ID: 1096299644

View in Genome Browser
Species Human (GRCh38)
Location 12:50415586-50415608
Sequence ACATATAACAAAAAATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1130
Summary {0: 1, 1: 0, 2: 1, 3: 70, 4: 1058}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096299644_1096299646 12 Left 1096299644 12:50415586-50415608 CCTTCCAATTTTTTGTTATATGT 0: 1
1: 0
2: 1
3: 70
4: 1058
Right 1096299646 12:50415621-50415643 AATTGCCCATGTTATGTGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096299644 Original CRISPR ACATATAACAAAAAATTGGA AGG (reversed) Intronic
902163051 1:14547742-14547764 ACAAAAAACAAAAAATTAGCAGG - Intergenic
902168996 1:14595518-14595540 AAATACAAAAAAAAATTAGAGGG + Intergenic
902303790 1:15521868-15521890 AAATAAAACTAAAAATTGGTAGG - Intronic
902355459 1:15895839-15895861 AAATATAAAAAAAAATTAGCTGG - Intronic
902408117 1:16197447-16197469 TCATATGACAAAAAAGTGGGGGG + Intergenic
902414117 1:16228994-16229016 ACAAACAACAAAAAATGGGCTGG - Intergenic
902506624 1:16942944-16942966 AAAAATAAAAAAAAATTGGCCGG + Intronic
902829222 1:18999108-18999130 AAATACAAAAAAAAATTGGGGGG + Intergenic
903338561 1:22640685-22640707 AAAAAAAAAAAAAAATTGGAGGG + Intergenic
904342090 1:29842873-29842895 ACATACAAACAAAATTTGGAAGG + Intergenic
904642789 1:31942971-31942993 AAATATAAAAAAAAATTAGTTGG + Intronic
905383958 1:37586272-37586294 ACAAAAAATAAAAAATTGGCTGG - Intronic
906090500 1:43175483-43175505 AAATAAAATAAAAAACTGGAAGG - Intronic
906118303 1:43369874-43369896 ACATTTAAAAAAAAATTAGCTGG + Intergenic
906185116 1:43856707-43856729 ATATATGAAAAAAAATTGGTGGG - Intronic
906197989 1:43941135-43941157 ACTTATACAAAAAAATTGGCTGG + Intergenic
906389353 1:45400490-45400512 ACATAACACAAAAAATTGTATGG + Intronic
906623695 1:47307157-47307179 ACAAAAAACAAAAAATTAGCTGG + Intronic
906863492 1:49389235-49389257 ACACATAAAAAAAAAATTGATGG - Intronic
907537844 1:55181280-55181302 AAATAAAACAAAAAACAGGAAGG + Intronic
907693930 1:56701730-56701752 AAATACAACAAAAAATTAGCTGG + Intronic
907923524 1:58934784-58934806 ACAATTAACAAAAAATGGAAGGG + Intergenic
908302517 1:62776350-62776372 AAAACAAACAAAAAATTGGAAGG - Intergenic
908557943 1:65276349-65276371 ACATATAATAAAAAATTGCCAGG - Intronic
908587744 1:65591071-65591093 ACATATCAAAAAAAATTAGAAGG - Intronic
908738321 1:67300059-67300081 AGATAAAACAAAAAATTAAAAGG + Intergenic
909122794 1:71625849-71625871 AAATATAAAAAAAAATTATAAGG - Intronic
909164244 1:72197928-72197950 ACATACAACAAAAAATGCAAAGG - Intronic
909350224 1:74643994-74644016 ATATATTACAAAAACTTGGGGGG - Intronic
909595449 1:77401302-77401324 ACATATAAAAGAAATTTTGAAGG + Intronic
909918839 1:81355195-81355217 ACACATTAAAAAAAATTGGCTGG + Intronic
909956526 1:81785942-81785964 ACAGAAAAAAAAAAATTGGTGGG + Intronic
909965977 1:81910923-81910945 ACATGTAAAAAAAAAAAGGAAGG - Intronic
910389165 1:86719832-86719854 AAAAATAACAAAAAATTAGCTGG + Intronic
910800965 1:91145626-91145648 ACATATAAAGAAAAATTGGCCGG - Intergenic
911200106 1:95036039-95036061 ACATATAAAAAAAAATTTTGTGG - Intronic
911260202 1:95676968-95676990 ACATTTAAAAATTAATTGGAAGG - Intergenic
911414150 1:97549226-97549248 ACAAAAAATAAAAAATTAGATGG - Intronic
911878633 1:103203672-103203694 TGAACTAACAAAAAATTGGAGGG + Intergenic
911942150 1:104060410-104060432 ATATAGAAAAAAAAATTGAAAGG - Intergenic
912120391 1:106464555-106464577 AAATACAAAAAAAAATTGGCCGG - Intergenic
912284014 1:108348826-108348848 ACAAAATACAAAAAATTGGCTGG - Intergenic
912351194 1:109015483-109015505 AAATACAAAAAAAAATTGGCTGG - Intronic
912362708 1:109108123-109108145 ACAAAAAACACAAAACTGGATGG - Intronic
912548520 1:110468249-110468271 AAAAAAAAAAAAAAATTGGAAGG + Intergenic
912769143 1:112446710-112446732 ACAAAAAACAAAAAATTAGCTGG - Intronic
912772682 1:112479270-112479292 ACATAAGACAAAAATTTGCAGGG + Intronic
912920418 1:113861534-113861556 AAATACAAAAAAAAATTGGCCGG - Intronic
912991889 1:114495686-114495708 ACAGAGAAGAGAAAATTGGATGG + Intronic
913161222 1:116147711-116147733 ACATAAAACATAAAATATGATGG + Intergenic
913681935 1:121194389-121194411 ACAAAAAACAAAAAACTGGCTGG + Intronic
914262348 1:146009778-146009800 ACAAAAAACAAAAAATTAGATGG + Intergenic
914391459 1:147226763-147226785 AAATACAACAAAAAATTCAATGG - Intronic
914577091 1:148982792-148982814 TCATGTAAAAAAAAAATGGAAGG - Intronic
914723527 1:150308672-150308694 AAATACAAAAAAAAATTGGCCGG + Exonic
914980062 1:152407283-152407305 ACAGCTAACAAAAAAATGAAGGG - Intergenic
915151441 1:153835125-153835147 ACAAAAAACAAAAATTTGAATGG + Intronic
915262975 1:154692503-154692525 ACGTAAAAGAACAAATTGGAAGG - Intergenic
915478668 1:156170159-156170181 ACAAATAATAAAAAATTAGCTGG + Intronic
915707868 1:157863779-157863801 ACAAAAAACAAAAAATTAGCCGG - Intronic
915744074 1:158142746-158142768 ACATCTAACAAAACCTTGGTGGG - Intergenic
916041373 1:160964420-160964442 AAAAATAAAAAAAAATTAGACGG + Intergenic
916055234 1:161064594-161064616 ACAAAAAACAAAAAATTAGCAGG + Intronic
916190454 1:162172643-162172665 ACATATACCAAAGAGTTGGCTGG - Intronic
916397637 1:164409186-164409208 AAATATAAAAAAAAATTAGCCGG + Intergenic
916702497 1:167312230-167312252 ACAAAAAAAAAAAAATTGGCTGG - Intronic
916756832 1:167778786-167778808 GGAAATAAAAAAAAATTGGATGG + Intronic
917102558 1:171460763-171460785 ATAAAAAACAAAAAATTGGCTGG + Intergenic
917551019 1:176029048-176029070 ACATTTAACGAATAATTGGCTGG - Intronic
917815090 1:178700746-178700768 ACAAATAACACAAAATAAGATGG - Intergenic
917949762 1:180019015-180019037 ACAAATACCAAAAAATTAGGTGG - Intronic
918027812 1:180770138-180770160 ACATAAAACAAAATACAGGAAGG - Intronic
918155079 1:181836616-181836638 ACATAGTACAACAAATTAGAAGG + Intergenic
918209117 1:182335233-182335255 ACAAATAATAAAAAATTAGCTGG - Intergenic
918540427 1:185626159-185626181 ACAAAAAACAAAAAATTAAATGG + Intergenic
918574361 1:186038531-186038553 ACATACAACAAAAAATAGATAGG + Intronic
918633173 1:186743682-186743704 ACAAATAACAAAAATTAGTAGGG + Intergenic
918933135 1:190883432-190883454 ACATATAAAAATAAATTCTATGG + Intergenic
918964636 1:191327018-191327040 AAATGTAACAAATAATTGAAAGG + Intergenic
919026267 1:192175076-192175098 AAAAATAAAAAAATATTGGATGG - Intronic
919036645 1:192319294-192319316 TGATATAAAAAAAAGTTGGAAGG - Intronic
919147055 1:193649175-193649197 ACAAATAACAAATAATGAGATGG - Intergenic
919245928 1:194983752-194983774 ACATATAAGAAAATATTAGTGGG + Intergenic
919627720 1:199928284-199928306 AAATATAAAAAAAAATTAGCCGG + Intergenic
919731879 1:200918035-200918057 ACAAATAACCAAAAATTAGCTGG - Intergenic
920469251 1:206212898-206212920 ACAAAAAACAAAAAACTGGCTGG + Intronic
921001941 1:211053029-211053051 ACATATAAATAAAAATTTAAAGG - Intronic
921118086 1:212113442-212113464 ACAAAAAACAAAAAACTGGTGGG - Intergenic
921420117 1:214937518-214937540 AAAAATAATAAAAAATTGGGAGG - Intergenic
921427306 1:215019157-215019179 ACTTATAATAAAAAATTGGTAGG + Intronic
921542952 1:216440049-216440071 AAGTAAAACAAAAATTTGGAGGG + Intergenic
921565241 1:216709691-216709713 ATTTAAAAAAAAAAATTGGAGGG + Intronic
921802091 1:219413136-219413158 ACAAAGAAAAAAAAAATGGAAGG + Intergenic
921908518 1:220522427-220522449 ACATAGAAAAAATAATTTGAAGG + Intergenic
922045637 1:221942986-221943008 AAAGATAACAAAAAATTAGTTGG + Intergenic
922284217 1:224154510-224154532 AAAAATACCAAAAAATTGGCCGG + Intronic
922378960 1:225001248-225001270 AAACATAACAAAACATTGAAGGG - Intronic
922686936 1:227647093-227647115 AAATACAAAAAAAAATTAGATGG + Intronic
922689163 1:227673427-227673449 AGAAATAAAACAAAATTGGAGGG + Intronic
922939581 1:229450037-229450059 ACAAAAAAAAAAAAATTAGATGG - Intronic
923879382 1:238086661-238086683 ATAGATAACAAAAAATTGGGGGG + Intergenic
924005652 1:239607684-239607706 ACACATAACATAAAATAGAATGG - Intronic
924206619 1:241718634-241718656 ACATCAAACAAGATATTGGAGGG - Intronic
924270631 1:242328989-242329011 AAATAAAACAAAAAATTTGCAGG - Intronic
924324293 1:242880025-242880047 AGAAATAACACAAAATTGAAGGG + Intergenic
924389047 1:243531250-243531272 AAAAATAACAAAAAATTAGCCGG - Intronic
924532484 1:244905062-244905084 ACAAAGACCAAAAAATTAGATGG - Intergenic
924555128 1:245111873-245111895 ACAAATAAAAAAAAATTAGCTGG + Intronic
924632672 1:245755946-245755968 ACAGAAAACAAAAAATTAAATGG - Intronic
1063195041 10:3733889-3733911 TCATAGAACATAAAATTGGCTGG - Intergenic
1063355910 10:5398122-5398144 ATAAAAAACAAAAAATTGGCCGG + Intronic
1063456110 10:6183847-6183869 AAATATAAAAAAAAATTAGCCGG - Intronic
1063478320 10:6348020-6348042 ACAGAACACAAAAACTTGGAAGG - Intergenic
1063644098 10:7861121-7861143 ACATACAAAAAAAAATTAGCCGG - Intronic
1063792467 10:9468977-9468999 ACATATAAAATAAAATATGAAGG + Intergenic
1063914390 10:10866756-10866778 ACTAAAAACAAAAAATTAGATGG + Intergenic
1064047457 10:12030720-12030742 AAAAATAACAAAAAATTAGCAGG + Intronic
1064128517 10:12686481-12686503 AAAAATAACAAAAAATTAGCTGG - Intronic
1065037989 10:21660123-21660145 AATTATAAGAAAAAATTAGATGG - Intronic
1065235938 10:23652456-23652478 CCATATAACCAAAAATTAAATGG - Intergenic
1065446694 10:25809577-25809599 AAAAAAAAAAAAAAATTGGAAGG + Intergenic
1065799748 10:29341329-29341351 AAAAATAAGAAACAATTGGATGG + Intergenic
1065888519 10:30100541-30100563 ACAAATACCAAAAAATTAGCTGG - Intronic
1065917039 10:30361221-30361243 ACATACAAAAAAAAATTTTAAGG + Intronic
1066040297 10:31542684-31542706 TGATATAACGAAAAATTGCAAGG + Intergenic
1066152582 10:32639788-32639810 AAAAATAACAAAAAATTAGCCGG - Intronic
1066253307 10:33654794-33654816 ACACACAACAAGAAATTGGGTGG + Intergenic
1066671935 10:37849523-37849545 AAATACAAAAAAAAATTAGACGG + Intronic
1067173465 10:43926092-43926114 ACCTATACCAGAAAATTGGAGGG + Intergenic
1067861441 10:49853193-49853215 ACATACAAAAAAAAATTAGCTGG - Intronic
1068189709 10:53635393-53635415 ACATATAAACAAAAAGAGGAAGG - Intergenic
1068742251 10:60486829-60486851 ATATACTACAGAAAATTGGAGGG - Intronic
1069331137 10:67294773-67294795 ACGTATAACAAAATAATGGTTGG - Intronic
1069369957 10:67737380-67737402 ACCTATATCAAAAAAATAGAAGG + Intergenic
1069489996 10:68853082-68853104 AAAAATAACAAAAAATTAGCTGG - Intronic
1069937204 10:71925792-71925814 AAAAATTACAAAAAATTGGCTGG - Intergenic
1070196561 10:74162431-74162453 CCATTTAACAAAAAAATGAAAGG - Intronic
1070623584 10:78032809-78032831 ACAAAAAAAAAAAAATTGGCCGG - Intergenic
1071319624 10:84441197-84441219 ACGTATAACAAAAAATAAAAAGG - Intronic
1071363963 10:84879702-84879724 ACCTATGACATAAAATTAGAAGG + Intergenic
1071722332 10:88159892-88159914 AAATTTAAAAAAAAATTGGGGGG + Intergenic
1071908205 10:90198519-90198541 ACATATAACAAAAGATTTAGGGG + Intergenic
1072093892 10:92157789-92157811 CCATATAACAAAAAACTTTAAGG + Intronic
1072141105 10:92590034-92590056 AAATATAAAAAAAAATTAGCCGG + Intergenic
1072282793 10:93884325-93884347 ACAAATTACAAAAAATTAGCTGG - Intergenic
1072373045 10:94785310-94785332 AAATATAACTGAAAAATGGACGG - Intronic
1072427481 10:95342115-95342137 ATATATCACAAATAATTTGAGGG - Intronic
1072595781 10:96870182-96870204 ACAAAAAACAAAAAATTAGCCGG - Intronic
1073015802 10:100398123-100398145 AAATACAACAAAAAATTAGCCGG - Intergenic
1073352104 10:102827385-102827407 ACACTTAAAAAAAAATTGGCCGG - Intergenic
1073849495 10:107598316-107598338 ACATATAGCAGAAAATTAGAAGG - Intergenic
1073974110 10:109080841-109080863 ACAAAAAATAAAAAATTGTATGG - Intergenic
1074075290 10:110117852-110117874 AAAGATAACAAAAAATTAGCTGG + Intronic
1074780272 10:116797401-116797423 ACATTTGACAAACAATTGTAAGG - Intergenic
1075035646 10:119064867-119064889 AAAAATAACAAAAAATTAGCTGG - Intronic
1075251406 10:120878545-120878567 AAATATAAAAAAAAATTCCAAGG - Intronic
1075878451 10:125827808-125827830 AAAAATAACAAAAAATTAGCCGG + Intronic
1076490006 10:130852523-130852545 AAATACAACAAAAAATTAGCCGG - Intergenic
1076839175 10:133037289-133037311 ATATATAAAAAAAAATTAGCCGG - Intergenic
1076867160 10:133173484-133173506 AAATAAAAAAAAAAATTAGAAGG - Intronic
1077274737 11:1699180-1699202 AAATATAAAAAAAAATTAGCCGG - Intergenic
1077733218 11:4758813-4758835 AAAAATGACAAAAAATTGGCTGG + Intronic
1077759747 11:5080762-5080784 ACACACAAGAAAAAAATGGAAGG + Intergenic
1078201754 11:9189800-9189822 ACTTAAAACACAAAATTGGCTGG - Intronic
1078224239 11:9378055-9378077 AAATATAATGAAAAATTGGCTGG + Intergenic
1078319351 11:10319998-10320020 TCATTTAATAGAAAATTGGAAGG - Intronic
1078459486 11:11502978-11503000 ACATATTACAAACATTTTGACGG - Intronic
1079041033 11:17059743-17059765 ACATTGAAAAAAAAATTGGCTGG + Intergenic
1079558321 11:21789749-21789771 CCAGAAAACAAAAAATTGGAAGG - Intergenic
1079692028 11:23430894-23430916 ACACATCACAATAAATTAGAGGG + Intergenic
1080044802 11:27797647-27797669 AAAAATAACAAAAAATTAGCCGG + Intergenic
1080382200 11:31784110-31784132 ACATAGAAAAAAGAAGTGGATGG + Intergenic
1080851760 11:36076545-36076567 ACATATACAAAAAAATTAGCCGG - Intronic
1081246823 11:40777559-40777581 ACAGAAAACAAAAAAGAGGAAGG - Intronic
1081429099 11:42956355-42956377 ATATACAAAAAAAAATTGGCTGG + Intergenic
1081602001 11:44501705-44501727 AAATATAAAAAAAAATTAGCTGG + Intergenic
1081648993 11:44810765-44810787 AAAAATAACAAAAAATTAGCTGG - Intronic
1081852014 11:46280347-46280369 AAATATAAAAAAAAATTAGCCGG - Intronic
1082231030 11:49766653-49766675 ATATATAACAAAACAATGTAGGG + Intergenic
1082875251 11:57981173-57981195 ACAAAAAATAAAAAATTAGATGG + Intergenic
1083123437 11:60538582-60538604 AAATAAAAAAAAAAATTGCAGGG + Intronic
1083422860 11:62565223-62565245 ACAAATAATAAAAAATTAGCTGG + Intronic
1083480845 11:62945550-62945572 ACATACAAAAAAAAATTAGCCGG - Intronic
1084061673 11:66679262-66679284 AAAAATAAAATAAAATTGGAAGG - Intergenic
1086315359 11:85585873-85585895 ACATATACAAAAAAATTAGCCGG - Intronic
1086963034 11:92999311-92999333 TCATAGAACAGAAAATAGGATGG - Intergenic
1087180545 11:95137666-95137688 TCATATAACAAGAATTTAGAAGG + Intergenic
1088220862 11:107569113-107569135 ACAAAAAACAAAAAATTAGCTGG - Intergenic
1088240822 11:107772330-107772352 AAAAAAAAAAAAAAATTGGAGGG - Intergenic
1088553854 11:111041672-111041694 ATAAATAATAAATAATTGGATGG + Intergenic
1088631449 11:111777647-111777669 AAATATAAAAAAAAAATGCAAGG + Intergenic
1089010428 11:115127745-115127767 ACTAAAAACAAAAAATTCGACGG - Intergenic
1089100255 11:115957095-115957117 ACATAAAAGCAAAAAATGGATGG + Intergenic
1089530794 11:119127850-119127872 AAAAAAAAAAAAAAATTGGAAGG - Intronic
1089530871 11:119128465-119128487 AAATACAAAAAAAAATTAGACGG - Intronic
1089930164 11:122302085-122302107 AGATATGTCAAAAAATTGTAAGG + Intergenic
1090112773 11:123933478-123933500 AAATTTAACAAAAAATTTGCAGG - Intergenic
1090219835 11:125010163-125010185 AAAAATAACAAATAATTGCAAGG - Intronic
1090601448 11:128376516-128376538 ACTTATCCCAAAAAATTGTAAGG - Intergenic
1091523864 12:1276397-1276419 AAAAATAACAAAAAATTAGCTGG - Intronic
1092338505 12:7655351-7655373 AAATACAAAAAAAAATTGGCTGG + Intronic
1092500209 12:9038097-9038119 ACAAAAAATAAAAAATTGGCTGG + Intergenic
1092516687 12:9222233-9222255 AAATACAACAAAAAATTAGCCGG - Intergenic
1092522836 12:9291396-9291418 ACATGTAACATACAATTCGAGGG - Intergenic
1092544451 12:9440501-9440523 ACATGTAACATACAATTCGAGGG + Intergenic
1093239970 12:16658308-16658330 ATAAATAACAAAAAATGGAAAGG - Intergenic
1093313596 12:17621567-17621589 ACAAAAAACAAAAAGTTGGGTGG - Intergenic
1093644750 12:21571975-21571997 ACAAACAACATAAAATGGGAGGG + Intronic
1093922338 12:24872891-24872913 ACATATGCCTAAAAAGTGGAAGG + Intronic
1093931409 12:24958088-24958110 TCATATAACAAAACTTTTGAAGG - Intergenic
1094482759 12:30897794-30897816 ACATTTGACAAAAGACTGGAGGG - Intergenic
1094508498 12:31081566-31081588 ACATGTAACATACAATTCGAGGG - Intronic
1094563839 12:31581529-31581551 AAATACAAAAAAAAATTAGAGGG + Intronic
1094590770 12:31817799-31817821 AAATATAAAAAAAAATTAGCTGG - Intergenic
1094669973 12:32560597-32560619 AAATATAACAAGAATTTAGAAGG - Intronic
1094751240 12:33411372-33411394 ACTTGTTACCAAAAATTGGAAGG + Intronic
1095579906 12:43785537-43785559 ACATAGATATAAAAATTGGAAGG + Intronic
1095973320 12:47920905-47920927 ACTTAAAACAATAAATTGGGTGG - Intronic
1096056788 12:48659459-48659481 ACAAAAAATAAAAAATTGGCTGG + Intronic
1096299644 12:50415586-50415608 ACATATAACAAAAAATTGGAAGG - Intronic
1096480169 12:51934874-51934896 AGATATAACAGAAGATAGGATGG - Intergenic
1096706712 12:53426459-53426481 ACAAAAAACAAAAAATTGGCTGG + Intronic
1096754054 12:53784084-53784106 AAAAAAAAAAAAAAATTGGAAGG + Intergenic
1097169239 12:57103457-57103479 ACAAAAAATAAAAAATTGGCCGG - Intronic
1097441745 12:59616191-59616213 GCATATAACAGAAAAATTGAAGG + Intronic
1097659138 12:62408715-62408737 ATATATAACAAAAACTAGCAAGG - Intronic
1097827065 12:64185126-64185148 ACAAAATACCAAAAATTGGATGG - Intergenic
1097927819 12:65149756-65149778 ATATGTATCAAAAATTTGGAGGG - Intergenic
1098093021 12:66924139-66924161 AAATATGCCAAAAAATTGGCTGG - Intergenic
1099193396 12:79584233-79584255 ACAGATAACAAAAAATTAGCAGG + Intronic
1099276169 12:80578550-80578572 AAATACAACAAAAAATTAGCCGG - Intronic
1099527810 12:83736918-83736940 ACATTTAACAAAAAATTGTCAGG + Intergenic
1100317569 12:93459101-93459123 AAAAATAACAAAAAATTAGCCGG + Intergenic
1100978874 12:100148829-100148851 AAAAAAAAAAAAAAATTGGAGGG + Intergenic
1101355609 12:103974809-103974831 AAATATAAAAAAAAATTAGCTGG + Intronic
1101904275 12:108813549-108813571 ATATATAAAAAAAAATTAGCTGG + Intronic
1102082720 12:110111452-110111474 ACAAATAACAAAAACAGGGAAGG - Intergenic
1103138750 12:118530405-118530427 AAAAATAACAAAAAATTAGCCGG + Intergenic
1103280426 12:119753573-119753595 AAAAATAACAAAAAATTAGCTGG + Intronic
1103313470 12:120031926-120031948 ACAAATAAAAAAAAATTAGCCGG + Intronic
1103345376 12:120245886-120245908 AGAAATAACAAAAAACAGGAGGG + Intronic
1103448906 12:121014168-121014190 AAATATAAAAAAAAATTAGCTGG + Intronic
1103622421 12:122196341-122196363 ACATATGGCAAATAATTGTATGG - Intronic
1103652359 12:122442776-122442798 ACAAAAAAAAAAAAATTGGCTGG + Intergenic
1103769527 12:123310526-123310548 AAAAATAAAAAAAAATTGGTCGG - Intronic
1103885872 12:124199701-124199723 ACAAATAATAAGAATTTGGAAGG + Intronic
1104234509 12:126920531-126920553 AAATACAAAAAAAAATTAGATGG + Intergenic
1104674761 12:130704956-130704978 ACAAATGACAAAAAACTGGGAGG + Intronic
1104865587 12:131951346-131951368 TCAAATAATAAAAAATTGGCCGG - Intronic
1104868028 12:131972312-131972334 AAAAATAACAAAAAATTCGCCGG - Intronic
1104995374 12:132651031-132651053 AAATACAACAAAAAATTAGCCGG - Intronic
1105016805 12:132790887-132790909 ACAAAAAACAAAAAATTAGCCGG + Intronic
1105046073 12:133004645-133004667 ACAAATAACAAAAAAATGTGTGG - Intronic
1105062761 12:133168978-133169000 AAAAATAACAAAAAATTAGCTGG + Intronic
1105513411 13:21070528-21070550 AAATATAAAAAAAAATTAGCTGG - Intergenic
1105742411 13:23341329-23341351 ACATTGTACAAAAACTTGGAGGG - Exonic
1105838923 13:24236431-24236453 AAATATAAAAAAAAATTAGCTGG + Intronic
1106067838 13:26374037-26374059 ACAAAAAACAAAAAATTAGCTGG + Intronic
1106125007 13:26894042-26894064 AAATATAAGAAAAAATTACAAGG + Intergenic
1106839068 13:33666909-33666931 ACATATATTTAAAAAGTGGATGG + Intergenic
1106957226 13:34953683-34953705 ATATATGAGAAAAAAATGGATGG + Intronic
1107131625 13:36902613-36902635 AAATACAAAAAAAAATTAGATGG - Intronic
1107419139 13:40230240-40230262 CCATAAAACAAAATATAGGAAGG + Intergenic
1107903396 13:45040466-45040488 ACCTAGAACAAAAACTTGGCAGG + Intergenic
1108190140 13:47929886-47929908 ACAAAAAACATAAAATTTGAAGG + Intergenic
1108366252 13:49717129-49717151 ACAAATAACACAAATATGGAAGG - Intronic
1109041533 13:57344846-57344868 ATATATAAGAATAAACTGGAGGG - Intergenic
1109144766 13:58765735-58765757 ACAGAGAACAAAAAATTGGGGGG + Intergenic
1109609381 13:64743582-64743604 GCTTTGAACAAAAAATTGGAAGG - Intergenic
1109933512 13:69247753-69247775 AGAAAGAACATAAAATTGGATGG - Intergenic
1110213031 13:72995138-72995160 AAAAATAACAAAAAATTAGCCGG + Intronic
1110309517 13:74032299-74032321 ACATATAAGAAAGTATTTGAAGG - Intronic
1110446499 13:75588854-75588876 ATATAAAATAAAAAATTTGAGGG - Intronic
1111003205 13:82212880-82212902 ACATAAAATAAAAAATTAGCTGG + Intergenic
1111324580 13:86676617-86676639 ACACATAAAGAAAAATTGAAAGG + Intergenic
1111350205 13:87018559-87018581 ATGTATAACAAATAATTAGAAGG + Intergenic
1111376834 13:87391184-87391206 AATTATACCAAAAAATTGAAGGG - Intergenic
1111590695 13:90344380-90344402 ATATAAAACAGAAAATTAGAGGG + Intergenic
1111788126 13:92816999-92817021 ACCTATAACCAAAAATGGGTTGG + Intronic
1111814960 13:93140486-93140508 ACAAAAAACAAAAAATTAGCTGG - Intergenic
1111853225 13:93603169-93603191 ACAAATAATAAAAAATTAGCTGG - Intronic
1111862902 13:93730589-93730611 ACATTTAACAAAACATCTGATGG + Intronic
1112165577 13:96916569-96916591 AAATAAAAGTAAAAATTGGATGG - Intergenic
1112353721 13:98657322-98657344 ACAAAAAACAAAAAATTAGCTGG + Intergenic
1112524115 13:100127590-100127612 ACATATAATAAAAGATTTGAGGG + Intronic
1113490347 13:110686856-110686878 ACAAAAAACAAAAAGTTGCAGGG - Intronic
1114245365 14:20908470-20908492 ACAAATAAAAAAAAGTTGCACGG - Intergenic
1114363387 14:22000822-22000844 AAAAATAAAAAAAAATTGGCAGG + Intergenic
1114886742 14:26861647-26861669 AAATAAAACAAAAAATTGGGTGG + Intergenic
1115034761 14:28843774-28843796 AAAAATACCAAAAAATTAGACGG - Intergenic
1115287228 14:31728744-31728766 ACATCTCACAAAAAGCTGGAAGG - Intronic
1115316678 14:32032448-32032470 AAACAAAACAAAAAATTGGCCGG + Intergenic
1116001657 14:39249300-39249322 ACATATAAAAATAAATTAGCTGG - Intronic
1116100898 14:40434095-40434117 ACTTATTACAGAAAATTGCAAGG + Intergenic
1116460537 14:45167790-45167812 TCATATAACTAACATTTGGAAGG + Intronic
1116878422 14:50138316-50138338 AAATATAAAAAAAAATTAGCTGG - Intronic
1117221976 14:53615606-53615628 ACATAAAATGAAAAATTAGATGG + Intergenic
1117362691 14:54992750-54992772 ACAAAAAATAAAAAATTAGATGG + Intronic
1117469812 14:56031705-56031727 ACATAAAAGAAAAAATTAGTTGG - Intergenic
1117559777 14:56925145-56925167 ACATATGAAAAAAAATTGTTGGG - Intergenic
1117586544 14:57213218-57213240 ACATATAAAAAAAAAATGGCTGG + Intronic
1117682378 14:58217503-58217525 ACATAAAAAAAAAAATTAGCTGG + Intronic
1117785451 14:59279653-59279675 ACAGGTAAAAAAAAATTGTATGG - Intronic
1118099896 14:62585916-62585938 ACATCTAACATAATATTTGATGG - Intergenic
1118381808 14:65223730-65223752 ACAAATAATAAAAAATTAGTAGG + Intergenic
1118827334 14:69396082-69396104 ACATGTAGCAGAAAATTGGATGG - Intronic
1119161507 14:72456449-72456471 AAATAAAACAAAAAATTAGCTGG - Intronic
1119739624 14:77005873-77005895 ACAAAAAATAAAAAATTGGCCGG - Intergenic
1119954194 14:78777696-78777718 CCATTTAACAAAAAATTAGGTGG + Intronic
1119989008 14:79173699-79173721 ACATGTAATAAGAAGTTGGAAGG + Intronic
1119995754 14:79251973-79251995 ACAAAAAATAAAAAATTGGCTGG - Intronic
1120126002 14:80744290-80744312 ATATATAACTAGGAATTGGAGGG - Intronic
1120245481 14:82001050-82001072 ACATAAAATAAAAAATTAGTTGG + Intergenic
1120349224 14:83331096-83331118 AAATAAAACAAAAAATTAGGTGG + Intergenic
1120405963 14:84093421-84093443 ATAAAAAACAAAAAATTGAATGG - Intergenic
1120608984 14:86615855-86615877 ACAAATAATAATAAATTGCAGGG - Intergenic
1120838456 14:89062085-89062107 ACATAAAACAAGAAATTTGCAGG + Intergenic
1121190576 14:92025716-92025738 AAATACAAAAAAAAATTAGACGG + Intronic
1121197619 14:92088229-92088251 AAAAATAACAAAAAATTAGCCGG - Intronic
1122260251 14:100514415-100514437 ACAAATAAAAAAAAATAGCAAGG - Intronic
1122749620 14:103922987-103923009 AAACAAAACAAAAAATTGGATGG + Intronic
1122958171 14:105082318-105082340 AAAAATAACAAAAAATTAGCCGG - Intergenic
1123498611 15:20857332-20857354 ACATATGACAACATATTGGGTGG + Intronic
1123555845 15:21430960-21430982 ACATATGACAACATATTGGGTGG + Intronic
1123592088 15:21868293-21868315 ACATATGACAACATATTGGGTGG + Intergenic
1123755836 15:23397087-23397109 AAAAATAACAAAAAATTAGCAGG - Intergenic
1123956323 15:25339100-25339122 AAATAAAACAAAAAAAAGGAAGG - Exonic
1123977061 15:25563657-25563679 ACGTATAACAAAAATGTGAATGG + Intergenic
1125046729 15:35250002-35250024 AAATATAAAAAAAAATTAGCCGG + Intronic
1125280034 15:38033553-38033575 ACAGACAAAAAAAAAATGGAGGG - Intergenic
1125812013 15:42549606-42549628 ACATACAAAAAAAAATTAGCTGG - Intronic
1125848685 15:42883698-42883720 ACATAAAACAAATAATAGAATGG + Intronic
1125915825 15:43486388-43486410 ACAAATAAACAAAAATTGGGAGG + Intronic
1126016011 15:44351413-44351435 AAAAATAACAAAAAATTAGCCGG + Intronic
1126391626 15:48161789-48161811 ACATAAAACAGAAAATTGTCAGG + Intronic
1126574560 15:50184150-50184172 AAAAATAACAAAAAATTAGCTGG - Intronic
1126609859 15:50518380-50518402 AAATATAAAAAAAAATTAGCCGG - Intronic
1127165054 15:56236087-56236109 ATATATAACAAAAAGTTGTGTGG - Intronic
1127422613 15:58822090-58822112 AAATACAACAAAAAATTAGTTGG + Intronic
1127430707 15:58904690-58904712 ACAGACAAAAAAAAATTGGCCGG - Intronic
1127979271 15:64022655-64022677 AAAAATAACAAAAAATTAGCTGG + Intronic
1128070838 15:64795870-64795892 AAATATACAAAAAAATTGGCCGG - Intergenic
1128120892 15:65145303-65145325 ACATGTAACAAGAAAGAGGAGGG - Intergenic
1128661938 15:69507903-69507925 ACACAGAACAAAAAACTAGAGGG - Intergenic
1128988763 15:72241195-72241217 AAATAAAACAATAAAATGGAAGG - Exonic
1129646865 15:77443678-77443700 ACATAAGAAAAAAGATTGGAAGG - Intronic
1129811961 15:78518332-78518354 ACAAATACCAAAAAATTAGCCGG - Intronic
1130392267 15:83467987-83468009 AAATATAACAGAAAATTAGCTGG - Intronic
1130394204 15:83488035-83488057 AAATACAAAAAAAAATTAGACGG - Intronic
1130860898 15:87888599-87888621 GCATTTAACAAAATATTGGTGGG - Intronic
1130992632 15:88885435-88885457 ACAAAAAACAAAAAATTAGCCGG - Intronic
1131034503 15:89212654-89212676 ACATGTATGAAAAGATTGGAAGG + Intronic
1131096515 15:89658286-89658308 ACAAATAAAAAAAAATTAGCTGG + Intergenic
1131142110 15:89985347-89985369 ACAAAAAACAAAAAATTAGCTGG - Intergenic
1131245366 15:90787209-90787231 ACATACAAAAAAAAATTAGCCGG - Intronic
1131916964 15:97277555-97277577 ACATATGACAAATATCTGGAAGG - Intergenic
1202964187 15_KI270727v1_random:158170-158192 ACATATGACAACATATTGGGTGG + Intergenic
1133186766 16:4105516-4105538 ACAAAAAAAAAAAAATTGGCCGG + Intronic
1133263358 16:4567443-4567465 ACATACAAAAAAAAATTAGCCGG - Intronic
1133993108 16:10726249-10726271 ACAAAGAATAAAAAATTGGCCGG - Intergenic
1134460502 16:14425631-14425653 AAAAATAACAAAAAATTAGCAGG + Intergenic
1134530555 16:14979584-14979606 AGATATAACAAGTAATTGGCTGG - Intronic
1135146998 16:19971315-19971337 ACAAAAAACAAAAAATTAGCTGG + Intergenic
1135345527 16:21685556-21685578 AAATAAAATAAAAAATTGTAAGG - Intronic
1135394166 16:22118522-22118544 AAAAATAACAAAAAATTAGCCGG + Intronic
1135556169 16:23438394-23438416 ACAAAAAACAAAAAATTAGCTGG + Intronic
1135566622 16:23516167-23516189 AAATAGAAAAAAAAATTGGCCGG - Intronic
1136263921 16:29102871-29102893 ACAAAAAACAAACAATTGGCTGG + Intergenic
1136473437 16:30497033-30497055 ACATATAATTAAAAATTAGCAGG + Intronic
1137441511 16:48502359-48502381 ACAGCAAACAAAAAATTAGAAGG + Intergenic
1137575539 16:49597521-49597543 ACATTTAAAAAAAAATTAAAAGG - Intronic
1138390359 16:56666193-56666215 AGAAATAACAGAAAAATGGAAGG - Intronic
1139071379 16:63387837-63387859 AAATATAAAAAAAAATTAGCTGG + Intergenic
1139357513 16:66375947-66375969 AAATACAAAAAAAAATTGGCCGG + Intronic
1139567527 16:67788412-67788434 AAATACAACAAAAAATTAGCCGG - Intronic
1139865789 16:70061382-70061404 AGATATAACAAGTAATTGGCCGG + Intergenic
1140508354 16:75488913-75488935 ACATAAAACATAAAGATGGAAGG + Intronic
1140959022 16:79894929-79894951 ACATATAACCAAAAATGGGAGGG + Intergenic
1141128408 16:81417555-81417577 AAAAAAAAAAAAAAATTGGAAGG - Intergenic
1141551273 16:84808232-84808254 ACAAAAAACAAAAAATTAGCCGG - Intergenic
1141719372 16:85747222-85747244 ACATTTATCAAAAAATAAGAGGG + Intronic
1142339842 16:89514480-89514502 ACAAAAAACAAAAAATTAGCAGG - Intronic
1142563506 17:825067-825089 ACAAATAATAAAAAATTAGCTGG + Intronic
1142730199 17:1849265-1849287 ACAGCCAACAAAAATTTGGAGGG - Intronic
1142935296 17:3325196-3325218 AAAAAAAAAAAAAAATTGGAAGG - Intergenic
1143394822 17:6584961-6584983 ACAAAAAACAAAAAATTAGCTGG - Intronic
1143557760 17:7672961-7672983 ATAAATAACAAAAAATTAGCTGG + Intronic
1143605005 17:7978383-7978405 AAATACAAAAAAAAATTGGTCGG + Intergenic
1143990200 17:10952721-10952743 AAAAATAACAAAAAATTAAAGGG - Intergenic
1144223643 17:13123112-13123134 AAAAATAACAAAAAATTAGCCGG - Intergenic
1144647137 17:16982820-16982842 AAATACAAAAAAAAATTGGTTGG - Intergenic
1144935538 17:18895373-18895395 AAATATAACAAAATATGGGCTGG - Intronic
1145054997 17:19696708-19696730 ACAAAGTACCAAAAATTGGATGG - Intronic
1145083662 17:19917101-19917123 AAAAATAACAAAAAATTAGCTGG + Intronic
1145114987 17:20200917-20200939 AGATATAACAAAAATATGGCTGG + Intronic
1145290322 17:21539695-21539717 ATATATAATAAATATTTGGAGGG - Intronic
1146233774 17:31137975-31137997 ACAAATAAAAAAAAATTCCAAGG - Intronic
1146976153 17:37114023-37114045 ACAAATAATAAAAAATTAGCTGG + Intronic
1147501269 17:40966042-40966064 ACACACAAAAAAAAATTAGATGG - Intronic
1147773960 17:42887305-42887327 AAATATAAAAAAAAATTAGCTGG + Intergenic
1147811516 17:43173277-43173299 AAATAAAATAAAAAACTGGACGG - Intronic
1148005700 17:44427571-44427593 ACAAATAATAAAAAACTGGGTGG + Intronic
1148030837 17:44619699-44619721 AAATAAAAAAAAAAATTGGCTGG - Intergenic
1148032579 17:44631635-44631657 AAAAATAACAAAAAATTAGCTGG - Intergenic
1148182669 17:45618178-45618200 AAAAATAACAAAAAATTAGTCGG + Intergenic
1148266189 17:46227517-46227539 AAAAATAACAAAAAATTAGTCGG - Intergenic
1148273454 17:46282262-46282284 AAAAATAACAAAAAATTAGGCGG - Intronic
1148636895 17:49155882-49155904 ACACACAAAAAAAAATTGGCCGG - Intronic
1149115264 17:53086461-53086483 ACAAAGTACAAAAAACTGGAGGG - Intergenic
1149717993 17:58812713-58812735 ACAAAAAACAAAAAATTAGCTGG - Intronic
1149758379 17:59207216-59207238 ACAAAAAACAAAAAATTAGCCGG + Intronic
1150024061 17:61653093-61653115 ACTTTTAACAAAAAATTATAAGG + Intergenic
1150409606 17:64932303-64932325 AAAAATAACAAAAAATTAGGCGG + Intergenic
1150631053 17:66880726-66880748 ACAAAAAACAAAAAATTCCAGGG - Intronic
1150654253 17:67029470-67029492 AAATACAAAAAAAAATTGGCTGG + Intronic
1150991944 17:70269886-70269908 AAATTTAACAAAAAATAGCATGG + Intergenic
1151235022 17:72713621-72713643 ACACATAAAAAAAACTGGGAGGG + Intronic
1151317757 17:73334570-73334592 AGATATAACAAAAAATTATGGGG - Exonic
1151642981 17:75410011-75410033 ACATAACACAAAAAATTAGCTGG - Intergenic
1151653136 17:75482182-75482204 AAATATAAAAAAAAATTAGCCGG + Intronic
1151659847 17:75513281-75513303 AAATATAAAAAAAAATTAGCCGG + Intronic
1151695006 17:75710392-75710414 ACAAATAAAAAATAATTGGCTGG + Intergenic
1151697697 17:75726289-75726311 ACATAAAATAAAAAATTAGCTGG + Intronic
1151987640 17:77554325-77554347 AAATACAAAAAAAAATTGGCTGG - Intergenic
1152226099 17:79093550-79093572 AAAAAAAAAAAAAAATTGGAGGG + Intronic
1153104764 18:1513724-1513746 AGATGAAACAGAAAATTGGAAGG - Intergenic
1153225485 18:2896634-2896656 ATAAATAACAAAAAATTAGCTGG - Intronic
1153266622 18:3276872-3276894 ACAAAAAACAAAAAATTAGCAGG + Intronic
1153286334 18:3458220-3458242 AAAAATAACAAAAAAAGGGAAGG - Exonic
1153531047 18:6046131-6046153 ACAGTTAAAAAAAAAGTGGATGG + Intronic
1153546658 18:6213572-6213594 ACTTATAACACAAAATTAGCTGG - Intronic
1153574014 18:6502790-6502812 ATGTATAGCAAAAAATTGGAAGG + Intergenic
1154088334 18:11329593-11329615 ACATAAAATAAAAAATTAGCTGG - Intergenic
1154363391 18:13684235-13684257 AAATATAAAAAAAAATTAGCCGG + Intronic
1154456618 18:14533757-14533779 ACATATGACAACATATTGGGTGG + Intronic
1154964172 18:21340256-21340278 AAATATAAAAAAAAATTAGCCGG + Intronic
1155229822 18:23762052-23762074 ACAAATAATTAAAAATTGGCTGG + Intronic
1155452932 18:25981730-25981752 ACATACAAAAAAAAATTAGCTGG + Intergenic
1156066774 18:33151276-33151298 AAAAATAACAAAAAATTAGGTGG + Intronic
1156137323 18:34058293-34058315 AAAAATAACAAAAAATTAGCCGG - Intronic
1158128440 18:54127002-54127024 ACAAATAACTAAAAATTTGCTGG - Intergenic
1158455622 18:57604725-57604747 ACAAATAATAAAAAATTAGCTGG + Intronic
1159028484 18:63208083-63208105 ACAAATAAAACAAAATTGGTTGG - Intronic
1159556536 18:69951592-69951614 ACATATTACATAGAATTGCAAGG + Intronic
1159772450 18:72562044-72562066 ACATAAAACAATAAATTTGGAGG - Intronic
1159798919 18:72872925-72872947 AAATATAAAAAAAAATTGTGCGG - Intergenic
1159901175 18:74047271-74047293 TCATATAAAAAAAAAGTGGTTGG - Intergenic
1160264914 18:77333852-77333874 AAATATAACAAAAAAATTGCAGG - Intergenic
1160325282 18:77940887-77940909 ACATAAAAAAAAAAAATAGAAGG - Intergenic
1160328843 18:77974089-77974111 ACAAATTACCAAAAAATGGATGG + Intergenic
1160476158 18:79190297-79190319 ACATTTAAAAAAAAATTCTAGGG + Intronic
1160489079 18:79321689-79321711 ACAAATTAAAAACAATTGGATGG + Intronic
1160955555 19:1690055-1690077 AAATATAAAAAAAAATTAGCCGG - Intergenic
1161147556 19:2688089-2688111 AAAAATAACAAAAAATTAGCCGG + Intronic
1161385932 19:3992919-3992941 ACAAAAAATAAAAAATTGGCCGG - Intergenic
1161418687 19:4163144-4163166 AAAAATAACAAAAAATTAGCCGG + Intronic
1161599931 19:5175512-5175534 ACATTTAAAAAAATATTAGATGG - Intronic
1161634858 19:5381561-5381583 AAATACAAAAAAAAATTGGCCGG - Intergenic
1161829795 19:6594365-6594387 ACAAAAAGCAAAAAATTGAAAGG + Intronic
1161922893 19:7279811-7279833 CCAAAAAAAAAAAAATTGGATGG + Intronic
1162436583 19:10663664-10663686 AAAAATACAAAAAAATTGGACGG - Intronic
1162653203 19:12107432-12107454 AAATATAAAAAAAAATTAGCTGG + Intronic
1162908100 19:13835328-13835350 AAACATAAAAAAAAATTGGCCGG + Intergenic
1162953770 19:14087278-14087300 AAATATAAAAAAAAATTAGCTGG - Intergenic
1162981456 19:14242925-14242947 AAAAATAACAAAAAATTAGCTGG + Intergenic
1163231996 19:16010247-16010269 AAATATAAAAAAAAATTAGCTGG + Intergenic
1163279830 19:16308896-16308918 AAATATAAAATAAAATTGGCCGG + Intergenic
1163342538 19:16718674-16718696 ACAAAAAACAAAAAATTAGCTGG - Intergenic
1164870245 19:31637329-31637351 TCATATAAGAAAATATTGGCCGG - Intergenic
1165213286 19:34252316-34252338 AAATACAACAAAAAATTAGCCGG - Intergenic
1165479183 19:36052012-36052034 ACAAACAAAAAAAAAATGGAGGG - Intronic
1165808857 19:38598325-38598347 ATATATAACAATAAATAGGCCGG - Intronic
1166292172 19:41870241-41870263 TCAAAAAAAAAAAAATTGGAGGG + Intronic
1166500146 19:43334312-43334334 ACATACATGAAAAAATAGGATGG - Intergenic
1166548047 19:43646096-43646118 AAAAATAAAAAAAAATTGGCTGG - Intronic
1167164923 19:47792284-47792306 AAAAATAAAAAAAAATTGGCTGG + Intergenic
1167259007 19:48447233-48447255 CCAAAAAACAAAAAATTAGAAGG - Intronic
1167540632 19:50085057-50085079 AAAAAAAAAAAAAAATTGGATGG + Intergenic
1167629085 19:50612756-50612778 AAAAAAAAAAAAAAATTGGATGG - Intergenic
1167830887 19:52021579-52021601 ACAAAGAACAAAAAATTAGCTGG + Intronic
1168422745 19:56215802-56215824 ACAAAAAAAAAAAAATTGTAAGG - Intergenic
926253226 2:11168121-11168143 ATATATAAAAAAAAATTAGCCGG + Intronic
926480609 2:13388831-13388853 GAATATAACAAAAAAATGGATGG - Intergenic
926732235 2:16044616-16044638 TCATATAATAAACTATTGGAAGG + Intergenic
927540465 2:23906177-23906199 AAATACAAAAAAAAATTGGCCGG + Intronic
927635337 2:24811440-24811462 ACAAAAAACAAAAAATTAGCTGG - Intronic
928132291 2:28661273-28661295 AAAAAAAAAAAAAAATTGGAAGG + Intergenic
928408083 2:31030533-31030555 ACATAAAGCAAAAAAGTGGGTGG + Intronic
928508103 2:31974872-31974894 AAATTTAAAAAAAAATTGGCAGG + Intronic
928568087 2:32574273-32574295 AAAGATAACAAAAAATTAGCTGG - Intronic
928705510 2:33945607-33945629 AAATAAAAAAAAAAATTAGATGG + Intergenic
929276812 2:40034756-40034778 ACATATAACCCAAGAGTGGAGGG + Intergenic
929306426 2:40368062-40368084 ACAGATCACAAAAAGTTGGGAGG - Intronic
929352631 2:40976933-40976955 ATTTATAATAAAAAACTGGAGGG + Intergenic
929764591 2:44833489-44833511 ACATGCAAGACAAAATTGGAGGG + Intergenic
929880244 2:45830083-45830105 AAAAAAAAAAAAAAATTGGAAGG + Intronic
930428175 2:51237966-51237988 AAATATAAGAAGAAATTGGTTGG - Intergenic
930676613 2:54208133-54208155 ACACATACAAAAAAATTAGAGGG - Intronic
931109533 2:59095722-59095744 ACACATAACAAAAATTAGCAAGG - Intergenic
931267571 2:60674144-60674166 ACAAAAAACAAAAAATTAGCTGG + Intergenic
931326720 2:61233351-61233373 ACAAATGACAAAAAATGGCATGG + Intronic
931501844 2:62877175-62877197 ACAGAAAACAAAAAAGAGGAGGG + Intronic
931510713 2:62989784-62989806 ACATATGAAAAAAATTTGGGGGG - Intronic
931778690 2:65561826-65561848 ATATATGACAATAAATTGTATGG + Intergenic
932025789 2:68131075-68131097 AAATATAAAAAAAAATTTGCTGG - Exonic
932299424 2:70655641-70655663 ACTTATAACACAAAATTTGCCGG - Intronic
932957654 2:76373062-76373084 AAAAATTACAAAAAATTGAAAGG - Intergenic
933016212 2:77130805-77130827 AAATAGAACAAATAATTGGCCGG - Intronic
933473242 2:82755195-82755217 ACATGTAACAAAATATTGTTAGG + Intergenic
933612135 2:84447593-84447615 ATATATAACAAAAAACAGGCTGG + Intronic
934097183 2:88617593-88617615 AAATATAAAAAAAAATTAGCCGG + Intronic
934876320 2:97924219-97924241 AAAAAATACAAAAAATTGGATGG + Intronic
935170146 2:100604720-100604742 ACATTTAAAAAAAAATTATATGG - Intergenic
935423083 2:102890981-102891003 ACATATACCAATAATTTGAAAGG + Intergenic
935519295 2:104084254-104084276 ACACGTAACAAAAAAGTGTAAGG - Intergenic
935536361 2:104299373-104299395 AAATAAAACAAAAAATAGGCCGG + Intergenic
935832682 2:107017086-107017108 AAATATAAAAAAAAATTAGCTGG - Intergenic
936003071 2:108853686-108853708 ACAAAAAATAAAAAATTAGATGG - Intronic
936054319 2:109249816-109249838 AAATAAAACAAAAAATTAGCCGG - Intronic
936148096 2:109995276-109995298 AAATATAAAAAAAAAGTTGAAGG + Intergenic
937174947 2:119921123-119921145 ACAAAAAACAAAAAATTAGCTGG + Intronic
937183332 2:120015163-120015185 AAAAATAACAAAAAATTAGCCGG + Intronic
937201062 2:120204804-120204826 AAATGTAAGAAAAAAATGGATGG - Intergenic
937535918 2:122886803-122886825 ACAAATTACAACAAATTTGATGG - Intergenic
938316642 2:130333970-130333992 ACAAATAACTAAAACGTGGAAGG + Intergenic
938400785 2:130989640-130989662 ACAGAAAACAAAAATCTGGAAGG - Intronic
938832831 2:135070667-135070689 ACTAAAAACACAAAATTGGACGG - Intronic
939075165 2:137592271-137592293 ACAAAATACAAAAAATTTGAGGG - Intronic
939529360 2:143337734-143337756 AAACATAAAAAAAAAGTGGAAGG + Intronic
939530412 2:143353098-143353120 ACATTTTAAAAAAAATTAGAAGG + Intronic
939711426 2:145525169-145525191 ATATATAATATAAAAATGGATGG - Intergenic
939754353 2:146091797-146091819 ATATGTTACAATAAATTGGAAGG + Intergenic
939884894 2:147670909-147670931 ACATACAACAAGGAGTTGGAAGG - Intergenic
940050153 2:149453846-149453868 ATAAATGAAAAAAAATTGGAGGG - Intronic
940288184 2:152052818-152052840 AAATACAAAAAAAAATTGGCTGG + Intronic
941028044 2:160480009-160480031 ACATTTAAGAAAAGATTTGAAGG + Intronic
941247879 2:163123616-163123638 ACATTCAACAAAAAATTACAAGG - Intergenic
941297577 2:163759368-163759390 CCATATTACATATAATTGGATGG - Intergenic
941608317 2:167628687-167628709 AAAGATAACAAAAAAGTGGAGGG + Intergenic
941662703 2:168211604-168211626 AAATATAAGAATAAATTGGAAGG - Intronic
941790800 2:169549624-169549646 ACAAAAAACAAAAAATTAGCTGG - Intronic
942029022 2:171939931-171939953 ACACATAATAAAAAATTAGCTGG - Intronic
942057210 2:172195687-172195709 ACGTATGACAAAAACATGGAGGG - Intergenic
942348313 2:175026627-175026649 ATAGATGACAAAAAACTGGAAGG + Intergenic
942587070 2:177492085-177492107 ACATATATCAGAAAATGGGAGGG - Intronic
943082494 2:183272205-183272227 ACATATAAAAATAAAATGGTAGG - Intergenic
943202145 2:184842080-184842102 ATTTACAACTAAAAATTGGATGG - Intronic
943205830 2:184894027-184894049 AAAAATGATAAAAAATTGGAAGG - Intronic
943241416 2:185389293-185389315 ACAAATAAAAAATAATTTGAGGG + Intergenic
943415388 2:187595991-187596013 AAATATTACTAAAATTTGGAAGG + Intergenic
943495485 2:188615526-188615548 AAATATTACAAAAAATTGAAGGG - Intergenic
943813030 2:192213185-192213207 ACATTTAGGAGAAAATTGGAGGG - Intergenic
943894995 2:193346577-193346599 ACAAATAAAAAAAAATTATATGG + Intergenic
944063916 2:195599097-195599119 ACATATATCAATAAATTTGTAGG - Intronic
944175225 2:196821313-196821335 ACAAATTACCAAAAACTGGATGG - Intergenic
944283929 2:197926471-197926493 GCTCATAACAAAAAATGGGATGG - Intronic
944405788 2:199381870-199381892 ACATTGAACAAACAATGGGAAGG - Intronic
944472615 2:200071165-200071187 TCAAATAACATAAAATTGGGTGG + Intergenic
944569557 2:201029923-201029945 GCATATAAAAAAAAATTAGCTGG + Intronic
944577647 2:201105040-201105062 ACAAATAATAAAAAATTAGCTGG + Intergenic
944607560 2:201365947-201365969 ACAGAAAACAAAAAATGGGTAGG + Intergenic
945071299 2:205991692-205991714 AAATAAAAAAAAAAATTGGCTGG + Intergenic
945150898 2:206790050-206790072 AAATATAACGAAAATGTGGAAGG - Intronic
945171276 2:206998287-206998309 ATATATAAAAAAAAATTTAAAGG + Intergenic
945405371 2:209441374-209441396 GTATATAACAAAAAATTTAAAGG - Intronic
945441503 2:209885437-209885459 AGATAAAAGAAGAAATTGGAAGG + Intronic
945555243 2:211267666-211267688 AAATAAAGCAAAAAATTAGAAGG - Intergenic
945567362 2:211417314-211417336 AAATATAAAAAAAAATTAGCTGG + Intronic
945719483 2:213401764-213401786 ACATAAAGCAAAAAATAAGATGG - Intronic
945834994 2:214829021-214829043 ACATATAACAAAGTTTAGGAAGG - Intergenic
945903068 2:215559997-215560019 ACATGTCACTAAAAATTGGCTGG + Intergenic
946011256 2:216565442-216565464 AAAAATAACAAAAAATTAGCTGG - Intronic
946648902 2:221869960-221869982 AAAAAGAAAAAAAAATTGGAAGG - Intergenic
946824316 2:223660996-223661018 ACATACAAAAAAAAATTAGCTGG + Intergenic
947234900 2:227930528-227930550 AAAAATAACAAAAAATTAGCTGG - Intergenic
947415700 2:229893212-229893234 AAATACATCAAAAAATAGGATGG - Intronic
947434266 2:230059374-230059396 ACATATAACAAATAATTTCATGG + Intronic
947974201 2:234350554-234350576 AAATATAAAAAAAAATTAGCTGG - Intergenic
948919608 2:241056740-241056762 AAATATAAAAAAAAATTAGCCGG - Intronic
949016324 2:241713530-241713552 AAAAATAAAAAAAAATTGGCTGG - Intronic
1169163019 20:3398505-3398527 GCATTAAAAAAAAAATTGGATGG + Intronic
1169515154 20:6308963-6308985 AAATATACCCAGAAATTGGATGG + Intergenic
1169997675 20:11576775-11576797 ACATTGAACAAAATATTTGAAGG - Intergenic
1170411963 20:16101813-16101835 AAATTTAAAAAAAAATTAGAGGG + Intergenic
1170988079 20:21276381-21276403 ACAAAAAACAAAAAATTAGCTGG + Intergenic
1171347402 20:24476506-24476528 AAAAATAACAAAAAATTAGCCGG + Intronic
1171537510 20:25908810-25908832 AAATAAAACAAAAAATTAGCTGG - Intergenic
1171725435 20:28615891-28615913 ATGTAATACAAAAAATTGGAAGG - Intergenic
1171752631 20:29067192-29067214 ATGTAATACAAAAAATTGGAAGG + Intergenic
1171789638 20:29510381-29510403 ATGTAATACAAAAAATTGGAAGG - Intergenic
1171840459 20:30204144-30204166 AAATAAAACAAAAAATTAGCTGG - Intergenic
1172101600 20:32487104-32487126 ACTAAAAACACAAAATTGGACGG + Intronic
1172143374 20:32739858-32739880 AAATACAAGAAAAAATTAGATGG + Intronic
1172159228 20:32853968-32853990 AAAAATACCAAAAAATTGGCCGG - Intergenic
1172282377 20:33717191-33717213 AAATAAAATAAAAAACTGGAAGG + Intronic
1172399315 20:34635890-34635912 ACAGATAATAAAAAATAGGCTGG + Intronic
1172579598 20:36036421-36036443 AAATATAAAAAAAAATTAGCTGG + Intergenic
1173303288 20:41823539-41823561 ACATAAAACAGAAAAATGAATGG - Intergenic
1173695758 20:45010363-45010385 ACATATAATAAATAATTGGGAGG - Intronic
1173786045 20:45793401-45793423 AAAAATAACAAAAAATTGGCCGG + Intronic
1173982223 20:47233369-47233391 ACAAATAAAAAAAAATTAGCTGG - Intronic
1174343301 20:49911503-49911525 AAATTTAAAAAAAAATTAGACGG + Intronic
1174421666 20:50403106-50403128 ACAAAAAACAAAAAATTAGCTGG + Intergenic
1174457674 20:50661239-50661261 AAATAAAAAAAAAAATTGTAGGG + Intronic
1174850218 20:53986733-53986755 ACAAATAATAAAAAATTAGCTGG + Intronic
1174900010 20:54489589-54489611 ATATTTAACAAAAAAAAGGAAGG - Intronic
1175003187 20:55652437-55652459 AAATACAACAAAAAATTAGTCGG + Intergenic
1175562593 20:59943887-59943909 ACATATGACAAAAAATGGTCTGG - Intronic
1175589753 20:60179662-60179684 ACAATTAAAAAAAAATTGGAAGG - Intergenic
1175725534 20:61315863-61315885 ACAAAAAACAAAAAATTAGCTGG - Intronic
1176658569 21:9612681-9612703 AAAAAAAAAAAAAAATTGGAAGG - Intergenic
1176817548 21:13619577-13619599 ACATATGACAACATATTGGGTGG - Intronic
1177081831 21:16649229-16649251 AAATAAAAAAAAAAATTGGAAGG - Intergenic
1177163605 21:17575650-17575672 AAATATAAAAAAAAATTAGCTGG - Intronic
1177165984 21:17604281-17604303 AAATATAAAAAAAAATTAGCCGG + Intronic
1177166359 21:17609251-17609273 AAATACAAGATAAAATTGGAAGG - Intronic
1177271458 21:18853379-18853401 AAATGAGACAAAAAATTGGAAGG + Intergenic
1177409088 21:20706819-20706841 AAATACAAAAAAAAATTGGCTGG + Intergenic
1177474286 21:21598464-21598486 ACATAGAATCAAAATTTGGATGG - Intergenic
1177774459 21:25552459-25552481 AAATTTAAAAAAAAATTGGTTGG + Intergenic
1178026986 21:28479288-28479310 TCCTCTACCAAAAAATTGGAAGG + Intergenic
1178215841 21:30597545-30597567 AAATATAAAAAAAAATTAGCCGG - Intergenic
1178774308 21:35534592-35534614 TCAGGTAACAAAAAGTTGGAAGG + Intronic
1178993477 21:37375684-37375706 AAAAATAACAAAAAATTAGTCGG - Intronic
1179220569 21:39403485-39403507 AAAAATAACAAAAAATTAGCCGG - Intronic
1179578946 21:42326285-42326307 ACAAAAAACAAAAAATTAGCTGG + Intergenic
1180139497 21:45884093-45884115 AAATATAAAAATAAATTGGCTGG - Intronic
1181121889 22:20674160-20674182 ACATTTAGCATAAAATTAGATGG + Intergenic
1181334707 22:22118772-22118794 ACATTTAGCATAAAATTAGACGG - Intergenic
1181995738 22:26880627-26880649 ACTTATAAAAAATAATTGGTGGG + Intergenic
1182021940 22:27088897-27088919 ACATTTAACAAAACACAGGAAGG + Intergenic
1182080961 22:27528412-27528434 ACCTAGAACAAAAGACTGGAAGG + Intergenic
1182177419 22:28305150-28305172 AAAAATAACAAAAAATTAGCTGG - Intronic
1182200277 22:28561233-28561255 AAATACAAAAAAAAATTGGCCGG - Intronic
1182730662 22:32488969-32488991 AAAAATAAAAAAAAATTGGCTGG - Intronic
1183428799 22:37753434-37753456 AAATACAAAAAAAAATTAGATGG - Intronic
1184168464 22:42744364-42744386 AAATAAAATAAAAAATTAGACGG + Intergenic
1184397528 22:44252129-44252151 ATAAATAATAAAAAGTTGGAGGG + Intronic
1184580207 22:45412174-45412196 AAATATAAAATAAAATTGGCCGG - Intronic
949090072 3:16973-16995 ACTTATAACTAAAAATTCAAGGG - Intergenic
949250158 3:1973845-1973867 AAAAATAACAAAAAAATGGCCGG + Intergenic
949361482 3:3236805-3236827 ACAAATTACAAAAGAGTGGAAGG + Intergenic
949371427 3:3338660-3338682 ACAAATAAAAAAAAATTAGCTGG + Intergenic
949576685 3:5345366-5345388 AAAAATTACAAAAAATTGGCTGG + Intergenic
950041472 3:9922245-9922267 ATATATAAAAACAAATTGGCCGG - Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950390757 3:12694676-12694698 AAAAATAAAAAAAAATTAGATGG - Intergenic
950584807 3:13884517-13884539 ACATATCACAACAAATTAGTGGG + Intergenic
950875523 3:16268133-16268155 ACATATTTCAAAAAATTAGTAGG + Intronic
950885654 3:16360330-16360352 ACAAATAATAAAAAATTAGCTGG - Intronic
951245253 3:20333481-20333503 ACATATAACACAGAAGTGTATGG - Intergenic
951764793 3:26185589-26185611 ACAAAAAATAAAAGATTGGATGG - Intergenic
951810302 3:26691306-26691328 ACTTCTACCAACAAATTGGAGGG + Intronic
951995763 3:28726752-28726774 ATATTTAAAATAAAATTGGAAGG - Intergenic
952153281 3:30615886-30615908 ACAAAAAACAAAAAACTGGCCGG - Intronic
952836063 3:37603238-37603260 AAATATTCCAAAAAAATGGATGG + Intronic
953154443 3:40356447-40356469 AAAAATAAAAAAAAATTGGCTGG - Intergenic
953314904 3:41917823-41917845 ACAAAAAACAAAAAATTAGCCGG + Intronic
953485252 3:43288230-43288252 AAATTTAAAAAAAAATTGAAAGG - Intronic
953586277 3:44204063-44204085 CCATATTACAGAAAATTGGATGG + Intergenic
953803241 3:46045259-46045281 AAATACAAAAAAAAATTGGTGGG + Intergenic
953963505 3:47284068-47284090 ACAAATAATAAAAAATTGTCTGG + Intronic
953998522 3:47538402-47538424 ACAAAAAATAAAAAATTGGCCGG + Intergenic
954288359 3:49635653-49635675 ACATTCAACAAAAAGATGGATGG - Intronic
954532637 3:51334000-51334022 ACAAAAAACAAAAAATTAGCCGG - Intronic
954650060 3:52155568-52155590 ATATATAAAATAAAATTTGAAGG + Intergenic
955185448 3:56710799-56710821 ACATATAAAAAAAAAATTGCTGG - Intergenic
955539873 3:59963102-59963124 ACACATAAAAAAAAATTTGCTGG + Intronic
955940194 3:64139933-64139955 ACTTATATCATACAATTGGATGG + Intronic
956271664 3:67454400-67454422 ATATATAAAAAAAAAATAGAAGG + Intronic
956419657 3:69073795-69073817 ACAGAAAACAAAAAATTAGCCGG - Intronic
956425696 3:69132322-69132344 GCATAGAAAAAAAGATTGGAAGG + Intergenic
956812886 3:72881553-72881575 GCATGTAACAAAAAATTGCATGG - Intergenic
957029739 3:75226661-75226683 ACTTATAACTAAAAATTCAAGGG - Intergenic
957518740 3:81291216-81291238 ACATATAATAATAAATTTTAGGG + Intergenic
958089149 3:88853919-88853941 ACATATAGCAGAAAGTGGGAAGG - Intergenic
958443693 3:94188616-94188638 ACATATAAAAAAAAACTTGATGG - Intergenic
958912754 3:100012932-100012954 ACATAAAATAAAAAATTGGTTGG - Intronic
959080464 3:101795567-101795589 ATATCTAGCAAAAGATTGGAGGG + Intronic
959814204 3:110656386-110656408 ACATATAAATAAAAATTCCAAGG + Intergenic
959872505 3:111344347-111344369 ACAAACAACCAAAAATTGGAAGG - Intronic
959931646 3:111990379-111990401 ACATATAGACAAATATTGGAAGG + Intronic
960074717 3:113471699-113471721 ATATATAACTAAAAATGGGAAGG + Intronic
960083568 3:113567044-113567066 ACTAATAAAAAAAACTTGGAAGG + Intronic
960203212 3:114863195-114863217 ACATATATCCATAAAGTGGAGGG + Intronic
960361090 3:116712472-116712494 AAAGATATCAACAAATTGGATGG + Intronic
960430969 3:117568159-117568181 AAATAAAAGAAAAAAATGGAGGG + Intergenic
960466174 3:117998456-117998478 AGATATTACAAACAGTTGGAAGG - Intergenic
961234214 3:125350320-125350342 AAATACAAAAAAAAATTAGATGG - Intronic
961676691 3:128571920-128571942 ACATATAACAATAAAATTGCTGG - Intergenic
961688431 3:128651209-128651231 AAATATAAAAAAAAATTAGCCGG - Intronic
961691107 3:128670384-128670406 AAATATAAAAAAAAATTAGCCGG - Intronic
962038395 3:131678967-131678989 AACTATTTCAAAAAATTGGAGGG - Intronic
962165619 3:133044793-133044815 ACATTTAAGAAAAAATTAGCTGG + Intronic
962704077 3:138026651-138026673 ACAAACAAAAAAAAATTAGAAGG + Intronic
962857600 3:139363031-139363053 ACAGATGACAGAAAGTTGGAAGG - Intronic
962871918 3:139504332-139504354 ACATAAAACTAAAAATAGAATGG - Intergenic
963071690 3:141310086-141310108 AAATAAAAAAAAAAATTGGCCGG - Intergenic
963342966 3:144059506-144059528 ACATATAACTAAAAAATGATAGG + Intergenic
963719704 3:148848087-148848109 CAATATAAGAAAAAGTTGGAAGG - Intronic
963993430 3:151679688-151679710 ACAAAAAAAAAAAAATTAGACGG + Intergenic
964027004 3:152086649-152086671 ACATATATAAAATAATTGAATGG - Intergenic
965097111 3:164244456-164244478 GAATATAACAAAAAGGTGGAGGG - Intergenic
965454240 3:168877722-168877744 AAATACCCCAAAAAATTGGAAGG - Intergenic
965818211 3:172658492-172658514 ACACATAGCAAAGTATTGGACGG + Intronic
965924525 3:173961096-173961118 AAATAACACAAAAAATTGGAAGG - Intronic
965935809 3:174109771-174109793 ACATTAAACACAAAACTGGAAGG - Intronic
966355667 3:179075988-179076010 AACTATAACAAAATATAGGAGGG + Intergenic
967053299 3:185804828-185804850 AAATATAAAAAAAAATTAGCTGG + Intronic
967164522 3:186768638-186768660 ATATTTAAAAAAAAAATGGATGG - Intergenic
967558121 3:190883790-190883812 ACATAAAATAAAAAATTAGCTGG - Intronic
967562256 3:190930218-190930240 ACATATTACAAATAACTGAATGG - Intergenic
967667599 3:192191672-192191694 AAAAATAACAAAAAATTAGCCGG + Intronic
967928309 3:194670782-194670804 ACAAATAAAAAAAAATTGCCAGG + Intronic
968058270 3:195709648-195709670 ACATAAAAAAACAAATAGGAAGG - Intergenic
968199832 3:196742753-196742775 AAATACAACAAAAAATTAGCCGG + Intronic
968227609 3:196984887-196984909 AAAAATAACAAAAAATTAGCTGG + Intergenic
968317890 3:197739532-197739554 AAATACAACAAAAAATTAGCCGG + Intronic
968447737 4:660801-660823 GCATAAAACAAATAATTGGATGG + Intronic
969068405 4:4509794-4509816 ACATATAAGAAAATGTTTGAAGG + Intronic
969093676 4:4716564-4716586 ACATATAAAATAAAATGGGCTGG - Intergenic
969909332 4:10428848-10428870 TCAAATAATAAAAAATTGGCTGG - Intergenic
969985310 4:11203060-11203082 ATATATGACAAAACAATGGATGG - Intergenic
970057840 4:11995342-11995364 ACATTTCACAAAACATTGTAGGG - Intergenic
970934109 4:21548654-21548676 ATATACAAAAAAAAAATGGATGG + Intronic
971234997 4:24833283-24833305 CCTTAAAACATAAAATTGGATGG + Intronic
971255611 4:25010918-25010940 ACAAAAAACAAAAAATTAGCTGG + Intronic
971287307 4:25303130-25303152 ATATATAAAAAAAAATTAGCCGG - Intergenic
971499866 4:27307116-27307138 ACATATAATAAAATATTCAAAGG - Intergenic
971549074 4:27926570-27926592 ACATGTAATAAAATATTGAAAGG - Intergenic
971715739 4:30174239-30174261 ACATAGAACAACAAAATGTATGG - Intergenic
972053535 4:34771252-34771274 AAATATAATAAAAAATTAGATGG + Intergenic
972466486 4:39361875-39361897 AAATACAAAAAAAAATTAGATGG + Intronic
972483170 4:39517362-39517384 AAATACAAAAAAAAATTAGATGG - Intronic
973084663 4:46042543-46042565 ACATTTAACAAACATTTGCATGG - Intronic
973147059 4:46840264-46840286 ACATATAAACAAAAATCCGATGG - Intronic
973629902 4:52810734-52810756 ACATATAAAAAAAAATTAGGTGG + Intergenic
974205148 4:58692573-58692595 ACTTATACCAAAAAAGTAGAAGG - Intergenic
974226143 4:59047951-59047973 AGAAATAATAAAAAATGGGAGGG - Intergenic
974724972 4:65787005-65787027 ACTTACAACACAAAATTGTATGG + Intergenic
974820419 4:67060623-67060645 ACAAAAAATAAAAAATTAGAAGG - Intergenic
975032151 4:69634319-69634341 ACATATAAGAAGGAATTGGAAGG + Intronic
975045319 4:69796313-69796335 AAATATAAAAAAAAATTAGCCGG - Intergenic
975124307 4:70764887-70764909 AAATATAGCACAAAATTGGACGG + Intronic
975895204 4:79081129-79081151 CAATAGAACAAAAGATTGGAAGG - Intergenic
976119818 4:81767662-81767684 ATATATAACTAAAAAGTTGAGGG - Intronic
976185443 4:82438489-82438511 ACAAAAAATAAAAAATTGGCTGG + Intronic
976714890 4:88113192-88113214 GAAGATAACAAATAATTGGAAGG + Intronic
977336487 4:95706225-95706247 ACAAAAAATAAAAAATTGGCTGG + Intergenic
977342393 4:95775366-95775388 AAAAATAACAAAAAATTAGCGGG - Intergenic
977740062 4:100468875-100468897 AAATAGAAAAAAAAATTGTATGG + Intronic
977831837 4:101603359-101603381 ACATATATAAAATAGTTGGAGGG + Intronic
978012634 4:103706608-103706630 ACATATAATAAAAAACTGGGGGG + Intronic
978014422 4:103724467-103724489 ACATGTAAAAAGAAATAGGAAGG + Intergenic
978381624 4:108134955-108134977 CCATATGACAAGAAAATGGAAGG + Intronic
978408146 4:108400795-108400817 AAATACAACAAAAAATTAGCCGG + Intergenic
978538937 4:109795035-109795057 ATATATGAGAAAAAATTGAAAGG + Intronic
978978283 4:114908533-114908555 TCATATCACATAAAAATGGAAGG - Intronic
979123094 4:116927472-116927494 ACATATCACAAAAACATTGATGG + Intergenic
979234990 4:118389748-118389770 AGATATAATAAAAAAGTGCAGGG + Intergenic
979488995 4:121302971-121302993 ACATTGAAGAAAAAAATGGAGGG + Intergenic
979842267 4:125457337-125457359 TCATGGAACAAAAAATAGGAAGG + Intronic
979885294 4:126020000-126020022 ACATTTAACAAAAAAGTCAAAGG - Intergenic
979897579 4:126178975-126178997 AAATATAACATTAAATTGGCAGG + Intergenic
980054849 4:128069443-128069465 ATATATAACATAAACTTGGTTGG + Intronic
980618111 4:135260326-135260348 ACAAAAAACTAAAAATTTGATGG - Intergenic
980685831 4:136226624-136226646 ACACAAAACAAAACACTGGAAGG - Intergenic
980727517 4:136784197-136784219 TCATATAAAAATAAATTAGAGGG + Intergenic
981202226 4:141994227-141994249 GCATTTAACAAATAATTGCAAGG - Intergenic
981434075 4:144699342-144699364 GCATAAAACAAGATATTGGAAGG + Intronic
981530558 4:145749793-145749815 AAAAATAACAAAAAATTAGCTGG - Intronic
981801757 4:148666005-148666027 ACTTTCAACAAAAAATTGCAAGG - Intergenic
981975408 4:150722512-150722534 AAATATAACTAAAAATTAGGAGG + Intronic
981992086 4:150933861-150933883 AAATAAAACAAAAAATTAGCTGG + Intronic
982453302 4:155577603-155577625 ACATGTGGCAAAAAATTGCAAGG - Intergenic
982468052 4:155755621-155755643 AAAAATAACAAAAAATTGGCTGG - Intergenic
982577317 4:157130620-157130642 ACAAATAACCAAAATTTGGTAGG - Intronic
982698306 4:158629784-158629806 AAAAATAAAAAAAAATTGGCTGG - Intronic
982931730 4:161416681-161416703 AAAAATAACAAAAAATTAGCCGG + Intronic
983346254 4:166528665-166528687 ACATTTAAGCAAAGATTGGAAGG + Intergenic
983517889 4:168676732-168676754 ACAAAAAAAAAAAAATTAGATGG - Intronic
983784082 4:171710164-171710186 AAATATAAAAAAAAATTAGCAGG - Intergenic
983846972 4:172532496-172532518 ACAAATTACTAAAAACTGGATGG - Intronic
984425377 4:179578498-179578520 TCATATTAAAAAAAATTGCAAGG - Intergenic
984491742 4:180442644-180442666 ATATATAAGAAATAATTAGATGG + Intergenic
984554430 4:181197212-181197234 ACAGATATCAATAAATTAGAAGG - Intergenic
984615152 4:181888877-181888899 AAATAGAACAAAAATGTGGAGGG - Intergenic
984796290 4:183663225-183663247 ACAAAAAACAAAAAATTAGCTGG - Intronic
984972138 4:185201162-185201184 ACAAATAAAAAAAAATTAGCTGG + Intronic
985315598 4:188656201-188656223 AGATTTAAAAAACAATTGGATGG - Intergenic
985422575 4:189799515-189799537 ACATTTAAAAATAGATTGGATGG + Intergenic
985872456 5:2568358-2568380 ACAAATAATAAAAAATTAGCTGG + Intergenic
986058708 5:4165704-4165726 AAAAATAACAAAATATTGGCCGG - Intergenic
987089708 5:14499888-14499910 AAAAATAACAAAAAATTAGCCGG + Intronic
987205429 5:15620392-15620414 ACAAAAAACAAAAAATTAGCTGG - Intronic
987613162 5:20235045-20235067 ACATATTAAAAACAGTTGGATGG + Intronic
987724809 5:21684420-21684442 ATAAATAACCACAAATTGGATGG + Intergenic
987824425 5:23010525-23010547 AAATATAATAAATATTTGGATGG - Intergenic
988222941 5:28372636-28372658 ACTTATGACAAAAAATAAGAAGG + Intergenic
988423596 5:31036381-31036403 AAATAAAACAAAAAACTGGGTGG - Intergenic
988853367 5:35200976-35200998 CCATACAACTAAAAATTGGAAGG - Intronic
989000069 5:36750622-36750644 AAATACAAAAAAAAATTGGCTGG + Intergenic
989237137 5:39161349-39161371 ACATTTAAGAAAATATAGGAGGG + Intronic
989289939 5:39751996-39752018 ACATAGATTAGAAAATTGGAGGG - Intergenic
989601183 5:43202171-43202193 AAAAATAAAAAAAAATTGGGGGG - Intronic
990512488 5:56501241-56501263 AAAAAAAAAAAAAAATTGGAGGG - Intergenic
991279479 5:64895351-64895373 TCATATAAGAAAAAATTTGAGGG + Intronic
991630550 5:68652554-68652576 ACATATTGCAAAATGTTGGAAGG + Intergenic
991659799 5:68939005-68939027 ACATATAATCAAAAAATAGATGG + Intergenic
992130465 5:73686677-73686699 ACATACAAAAAAAAATTTGCCGG - Intronic
992560465 5:77947480-77947502 AAATATAAGCAAAAATTGGGTGG + Intergenic
993206780 5:84891727-84891749 ACTGATAACAAAAAATTCAAAGG - Intergenic
993260531 5:85652710-85652732 ACATAAAAGAAACATTTGGAAGG - Intergenic
993533613 5:89053516-89053538 AAAAAAAAAAAAAAATTGGAGGG + Intergenic
993540669 5:89146821-89146843 ACAGAAAACAAAGAATTGTAGGG - Intergenic
993853114 5:93035843-93035865 ACATATAAAAGAAAAATGTAGGG + Intergenic
993970240 5:94411002-94411024 AAATAAAACAATAAATTGTAGGG + Intronic
994192790 5:96886982-96887004 ACATATAGAAAATATTTGGAAGG - Intronic
994470424 5:100197901-100197923 CTACATAACAAAAAATTGGAAGG - Intergenic
994478553 5:100302381-100302403 ACATATATCAAAAAATCCTATGG - Intergenic
994533450 5:100996732-100996754 AAAAATAACAAAAAATTAGCTGG - Intergenic
994796757 5:104311985-104312007 AAATATAATAAGAAATTGAAAGG - Intergenic
995049940 5:107691343-107691365 AAAAATAAAAAAAAATTAGATGG + Intergenic
995149120 5:108821760-108821782 ACATATATCAAAATATTACAAGG - Intronic
995210867 5:109536647-109536669 ACAGAAAACAAAAAATAAGATGG + Intergenic
995505749 5:112859305-112859327 ACATATAACATAAAAGTGCAAGG - Intronic
995569196 5:113461501-113461523 ACATACAAGAAATAATTAGAAGG + Intronic
995635015 5:114178250-114178272 AAATATAATAAATAAATGGAAGG + Intergenic
995654701 5:114412263-114412285 CAATAAAACAAAAAATAGGATGG + Intronic
995786103 5:115829953-115829975 AAAAATAACAAAAAATTAGGCGG + Exonic
995976734 5:118045824-118045846 AAATAAAAAAAAAAATTAGAAGG + Intergenic
996121301 5:119675313-119675335 AACTATTCCAAAAAATTGGAAGG - Intergenic
996203780 5:120705345-120705367 ATATATAGAAAAAAATTTGAGGG - Intergenic
996433413 5:123405785-123405807 GCTTACAACAAAAAATTGCAAGG + Intronic
996597064 5:125217076-125217098 TCATATAACAAAAATTAGAAAGG + Intergenic
996758827 5:126966309-126966331 ACATATAATAAAAATTTTTAAGG - Intronic
996847368 5:127914875-127914897 GCATACAACAATCAATTGGAAGG + Intergenic
997121567 5:131178798-131178820 AAAGATAACAAAAAATTAGCTGG + Intronic
997140342 5:131373287-131373309 AGATATAATAAAAAAATAGATGG + Intronic
997831949 5:137157898-137157920 AAAAATACCAAAAAATTGGCTGG + Intronic
998090930 5:139368174-139368196 AAATACAACAAAAAATTAGCTGG + Intronic
998121437 5:139581285-139581307 AAAAATAACAAAAAATTAGCCGG + Intronic
998414692 5:141937609-141937631 AAATATAAAAAAAAATTAGTTGG + Intronic
998772534 5:145562778-145562800 ACACAGAAAAAAAAAATGGAAGG + Intronic
998843868 5:146285544-146285566 ACCTCTCACAAACAATTGGATGG + Intronic
998874086 5:146582019-146582041 AAATACAACAATAAATTGGAGGG - Intronic
999405901 5:151306331-151306353 AGATTTAACAATAAATAGGATGG + Intergenic
999654441 5:153798465-153798487 AAACATAACAGAAAATTGTATGG + Intronic
999717220 5:154370993-154371015 ACAGAGAACCAAAAACTGGATGG + Intronic
999937629 5:156504343-156504365 ACATATAACAAAAATTCTCAAGG - Intronic
999939012 5:156520298-156520320 ACAGCTAACAAGAAAATGGAAGG + Intronic
1000317184 5:160103960-160103982 ACAAATACAAAAAAATTAGAAGG + Intronic
1000599098 5:163250704-163250726 ACATGTAAAAAAAAGATGGAGGG + Intergenic
1000695011 5:164369611-164369633 AAAGGTAACAAAAAATTAGAAGG + Intergenic
1000707393 5:164528495-164528517 ATATATAAAAAAAAATTAGCTGG + Intergenic
1001004066 5:168034343-168034365 AAAAAAAAAAAAAAATTGGAGGG + Intronic
1002812722 6:648880-648902 AAATATAACAAAAATTAGGCAGG - Intronic
1002904079 6:1434749-1434771 ACATAAAAAAAAAAATTGCTGGG - Intergenic
1003057031 6:2831064-2831086 AGATTTAACAAAAAATTAGATGG - Intergenic
1004377409 6:15102799-15102821 AAAAAAAAAAAAAAATTGGAAGG - Intergenic
1004395205 6:15241810-15241832 ACATAAAATTAAAAATTAGAGGG - Intergenic
1004404513 6:15319557-15319579 ACATACACAAAAAAATTGGCAGG - Intronic
1004853605 6:19726219-19726241 ACATATAAAATAATATTGGGTGG - Intergenic
1005274934 6:24206732-24206754 ACAAATAAAATAAAATTGAAAGG + Intronic
1005354946 6:24973442-24973464 AAATACAAAAAAAAATTAGATGG + Intronic
1005532892 6:26725335-26725357 ACATAAAAGCAAAAATTGCAAGG + Intergenic
1005537903 6:26776329-26776351 ACATAAAAGCAAAAATTGCAAGG - Intergenic
1005615742 6:27571229-27571251 TGATATAACTAAAAATTTGAAGG + Intergenic
1005690382 6:28299232-28299254 TCATATAACAAAAAGTGTGAAGG + Intronic
1006050025 6:31335113-31335135 ACAAAAGACAGAAAATTGGAAGG - Intronic
1006327861 6:33367388-33367410 ACAGATTACAAAAAGTGGGAAGG + Intergenic
1006756587 6:36421297-36421319 ACAAAAAACAAAAAATTAGCTGG + Intronic
1007899328 6:45395535-45395557 ACATATAACAAAAAATTTAGGGG + Intronic
1007945394 6:45822188-45822210 ACATATAACAGTAAAATGAAAGG - Intergenic
1007979936 6:46142270-46142292 ATATATGAAAAAAGATTGGATGG - Intronic
1008039803 6:46785234-46785256 ATAAATAATAAAAAACTGGAAGG + Intergenic
1008382239 6:50848835-50848857 ACAAAAAACAAAAAATGGGGGGG + Intergenic
1008453452 6:51680348-51680370 TCATATAAGAAAAAATTTCAAGG - Intronic
1009006598 6:57796283-57796305 ACATAGAAGCAAAAATTGCATGG - Intergenic
1009008771 6:57818735-57818757 ACATAGAAGCAAAAATTGCATGG - Intergenic
1009053274 6:58304696-58304718 ACAGATAACAAAAAAGAGTATGG + Intergenic
1009237840 6:61145866-61145888 ACAGATAACAAAAAAGAGTATGG - Intergenic
1009533815 6:64854778-64854800 AGATATAAAAAAAAAATTGAAGG - Intronic
1009748497 6:67851993-67852015 AAATATAAAAAAAAATTATATGG + Intergenic
1010179423 6:73067900-73067922 ATATATAACTAAAATTTGTATGG + Intronic
1010673556 6:78715799-78715821 AAAAATAAAAAAAAATTGGGTGG + Intergenic
1010857257 6:80855279-80855301 AGATAAGAAAAAAAATTGGAAGG + Intergenic
1011211635 6:84961644-84961666 AAAAATTACAAAAAATTGGCTGG - Intergenic
1011519821 6:88193367-88193389 ATATAAAACTAAAAAGTGGAAGG + Intergenic
1011572142 6:88749538-88749560 ACAAATAACACAAAATAAGATGG + Intronic
1012237030 6:96831044-96831066 ACATTTAAAATAAATTTGGAAGG - Intronic
1012283383 6:97358238-97358260 AAATATAAAACAAAATTGGCTGG + Intergenic
1012346415 6:98193044-98193066 AATTATAACAAAAAGGTGGAGGG - Intergenic
1012555887 6:100511254-100511276 ACATAATACAAAAAATTAGCTGG + Intronic
1012890895 6:104896109-104896131 ACATATGGGAAGAAATTGGAGGG - Intergenic
1012906624 6:105074357-105074379 AAAAATAACAAAAAATTAGCCGG - Intronic
1013153597 6:107471365-107471387 ACATATAAAAGACAATTGGCTGG + Intergenic
1013491559 6:110651434-110651456 ACACATAATAAAAAATAGGCCGG + Intronic
1013665173 6:112340286-112340308 AAATATAAAAAAAAATTAGCCGG - Intergenic
1013698919 6:112738940-112738962 AAAAAGAAAAAAAAATTGGAAGG + Intergenic
1013895162 6:115079210-115079232 ACATATAACACTAAGTAGGACGG + Intergenic
1014218765 6:118779187-118779209 AGAAATAAAACAAAATTGGATGG - Intergenic
1014388823 6:120834995-120835017 AATTATAACAAATTATTGGAGGG + Intergenic
1014393774 6:120898177-120898199 ACTTATAACAAGAAATAGGTTGG + Intergenic
1014542089 6:122688940-122688962 AAAAATAAAAAAAAATTAGACGG - Intronic
1014561956 6:122901559-122901581 AAAAATGAGAAAAAATTGGAAGG + Intergenic
1014600990 6:123411914-123411936 ACATTTAAGAAAACATGGGAAGG + Intronic
1014934503 6:127371668-127371690 ATAAATAACAAGAAATTTGAGGG - Intergenic
1014997284 6:128164737-128164759 ACATTTAATAAATTATTGGAGGG + Intronic
1015247635 6:131092448-131092470 ATATATAAAAAAAAGATGGAAGG + Intergenic
1015686135 6:135863685-135863707 AAAAAAAAAAAAAAATTGGAAGG - Intronic
1016173636 6:141051232-141051254 ACAAAAAACAAAAAATTAGCTGG - Intergenic
1017221852 6:151974687-151974709 ACTTATAACAAACATTTGTATGG - Intronic
1017367093 6:153655841-153655863 AAATATAACAAAAAATTAGCTGG + Intergenic
1017551126 6:155508730-155508752 AAATAAATCAAGAAATTGGATGG - Intergenic
1017601878 6:156092412-156092434 ACAAATAAAAAAAAATTAGCTGG - Intergenic
1017638707 6:156469123-156469145 ACATATAATAATAATTTGAATGG + Intergenic
1017736985 6:157374322-157374344 ACAAAAAAAAAAAAATTGGCTGG + Intergenic
1018330773 6:162725600-162725622 AACTATAACAAAAAATTGGCAGG + Intronic
1018783195 6:167087669-167087691 ACAAATAACATAAAATGGGCTGG + Intergenic
1019943785 7:4311000-4311022 AAATAATACAAAAAATTGGCCGG - Intergenic
1019981956 7:4628248-4628270 ACATACAAAAAAAAATTAGCCGG - Intergenic
1020231355 7:6321472-6321494 AAAAATAACAAAAAATTAGCTGG + Intergenic
1020448539 7:8296038-8296060 ACAAAAAACAAAAACATGGATGG + Intergenic
1020627116 7:10595403-10595425 ACATACAAAAAAAAATTAGCCGG + Intergenic
1021252054 7:18341777-18341799 ACATATAATAAAAAATTACCAGG - Intronic
1021397734 7:20171411-20171433 AAATATAAAAAAAAATTAGCTGG - Intronic
1021445643 7:20731052-20731074 ACCTATAAAAAAAAATAAGAAGG + Intronic
1021529548 7:21629012-21629034 ACATATATCAAAAAAGTAGAAGG - Intronic
1021544941 7:21803269-21803291 ACATATTACAAAAAATGCTAAGG + Intronic
1021674403 7:23065586-23065608 AGATGTAACAAAATATTGGCCGG + Intergenic
1021699480 7:23303646-23303668 AAATAAAATAAAAAATTGGCTGG + Intronic
1021727634 7:23564869-23564891 AAATAAAACAAAAAATTAGCTGG - Intergenic
1021889136 7:25170364-25170386 ACAAATAACAAAAAATGCAAAGG - Intronic
1021932568 7:25596232-25596254 ACATGTAAGGGAAAATTGGAGGG + Intergenic
1022870563 7:34473463-34473485 GAAAATAACAAAAAATTGGAGGG - Intergenic
1022984933 7:35643310-35643332 AAATATAACAAAAACATGAAGGG + Intronic
1023111226 7:36812847-36812869 AGAAATAACAAATAATTAGACGG - Intergenic
1023420068 7:39969797-39969819 ACACTTAGCAAAAAATAGGAAGG - Intronic
1024876508 7:54030308-54030330 ACAAAGAAGAAAAAAATGGAAGG + Intergenic
1026270794 7:68834989-68835011 AAATACAAAAAAAAATTAGATGG - Intergenic
1026782513 7:73279012-73279034 AAATACAAAAAAAAATTAGATGG - Intergenic
1027023276 7:74831837-74831859 AAATACAAAAAAAAATTAGATGG - Intronic
1027064654 7:75113467-75113489 AAATACAAAAAAAAATTAGATGG + Intronic
1027749041 7:82117624-82117646 ACAAATAACAGAAAATTAGCTGG + Intronic
1027847762 7:83405111-83405133 ACATATAATAACACATTGTAAGG + Intronic
1027857791 7:83534815-83534837 ACATTAAACAAAGAATTGGCAGG - Intronic
1028612904 7:92732253-92732275 ACAAAAAACAAAAAATTAGTTGG + Intronic
1028783365 7:94763530-94763552 TCATATATCAAAATCTTGGAAGG - Intergenic
1028804834 7:95012967-95012989 ACATATACAAAAAAAATGGAAGG - Intronic
1029088684 7:98031598-98031620 AAAAAAAGCAAAAAATTGGAGGG - Intergenic
1029122822 7:98280066-98280088 AAATATAAAAAAAAATTAGCTGG + Intronic
1029141299 7:98412445-98412467 AAATAAAATAAAAAATTAGATGG - Intergenic
1029196177 7:98807092-98807114 ACAAAAAATAAAAAATTGGCTGG - Intergenic
1029675020 7:102062661-102062683 ACAAAAAATAAAAAATTGGCTGG - Intronic
1029691940 7:102188339-102188361 ACATAAAACAAGAATATGGAGGG - Intronic
1030394425 7:108967589-108967611 AGAAATAAAAAAAGATTGGAAGG - Intergenic
1030485710 7:110164462-110164484 AAATATAACAAAAAAGTGAGTGG - Intergenic
1030546707 7:110905434-110905456 AAATGTAACAAAAAATTGAAGGG - Intronic
1030560880 7:111084415-111084437 ACATTTACCAGACAATTGGAGGG + Intronic
1030780830 7:113597882-113597904 AGATATAAAAAAAGCTTGGAGGG - Intergenic
1030892688 7:115019641-115019663 ACAAATCACAAGTAATTGGAAGG - Exonic
1031320437 7:120319887-120319909 ACAAAAAACAAAAAACTGCATGG - Intronic
1031323303 7:120360792-120360814 AGATATAAGAAAACAATGGATGG + Intronic
1031477013 7:122235797-122235819 ATATATAACAAGAAATACGAAGG + Intergenic
1031505180 7:122573376-122573398 ATACAAAACAAAAAATTGGCTGG + Intronic
1031643629 7:124196253-124196275 ACATAGAACTAAATATTAGAAGG - Intergenic
1031756157 7:125645468-125645490 ATATATAACAAAAATCTGGAAGG - Intergenic
1032055423 7:128680724-128680746 AAAAATAACAAAAAATTAGCCGG - Intronic
1032298397 7:130663898-130663920 AAAGATAACAAAAAATTAGTTGG - Intronic
1032350091 7:131154008-131154030 ATATATTACAAAAAAATGGGGGG + Intronic
1032641828 7:133778423-133778445 ACAGATAATAAAAAATTAGCTGG + Intronic
1032719967 7:134542845-134542867 ATATATAATAAAAATGTGGATGG - Intergenic
1032727463 7:134604179-134604201 ACCTATATCAAATATTTGGAGGG - Intergenic
1033082677 7:138313002-138313024 ACATACAAAAAAAAATTAGCCGG - Intergenic
1033385516 7:140871078-140871100 AAATACAAAAAAAAATTGGCTGG + Intronic
1033877805 7:145843505-145843527 ACAATTAAAAAAAAATTAGATGG - Intergenic
1033994679 7:147330864-147330886 ACAGATGACACAAACTTGGAAGG + Intronic
1034566068 7:151916803-151916825 ACTGAAAACAAAAAATTGGCTGG - Intergenic
1034594310 7:152175305-152175327 AAAAATAACAAAAAATTAGCTGG - Intronic
1035147658 7:156836234-156836256 AGATTTAACAAAAAATAGTAAGG + Intronic
1036027115 8:4921770-4921792 ACATATAAGAAAAAAATGGCTGG - Intronic
1037148231 8:15600579-15600601 ACAGATTAAAATAAATTGGATGG + Intronic
1037685072 8:21131608-21131630 ACATAAAACAAAAAGGTGGGAGG + Intergenic
1037779360 8:21857087-21857109 AAAGATAACAAAGAAGTGGATGG + Intergenic
1038279372 8:26149896-26149918 ACTTTCAACAAAAAATTGCAAGG - Intergenic
1038628280 8:29215703-29215725 ACAAATACCATAAACTTGGAAGG - Intronic
1038957366 8:32482277-32482299 GCATATAACAGGAAATTGGGAGG + Intronic
1039541102 8:38371169-38371191 ACATATGAAAAAATATTGGAAGG + Intronic
1040098923 8:43479772-43479794 ATATATAACAAAATCTTTGAAGG - Intergenic
1040328155 8:46371594-46371616 ACATACAAAAAAAAATTAGCTGG - Intergenic
1040472739 8:47749115-47749137 ACATTTAAAGAAAAATTGGCTGG + Intergenic
1040497247 8:47977102-47977124 AAAGATAACAAAAAATTAGCTGG + Exonic
1040663367 8:49600776-49600798 ACATGTAAGAAAAAAATGGGAGG + Intergenic
1040914293 8:52553343-52553365 ATCTCTAAAAAAAAATTGGAAGG + Intronic
1040938173 8:52803232-52803254 ACATACAAAAAAAAATTAGCTGG + Intergenic
1041071941 8:54133876-54133898 ACATACAAAAAAAAATTAGCGGG + Intergenic
1041153015 8:54955827-54955849 ACATAATACAAAAAATTAGCTGG + Intergenic
1041159217 8:55020595-55020617 ACAGATAACAAAAAATAAAATGG + Intergenic
1041244231 8:55875636-55875658 AAATATAAAAAAAAATTAGCCGG - Intergenic
1041277328 8:56176209-56176231 AAAGATAACAAAAAATTAGCCGG - Intronic
1041431915 8:57791662-57791684 ACAGATAACAGAGACTTGGAAGG + Intergenic
1041490727 8:58429695-58429717 ACATAGAACAAAACAATGGGGGG - Intronic
1041791752 8:61703926-61703948 ACAGATAACAAAAAAACAGAGGG + Intronic
1042486222 8:69348834-69348856 GCATATAACAAAAAATGGTTAGG - Intergenic
1042661470 8:71159273-71159295 ACAAATTACACAAAATAGGAAGG - Intergenic
1042849202 8:73198850-73198872 ACAAAAAACAAAAAACTGAATGG + Intergenic
1042868623 8:73377872-73377894 ACATAAAATAAAAAATTGAATGG - Intergenic
1043235160 8:77855671-77855693 CCATTTAACAAAGAATTGAAGGG - Intergenic
1043861260 8:85319880-85319902 ACAAATAACAAACAAGTGGGAGG + Intergenic
1043947292 8:86268828-86268850 ACAAATAAAACAAAATTTGATGG - Intronic
1044114201 8:88314402-88314424 GCATATAATAAAAAATTGTCAGG - Intronic
1044348217 8:91131568-91131590 ACATATAACAAAAGACATGAGGG - Intronic
1044678964 8:94757948-94757970 AAAAATAACAAAAAATTAGCTGG + Intronic
1045396557 8:101766434-101766456 ATATATAAGAAAAATCTGGAAGG - Intronic
1045526168 8:102942878-102942900 AAAAATAACAAAAAATTAGCTGG - Intronic
1045629440 8:104100781-104100803 ATATATAACAGGAAATTGAATGG - Intronic
1045845635 8:106632775-106632797 AAATACAACAAAAAATTAGCTGG + Intronic
1046007796 8:108506750-108506772 AAATATAACAAAAATTAGGGTGG + Intergenic
1046177113 8:110592021-110592043 AGATATAACAAAAAAGAGAAAGG - Intergenic
1046196265 8:110866739-110866761 AAAAAAAAAAAAAAATTGGAGGG - Intergenic
1046257367 8:111718973-111718995 TGGTAGAACAAAAAATTGGAAGG + Intergenic
1046366735 8:113242158-113242180 CAATAAAACAAAAAATTGTATGG + Intronic
1047078924 8:121437727-121437749 ACCTAGAACAAAAAATTTAAGGG + Intergenic
1047962756 8:130022938-130022960 AAATACAACAAAAAATTAGTCGG + Intergenic
1048349804 8:133607129-133607151 ACAAATAACCAAAAATTAGCTGG - Intergenic
1049650924 8:143769219-143769241 ACAAATAACTAAAAATTAGCTGG - Intergenic
1050491204 9:6189725-6189747 ACAAAAAACAAAAAATTAGCTGG - Intergenic
1050846792 9:10231331-10231353 ACAAAGAAAAAAAAAATGGAAGG + Intronic
1051420702 9:16886537-16886559 AAATATAAAAAAAAATTGGCTGG - Intergenic
1051462670 9:17339993-17340015 AAATAAAATAAAAAATTGGCTGG + Intronic
1051666894 9:19474225-19474247 AAATACAAAAAAAAATTGGCTGG - Intergenic
1052196736 9:25726103-25726125 ATATTTCACAGAAAATTGGAAGG - Intergenic
1052720998 9:32170833-32170855 ACATATAAAAACATACTGGAAGG - Intergenic
1052723375 9:32199996-32200018 ACAGCTAACTAAAAATTGTAAGG + Intergenic
1052907980 9:33853767-33853789 AAAAAAAAAAAAAAATTGGAAGG - Intronic
1053570075 9:39295697-39295719 AAAAATAAAAAAAAATTGGCCGG - Intergenic
1053905880 9:42844383-42844405 ACATACAAACAAAAATTGGCTGG + Intergenic
1054091705 9:60854707-60854729 AAAAATAAAAAAAAATTGGCCGG - Intergenic
1054113120 9:61130297-61130319 AAAAATAAAAAAAAATTGGCCGG - Intergenic
1054127073 9:61323309-61323331 AAAAATAAAAAAAAATTGGCCGG + Intergenic
1055412532 9:76046470-76046492 ATATAAAAGAAAAAATTGGCTGG - Intronic
1056355734 9:85799675-85799697 AAAAATAATAAAAAATTGGCTGG - Intergenic
1056502357 9:87222434-87222456 ACATATAAAAACAAATGGGCTGG + Intergenic
1056536790 9:87535110-87535132 ACAGAAAACAGAAAAATGGATGG - Intronic
1056788163 9:89607148-89607170 AGATCTGAGAAAAAATTGGAAGG + Intergenic
1057204618 9:93163855-93163877 AAAAATAAAATAAAATTGGAGGG + Intergenic
1057709167 9:97421855-97421877 CCATAGAAGAAAAAATTGGCTGG - Intronic
1057809284 9:98245266-98245288 AAAACAAACAAAAAATTGGAAGG + Intronic
1057922744 9:99111465-99111487 AAAAATAACAAAAAATTAGCTGG + Intronic
1058312941 9:103528872-103528894 ACAAATAACAAACAACGGGAAGG + Intergenic
1058535374 9:105954130-105954152 ACATATAAAAAAGAAATGAATGG - Intergenic
1058716109 9:107723306-107723328 TGATAGAACCAAAAATTGGATGG + Intergenic
1059179381 9:112197587-112197609 AAATATAAAAAAAAATTAGCCGG + Intergenic
1059208821 9:112491920-112491942 AAATATAAGAAAAAACTGAAGGG - Intronic
1059720465 9:116954940-116954962 ACATATAACCATTACTTGGAGGG - Intronic
1060905342 9:127299859-127299881 AAATACAAAAAAAAATTGGCTGG - Intronic
1060920387 9:127416640-127416662 ACAAAAAACAAAAAATTAGCTGG + Intergenic
1060983333 9:127806207-127806229 AAAAATACCAAAAAATTGGCTGG + Intronic
1061051169 9:128196384-128196406 ACAAATAACTAAAAATTAGCTGG + Intronic
1061228726 9:129299105-129299127 ACATAAAACAAAAAATAAAATGG - Intergenic
1061988775 9:134146124-134146146 AAATATAAAAAAAAATTAGCCGG - Intronic
1203529812 Un_GL000213v1:129924-129946 ACATATGACAACATATTGGGTGG + Intergenic
1203450957 Un_GL000219v1:115789-115811 ATGTAATACAAAAAATTGGAAGG - Intergenic
1203636298 Un_KI270750v1:116259-116281 AAAAAAAAAAAAAAATTGGAAGG - Intergenic
1185517690 X:713240-713262 AAATATAAAAAAAAATTAGCCGG + Intergenic
1185548836 X:967613-967635 AAATATAAAAAAAAATTAGCTGG + Intergenic
1185895373 X:3853821-3853843 GCAAATAACAAAAACTTGGATGG - Intergenic
1185900490 X:3892245-3892267 GCAAATAACAAAAACTTGGATGG - Intergenic
1185905606 X:3930676-3930698 GCAAATAACAAAAACTTGGATGG - Intergenic
1185942959 X:4341403-4341425 ACATATAACATAAGAGTGCATGG - Intergenic
1185995501 X:4944095-4944117 ACAAACAATAAAAAATTGGTTGG + Intergenic
1186162356 X:6791191-6791213 ACAAAAAACAAAAAATTGACTGG + Intergenic
1186409042 X:9329644-9329666 ACAGATAACGGAAACTTGGAAGG - Intergenic
1186496032 X:10013990-10014012 CCATTTTACAAAAAATTGGAAGG + Intergenic
1186503392 X:10070603-10070625 ACATATCAGAAAAACTTGGCAGG + Intronic
1187018457 X:15354128-15354150 AAATATAAAAAAAAATTAGCCGG - Intronic
1187091052 X:16097133-16097155 TCATATAAGAATAAATTTGAGGG - Intergenic
1187666026 X:21610214-21610236 ACACATACCAAGAAATTAGATGG - Intronic
1187692584 X:21884868-21884890 ACATAAAAAAATAACTTGGAGGG + Exonic
1188253778 X:27933890-27933912 ACAGATAAAAAAGAATAGGAAGG + Intergenic
1188282009 X:28281679-28281701 ACATAGAAGAAAAAAATTGAAGG - Intergenic
1188303340 X:28532076-28532098 AAATATAACCAAAAAATGGAAGG + Intergenic
1188637086 X:32447250-32447272 AAATATAACAAAGAATGGGAAGG - Intronic
1189018395 X:37308696-37308718 ACATACAAAAAAAAATTAGCCGG - Intergenic
1189098832 X:38168171-38168193 ACAGATAACAATAAAATGCAAGG + Intronic
1189229614 X:39442056-39442078 ACAAATACCAAAGAAATGGATGG + Intergenic
1190078088 X:47333512-47333534 AAAAATAACAAAAAATTAGCTGG - Intergenic
1190735784 X:53255402-53255424 ACATATAGGAAAAAACTGGAAGG - Intronic
1190840255 X:54137247-54137269 AAAAATAAAAAAAAATTGGCCGG - Intronic
1190949549 X:55129918-55129940 AGATTAATCAAAAAATTGGATGG - Intronic
1191819810 X:65292820-65292842 ACAGATAATAAAAAATTAGCTGG + Intergenic
1192076083 X:67998739-67998761 ACAGAAAACAAAAAAGTGCAAGG - Intergenic
1192354587 X:70388901-70388923 AAAAATATCAATAAATTGGATGG - Intronic
1192672972 X:73166073-73166095 ACATAATACAAAAAATTAGCCGG - Intergenic
1193132694 X:77934254-77934276 ACATTTAAAAAAAAATTAGCTGG + Intronic
1193324236 X:80160812-80160834 ACAGCTAACATAATATTGGATGG + Intergenic
1193678451 X:84485692-84485714 ACATAAAGCAAAAAGTTGGCTGG - Intronic
1194440306 X:93924655-93924677 ACACATAAAAAAAAATTAGCCGG + Intergenic
1194442841 X:93954401-93954423 AAATATTACAAAAAATTAGCTGG + Intergenic
1194525700 X:94974798-94974820 ACAAACAAAAAAAAAATGGAAGG - Intergenic
1194530977 X:95047958-95047980 ACATAGAAAAAAAAACAGGAAGG + Intergenic
1194547055 X:95249667-95249689 AAATAGAAGAAAAAATTGAAGGG + Intergenic
1194886783 X:99325198-99325220 ACAAAAAACAAAAAATATGAAGG - Intergenic
1194916118 X:99711184-99711206 AAATACAACATAAAATTGAATGG + Intergenic
1194965918 X:100288823-100288845 AGATAAAAAAAAAAATGGGAAGG - Intergenic
1195022717 X:100845943-100845965 ACATACAAAAAAAAATTAGCCGG - Intronic
1195130794 X:101849073-101849095 AATTCTAACAAAAAATAGGAAGG + Intronic
1196117254 X:112011188-112011210 ACATATAAGGAGAAATTGGGGGG - Intronic
1196119627 X:112035923-112035945 ACATATAACATAATATAGGCCGG - Intronic
1196226406 X:113172567-113172589 AGATAAAACAAAAAGATGGAGGG + Intergenic
1196236873 X:113291970-113291992 ACATAGAAGAAAACATTAGAGGG + Intergenic
1196261803 X:113591707-113591729 ACAAATAAAAATAAATAGGATGG - Intergenic
1196360606 X:114851570-114851592 ATAAATAACAAAGACTTGGAGGG - Intronic
1196400046 X:115305901-115305923 ACATAGATCAAGAAATTGGTAGG + Intronic
1196732743 X:118957597-118957619 AAATATAAAAAAAAATTAGCTGG + Intergenic
1197451354 X:126622487-126622509 ACATACAACAAAAAAGGGGGGGG - Intergenic
1198280229 X:135134274-135134296 CAATATAACAAAAAATTGACCGG + Intergenic
1198290729 X:135238240-135238262 CAATATAACAAAAAATTGACCGG - Intergenic
1198671183 X:139082754-139082776 ACAAATTACCACAAATTGGATGG - Intronic
1199444251 X:147902467-147902489 ACTTTCAACAAAAAATTGCAAGG + Intergenic
1199818609 X:151422719-151422741 ACAAATAACAAAAAATTAGCTGG + Intergenic
1199989933 X:152981514-152981536 AAATAGAACAAAAAGATGGAGGG + Intergenic
1200107260 X:153721734-153721756 ATATATAAAAAAAAATTAGCTGG + Intronic
1200286063 X:154823419-154823441 ATATATAGAAAAAAATTGAAGGG + Exonic
1200579147 Y:4926979-4927001 AAATACAAAAAAAAATTGGTTGG - Intergenic
1201300095 Y:12497831-12497853 AAATACAAAAAAAAATTGGCCGG + Intergenic
1201694391 Y:16808601-16808623 TTATATCACAAACAATTGGAAGG + Intergenic
1202418787 Y:24651043-24651065 ACATAAAAAAAAAAATTAGTGGG + Intergenic
1202451999 Y:25019043-25019065 ACATAAAAAAAAAAATTAGTGGG - Intergenic