGTAACAAACACCAGG + Intronic
1021112631 7:16713081-16713103 AATCAACTGTAACAAACCCTTGG - Intergenic
1028362650 7:89987582-89987604 ATTCTTCTGAAACAAACACCTGG + Intergenic
1032979036 7:137260600-137260622 TTTTTACTTTTACAAAGCCCAGG + Intronic
1033048344 7:137982289-137982311 TTTCTACTGAAAGAAACCTGTGG - Intronic
1033933825 7:146558030-146558052 TTAGTACTGTGACAAACTCCGGG + Intronic
1035493906 7:159304985-159305007 TTTCTACTATTACAAACCACAGG - Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1040465725 8:47693357-47693379 TTTCTTCTGTAAGAAACCCATGG - Intronic
1040960463 8:53026834-53026856 TTTCAAATGCAGCAAACCCCAGG - Intergenic
1045442608 8:102228953-102228975 TATTTACTCTAACAAACCCTCGG + Intronic
1046188667 8:110759758-110759780 TTTCTACTGAAACACACAACTGG + Intergenic
1046789160 8:118302579-118302601 TTTCCACTGTAACTAATACCTGG + Intronic
1048229468 8:132623169-132623191 TATTTACAGTAGCAAACCCCTGG + Intronic
1049070347 8:140350853-140350875 TTGCTCCTGTAATAAAACCCAGG - Intronic
1051819840 9:21151559-21151581 TTTCTATAGTAACAAACTCAGGG - Intergenic
1058561212 9:106231322-106231344 ATTCTTCAGTAACAATCCCCTGG + Intergenic
1059618211 9:115974144-115974166 GTACTACTTTAACAAACCCATGG - Intergenic
1187959414 X:24554385-24554407 TTCCCACTGAAACAAACCCAGGG - Intergenic
1188907860 X:35809680-35809702 TTACTTCTGTAACCAGCCCCAGG + Intergenic
1190947874 X:55113539-55113561 TTTTTGCTGCAACAGACCCCTGG + Intronic
1193821408 X:86170323-86170345 TTTCGGCTGTAACAACTCCCTGG + Intronic
1198700512 X:139392455-139392477 TTTCTTCTGTAACAAACACCTGG - Intergenic
1200248253 X:154537669-154537691 TTCCTACAGAAACAACCCCCTGG + Intronic