ID: 1096308339

View in Genome Browser
Species Human (GRCh38)
Location 12:50498663-50498685
Sequence CAGGGCAGAAAACCGCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 854
Summary {0: 76, 1: 203, 2: 215, 3: 197, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096308339_1096308346 12 Left 1096308339 12:50498663-50498685 CCTTTAAGCGGTTTTCTGCCCTG 0: 76
1: 203
2: 215
3: 197
4: 163
Right 1096308346 12:50498698-50498720 GTTCCTTGCCCTCATTCCCATGG No data
1096308339_1096308347 13 Left 1096308339 12:50498663-50498685 CCTTTAAGCGGTTTTCTGCCCTG 0: 76
1: 203
2: 215
3: 197
4: 163
Right 1096308347 12:50498699-50498721 TTCCTTGCCCTCATTCCCATGGG No data
1096308339_1096308352 28 Left 1096308339 12:50498663-50498685 CCTTTAAGCGGTTTTCTGCCCTG 0: 76
1: 203
2: 215
3: 197
4: 163
Right 1096308352 12:50498714-50498736 CCCATGGGTGTTCCACCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096308339 Original CRISPR CAGGGCAGAAAACCGCTTAA AGG (reversed) Intergenic
900153414 1:1191925-1191947 CAGGGCGGAAAACCGCTGAAAGG - Intronic
900466509 1:2828258-2828280 CGGGGCGGAAAACCGCTTAAAGG - Intergenic
902390661 1:16103147-16103169 CAGGGCAGAAAACCACTTAAAGG - Intergenic
902391293 1:16108631-16108653 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
902904080 1:19541631-19541653 CAGGGTAGAAAACCGCTTAAAGG + Intergenic
902904700 1:19547344-19547366 CAGGGTGGAAAACCACTTAAAGG + Intergenic
902965420 1:19997570-19997592 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
902966033 1:20003374-20003396 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
904324035 1:29715844-29715866 CAGGGTGGAAAACCACTTAAAGG + Intergenic
904324254 1:29717614-29717636 CAGGGCGGAAAACCACTTAAAGG - Intergenic
904572891 1:31480519-31480541 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
904574242 1:31492779-31492801 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
905843227 1:41203670-41203692 CAGGGCAGAAAACCACTTAAAGG + Intronic
906008887 1:42504191-42504213 CAGGGCGGAAAACCGCTTAAAGG - Intronic
906043064 1:42804525-42804547 CAGGGTGGAAAACCACTTAAAGG - Intergenic
906774155 1:48513577-48513599 CAGGGTGGAAAACCACTTAAAGG - Intergenic
906774867 1:48520075-48520097 CAAGGCGGAAAACCACTTAAAGG - Intergenic
906840715 1:49135712-49135734 CAGGGCGGAAAACCACTTAAAGG - Intronic
907465201 1:54630445-54630467 CAGGGTGGAAAACCCCTTAAAGG + Intronic
907465817 1:54635942-54635964 CAGGGCGGAAAACCGCTTAAAGG + Exonic
907713959 1:56910650-56910672 AAGGGGAGAAAACCACTTACTGG - Intronic
907798834 1:57743984-57744006 CAGGGCGGAAAACTGCTTAAAGG - Intronic
908369779 1:63469951-63469973 CAGGGCAGAAAACCACTTAAAGG + Intronic
908494484 1:64680601-64680623 CAGGGAACAAAACTGTTTAATGG + Intronic
908581388 1:65520903-65520925 CAGGGCCAAAAACCACTTAAAGG - Intronic
908894989 1:68888406-68888428 CAGGGCAGAAAACCACTTAAAGG + Intergenic
909098138 1:71315667-71315689 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
909208503 1:72791933-72791955 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
909576028 1:77177384-77177406 CAGGGCAGAAAGCCGCTTAAAGG + Intronic
910536993 1:88309862-88309884 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
911131120 1:94389407-94389429 CAGGGCAGAAAACTGCTTGAAGG + Intergenic
911283413 1:95959413-95959435 CAAAGCGGAAAACCGCTTAAAGG + Intergenic
911600734 1:99845393-99845415 CAGGGCGGAAAACCGCTTAAGGG - Intergenic
912225039 1:107723593-107723615 CAGGGCACAAAACAACTTCATGG + Intronic
912856491 1:113172994-113173016 CAGGGCAGAAAACCACTTAAAGG + Intergenic
912875939 1:113359389-113359411 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
913490648 1:119376627-119376649 CCAGGCAGAAATCTGCTTAAAGG - Intronic
914927475 1:151900917-151900939 CAGGGCAGAAAACCGCTTAAAGG + Intronic
914981818 1:152421557-152421579 CAGTGCGGAAAACTGCTTAAAGG - Intergenic
914982165 1:152424507-152424529 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
915379649 1:155428625-155428647 CAGGCTGGAAAACCGCTTAAAGG + Intronic
915401338 1:155624114-155624136 CAGGGCAGAAAACCACTTAAAGG + Intergenic
915590393 1:156867152-156867174 CAGGGCAGTAGCCCCCTTAACGG - Intronic
915810167 1:158900623-158900645 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
916360932 1:163967585-163967607 CAGGGTGGAAAACCGCTTGAAGG + Intergenic
916495925 1:165346621-165346643 CAGGGTAGGAAACCGATGAAGGG + Intronic
917749608 1:178041916-178041938 TAGGGCAGTAAACCGTCTAAGGG - Intergenic
917799146 1:178554405-178554427 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
917799791 1:178560300-178560322 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
917903830 1:179570515-179570537 CAGGGAGGAAAACCGCTTAAAGG - Intronic
918234941 1:182571385-182571407 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
918349423 1:183638165-183638187 CAGAGTAGAAATCAGCTTAAGGG + Intronic
918837639 1:189488341-189488363 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
919282580 1:195510148-195510170 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
920085700 1:203414625-203414647 CAGGGCAGGAAACCCCTTAAAGG + Intergenic
920413027 1:205777104-205777126 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
920427640 1:205890850-205890872 CAGGGTGGAAAACCGCTTAAAGG + Intergenic
920428190 1:205895806-205895828 CAGGGTGGAAAACCACTTAAAGG + Intergenic
921226530 1:213025811-213025833 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
921227226 1:213032260-213032282 CAGGGCAGAAAACCACTTAAGGG - Intergenic
921465438 1:215481542-215481564 CAGGGGAGAAAACCGCTTAAAGG + Intergenic
924516996 1:244774486-244774508 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
924765076 1:247024797-247024819 CAGGGCGGAAAACCACTTAAAGG + Intergenic
924765648 1:247029822-247029844 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
1063116431 10:3075145-3075167 CAGGGTGGAAAACTGCTTAAAGG - Intronic
1063314304 10:4986462-4986484 CAGGGCAGAAAACTGCTTAAAGG - Intronic
1063789246 10:9423389-9423411 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1066237689 10:33502305-33502327 CAGGGGAGAAAGCAGCTGAACGG - Intergenic
1066283930 10:33945763-33945785 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
1066541994 10:36457392-36457414 CAGGGCGGAAAACCACTTAAAGG + Intergenic
1066619308 10:37326900-37326922 CAGGGCGGAAAACCACTTTAAGG + Intronic
1066989054 10:42495058-42495080 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1066989778 10:42501869-42501891 GAGGGCAGAAAACCGCTTAAAGG + Intergenic
1066990251 10:42506401-42506423 CAGGGCAGAAAACCACTTAAAGG - Intergenic
1066990710 10:42510557-42510579 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
1067135204 10:43601825-43601847 CAGGGCAGAAAACAGCTTAAAGG - Intergenic
1067233843 10:44430652-44430674 CAGGGTGGAAAACAGCTTAAAGG + Intergenic
1068075442 10:52248121-52248143 CAGGGCGGAAAACCACTCAAAGG - Intronic
1068166197 10:53335924-53335946 CAGGGCGGAAACCCACTTAAAGG - Intergenic
1068166939 10:53342726-53342748 TAGGGCAGAAACCCGCTTAAAGG - Intergenic
1068177857 10:53485486-53485508 CAGGGAGGAAAACTGCTTAAAGG - Intergenic
1068337375 10:55652689-55652711 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1068674841 10:59760102-59760124 CAGGGTGGAAAACCGCTTAAAGG + Intergenic
1068675447 10:59765131-59765153 CAGGGTGGAAAATCGCATAAAGG - Intergenic
1069056230 10:63847589-63847611 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1069070230 10:63984735-63984757 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
1069151500 10:64966278-64966300 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1069162298 10:65106954-65106976 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
1069172135 10:65245516-65245538 CAGGGCAGAAAACCACTTAAAGG - Intergenic
1070694398 10:78551455-78551477 CAGGGCAGAAAGCCAGTGAATGG - Intergenic
1070894976 10:79975904-79975926 CAGGGTGGAAAACCGCTTAAAGG - Intronic
1070947069 10:80401183-80401205 CAGGGAGGAAAACCTCTTAAAGG + Intergenic
1071119555 10:82261786-82261808 CAGGGCGGAAAACTGCTTAAAGG - Intronic
1072992513 10:100210741-100210763 CAGAGCAGCAACCTGCTTAAGGG + Intronic
1074980462 10:118615560-118615582 CAGGGCGAAAAACCGCTTAAAGG - Intergenic
1075786301 10:125052463-125052485 GAGCACAGAAAACAGCTTAAGGG - Intronic
1075890375 10:125944649-125944671 CAGGGTGGAAAACCGCTTAAAGG + Intronic
1075913050 10:126142486-126142508 CAGGGCGGAAAACTGCTTAAAGG - Intronic
1076034112 10:127184683-127184705 CAGTGCAGGAAATGGCTTAATGG - Intronic
1076416161 10:130290969-130290991 CAGGGCAGAAAACCACTTAAAGG + Intergenic
1076416871 10:130297440-130297462 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1077180467 11:1210165-1210187 CAGGGTGGAAAACCGCTTAAAGG + Intergenic
1077210066 11:1366705-1366727 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
1078206533 11:9234663-9234685 CAGGGCAGAAAACCGCTTAAAGG + Intronic
1078561187 11:12374371-12374393 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1079830699 11:25264029-25264051 GAGGGTAAAAAACTGCTTAAAGG - Intergenic
1080106206 11:28513825-28513847 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
1081013829 11:37850705-37850727 CAGGGTGGAAAACCGCTTAAAGG + Intergenic
1081328063 11:41770189-41770211 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1082127257 11:48447868-48447890 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
1082280370 11:50265276-50265298 CAGGGTGGAAAATTGCTTAAAGG + Intergenic
1082560824 11:54618799-54618821 TAGGGCAGAAAACCACTTAAAGG - Intergenic
1082914584 11:58418527-58418549 CAGGGTGGAGAACCACTTAAAGG + Intergenic
1082965946 11:58966214-58966236 CAGGGAGGAAAACTGCTTAAAGG + Intronic
1083065905 11:59923728-59923750 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
1083066498 11:59929426-59929448 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1084005356 11:66319794-66319816 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1084024967 11:66442325-66442347 CAGGATGGAAAACCACTTAAAGG - Intronic
1086066328 11:82749299-82749321 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
1086522585 11:87687302-87687324 CAGGGAGGAAGACTGCTTAAAGG + Intergenic
1086752312 11:90512532-90512554 CAGGGCAGAAAACAGCTTAAAGG - Intergenic
1087064535 11:94015053-94015075 CAGGGCAGAAAGCTGCTTAAAGG + Intergenic
1087500454 11:98945407-98945429 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
1087874261 11:103337064-103337086 CAGGGCAGAAAATGGCTTAAAGG + Intronic
1088216702 11:107518566-107518588 CAGGGCGGAAAACTGCTTAAAGG + Intronic
1088340884 11:108765152-108765174 CAGGGTACAAACCCGCTTTAGGG - Intronic
1088491861 11:110396378-110396400 CAGGGCGGAAAACCACTTAAAGG + Intergenic
1088960977 11:114664296-114664318 CATGGCAGAAAACAAATTAAGGG + Intergenic
1090037223 11:123259494-123259516 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1090167437 11:124565105-124565127 CGGGGCGGAAAACCGCTTAAAGG - Intergenic
1090305457 11:125687441-125687463 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1090331506 11:125935916-125935938 CAGGGCAGAAGTCTGTTTAAAGG + Intergenic
1090929922 11:131288208-131288230 CAGGGAAGACAGCCCCTTAAGGG - Intergenic
1092150597 12:6245764-6245786 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1092292589 12:7171421-7171443 TAGGGCGGAAAACTGCTTAAAGG - Intergenic
1092309996 12:7342261-7342283 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1092568661 12:9697256-9697278 CAGGGTGGAAAACCACTTAAAGG + Intronic
1092686243 12:11050406-11050428 CAGGGCAGGAAACCACTTAAGGG - Intronic
1094342111 12:29424296-29424318 CAGGATGGAAAACTGCTTAAAGG - Intronic
1094573859 12:31665857-31665879 CAGGGCAGAGAACTGCTTAAAGG - Intronic
1094728803 12:33151394-33151416 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
1094821338 12:34228216-34228238 CAGGGTGGAAAACCACTTGAAGG + Intergenic
1095095584 12:38146549-38146571 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1095184798 12:39189291-39189313 CAGGGCGGAAAACCACTTAAAGG - Intergenic
1095186007 12:39201041-39201063 CAGGGCAGAAAACCACTTAAAGG - Intergenic
1095780931 12:46058924-46058946 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
1095912553 12:47443669-47443691 CAGGGCGGAAAACCACTTAAAGG - Intergenic
1095913096 12:47448586-47448608 CAGGGCGGAAAACCACTTAAAGG - Intergenic
1096125052 12:49113081-49113103 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
1096307645 12:50492214-50492236 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1096308339 12:50498663-50498685 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1096442002 12:51651085-51651107 CAGGGTGGAAAACCGCTTAAAGG - Intronic
1096450252 12:51734530-51734552 CAGGGTGGAAAACCGCTTAAAGG - Intronic
1096450882 12:51740091-51740113 CAGGGTGGAAAACCACTTAAAGG - Intronic
1097137736 12:56873118-56873140 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
1097816089 12:64075341-64075363 CAAGTCGGAAAACTGCTTAAAGG - Intronic
1099749409 12:86753257-86753279 CAGGGTGGAAAACCGCTTAAAGG + Intronic
1099787494 12:87285070-87285092 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1100306095 12:93351619-93351641 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
1100414680 12:94358975-94358997 CAGGGCAGAAAACTGCTTAAAGG + Intronic
1100472499 12:94905878-94905900 CAGGGCGGAAAACTGCTTAAAGG + Intronic
1101223171 12:102661602-102661624 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1101223861 12:102668007-102668029 CAGGGCAGAAAACCACTTAAAGG - Intergenic
1101500958 12:105303165-105303187 CAAGGCAGAAAACTGCTTAAAGG - Intronic
1101501579 12:105309072-105309094 CAGGGCAGAAAACCGCTTAAAGG - Intronic
1101767034 12:107711254-107711276 CAAGGTGGAAAACTGCTTAAAGG - Intronic
1101992225 12:109495814-109495836 CAGGGTGGAAAACTGCTTAAAGG - Intronic
1102322237 12:111946535-111946557 CAGGGTGGAAAACCACTTAAAGG - Intronic
1102331614 12:112037130-112037152 AAGGACAGAAACCAGCTTAAAGG + Intronic
1102608786 12:114092313-114092335 CAAGGCAGAAAACCACTTAAAGG + Intergenic
1102985890 12:117278064-117278086 CAGGGCTGGAAACCGCCTAGAGG - Exonic
1103143294 12:118571052-118571074 CAGGGCAGAAAACCTCTTAAAGG + Intergenic
1104446310 12:128836357-128836379 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1105282630 13:18977253-18977275 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1105352763 13:19630877-19630899 CAGAGCGGAAAACCGCTTAAAGG + Intergenic
1105697489 13:22903121-22903143 CAAGGTGGAAAACTGCTTAAAGG + Intergenic
1105711190 13:23010683-23010705 CAGGGCAGAAAACCACTTAAAGG + Intergenic
1105738511 13:23297597-23297619 CAGGGCAGAAAACCGCTTAAAGG - Intronic
1106416800 13:29552582-29552604 GAGGATGGAAAACCGCTTAAAGG + Intronic
1106646821 13:31643909-31643931 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1106710169 13:32322567-32322589 CGGGGCAGAAAACCGCTTAAAGG - Intronic
1108602383 13:52005978-52006000 CAGGGCAGAAAACTGCTTAAAGG + Intronic
1108972323 13:56392847-56392869 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
1110919218 13:81063572-81063594 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
1111056507 13:82957505-82957527 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1111277007 13:85963559-85963581 CAGGGTGGAAAACTGCTGAAAGG - Intergenic
1111387483 13:87545569-87545591 CAGGGCAGAAAACCACTTAAAGG + Intergenic
1111415921 13:87943916-87943938 CGGGGCAGAAAACCACTTAAAGG - Intergenic
1111690061 13:91552692-91552714 CAGGGTGGAAAACCCCTTAAAGG - Intronic
1111784125 13:92765774-92765796 TAGGTCAGAAAACCTTTTAAGGG + Intronic
1113830032 13:113288517-113288539 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1114028863 14:18557564-18557586 CAGGATGGAAAACCTCTTAAAGG - Intergenic
1114622554 14:24105242-24105264 CTGGGCAGAAAACCGCTTAAAGG - Intronic
1114677697 14:24455225-24455247 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1115128356 14:30023476-30023498 CAGGGCGGAAAACCGCTTAAAGG + Intronic
1115959472 14:38819398-38819420 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1116232569 14:42235773-42235795 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1116238092 14:42307452-42307474 CACGGCAGAAAATGGCTTAAAGG - Intergenic
1116238777 14:42314010-42314032 TAGGGTGGAAAACAGCTTAAAGG - Intergenic
1116664259 14:47754660-47754682 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1117083157 14:52172243-52172265 CAGGCCAGAAAACCACTTAAAGG + Intergenic
1117600160 14:57366115-57366137 CAGGCCAGAAAACCGCTTAAAGG + Intergenic
1117631167 14:57693439-57693461 CAGGGCAGAAAACTGCTTAAAGG + Intronic
1118393074 14:65312707-65312729 AAGGGCAGAAAACCAATGAAGGG + Intergenic
1118479122 14:66145572-66145594 CAGGATGGAAAACTGCTTAAAGG + Intergenic
1118538290 14:66793013-66793035 CAGGGCGGAAAACCGCTTAAAGG - Intronic
1118587615 14:67370150-67370172 CAGGGCAGAAAACTGCTTAAAGG - Intronic
1118687201 14:68302839-68302861 CAGGGTGGAAAACTGCTTAAAGG - Intronic
1118949921 14:70426784-70426806 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
1119025618 14:71149908-71149930 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
1119138754 14:72245549-72245571 CAGGGAGGAAAACTGCTTAAAGG - Intronic
1119562359 14:75601249-75601271 CAAGGCGGAAAACCGCTTAAAGG - Intronic
1120261304 14:82189243-82189265 CAGGGCGGAAAACCGGTTAAAGG + Intergenic
1120323430 14:82994737-82994759 CAGGGCGGAAAACCACTTAAAGG + Intergenic
1120421154 14:84287607-84287629 CAGGGCGGAAAACCACTTACAGG + Intergenic
1120480750 14:85046507-85046529 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1121498474 14:94414383-94414405 CAGGGCGGAAAGCCACTTAAAGG + Intergenic
1121677926 14:95769604-95769626 CAGGGTGGAAAACCGCTGAAAGG - Intergenic
1122652693 14:103234157-103234179 CAGGGCGGAAAACCGCTCAAAGG + Intergenic
1122653288 14:103239132-103239154 CAGGGCAGAAAACCACTCAAAGG + Intergenic
1123177817 14:106438308-106438330 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1202843896 14_GL000009v2_random:149193-149215 CAGGGTGGAAATCCACTTAAAGG - Intergenic
1202913289 14_GL000194v1_random:139436-139458 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1123673440 15:22684159-22684181 CGGGGTGGAAAACCGCTTAAAGG - Intergenic
1123789126 15:23701788-23701810 CCGGGTGGAAAACCGCTTAAAGG - Intergenic
1123891363 15:24783434-24783456 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
1124020825 15:25921452-25921474 CAGGGCAGAAAACCACTTAAAGG - Intergenic
1124325443 15:28757144-28757166 CGGGGTGGAAAACCGCTTAAAGG - Intergenic
1124897966 15:33795158-33795180 CAGGGCAGAAAACAGTACAAAGG - Intronic
1125527731 15:40388712-40388734 AAGGGCGGAAAACCACTTAAAGG - Intronic
1126687632 15:51262106-51262128 CAGGGCAGAAAACCACTTAAAGG + Intronic
1126798305 15:52278287-52278309 CTGGGCAGTAAACAGCTTCAGGG - Intronic
1126841913 15:52725609-52725631 CAGGGCGGAAAACCACTTAAAGG - Intergenic
1126955435 15:53928390-53928412 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1127360071 15:58237473-58237495 CACGGCGGAAAACCGCTTAAAGG + Intronic
1128835335 15:70804769-70804791 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1129072535 15:72963199-72963221 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1129792292 15:78349481-78349503 CAGGGCGGAAAATCGCTTAAAGG - Intergenic
1130080180 15:80726194-80726216 CAGGGTGGAAAACCGCTTGAAGG - Intronic
1130999237 15:88925141-88925163 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1131037618 15:89234045-89234067 CAGGGCAGAAAACCACTTAAAGG - Intergenic
1131038287 15:89240125-89240147 CAGGGCGGAAAACCACTTAAAGG - Intergenic
1131165543 15:90139727-90139749 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
1132193270 15:99888287-99888309 CAGGGTAGAAAACTGCTTAAAGG + Intergenic
1132909589 16:2301970-2301992 CAGGGCGGAAAACCGCTTAAAGG + Intronic
1133044198 16:3077169-3077191 CAGGGCGGAAAACCGCTTAAAGG - Intronic
1133044705 16:3081375-3081397 CAGAATGGAAAACCGCTTAAAGG - Intronic
1133936331 16:10272438-10272460 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
1134315520 16:13115500-13115522 CAGGGCAGAAAACCGCTTAAAGG - Intronic
1136638677 16:31543046-31543068 CAGGGTGGAAAACCTCTTAAAGG + Intergenic
1136659119 16:31739850-31739872 CAGGGTGGAAAGCCGCTTAAAGG + Intronic
1136743332 16:32559837-32559859 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1136922232 16:34342960-34342982 AAGGGCGGAAAACCCCTTAAAGG + Intergenic
1136982341 16:35068846-35068868 AAGGGCGGAAAACCCCTTAAAGG - Intergenic
1136983647 16:35081374-35081396 CAGGGTGGAAAACCCCTTAAAGG - Intergenic
1137301506 16:47152633-47152655 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1137328866 16:47470398-47470420 CAGGGCCTAAAACCGCTTAAAGG - Intronic
1137764625 16:50968309-50968331 CAGGGCAGCAAACAGTTGAAAGG + Intergenic
1139081344 16:63525153-63525175 CAGGGAGAAAAACTGCTTAAAGG + Intergenic
1140652770 16:77106614-77106636 CAGTGCGGAAAACCACTTAAAGG + Intergenic
1142320404 16:89378888-89378910 CAAGGCTGAAAACCTCTTCAGGG + Intronic
1142371422 16:89685048-89685070 CAGGGCGGAAAACCGCTTAAAGG + Intronic
1142416751 16:89947355-89947377 CAGGGCGGAAAACTGCTTAAAGG + Intergenic
1203026267 16_KI270728v1_random:515392-515414 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1203045454 16_KI270728v1_random:819039-819061 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1142475421 17:185990-186012 CAGGACGGAAAACCCCTTAAAGG + Intergenic
1143430095 17:6875478-6875500 CAGGATGGAAAACCACTTAAAGG - Intergenic
1143430730 17:6881349-6881371 CAGGACGGAAAACTGCTTAAAGG - Intronic
1144506796 17:15838414-15838436 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1145170978 17:20656349-20656371 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1146150308 17:30462981-30463003 CAGGGCGGAAAACTGCTTAAAGG - Intronic
1146294456 17:31638682-31638704 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1146715893 17:35087061-35087083 CAGGCCGGAACACCTCTTAAGGG - Intronic
1147689379 17:42306034-42306056 CAGGGAAGAAAACCGATGCAGGG - Intronic
1147719291 17:42528751-42528773 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
1149139704 17:53417219-53417241 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1149248980 17:54746108-54746130 CAGGGCAGAAAACCGTTTAAAGG - Intergenic
1149783496 17:59416710-59416732 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1150733307 17:67714494-67714516 CTGGGCAGAAAACTTCTTCAGGG + Intergenic
1150992957 17:70282116-70282138 CAGGGTGGAAAACCGCTTAAAGG + Intergenic
1151482898 17:74380551-74380573 AAGGGCTGGAAACAGCTTAACGG + Intergenic
1152064255 17:78101793-78101815 CAGGGCGGAAGACTGCTTAAAGG - Intronic
1152571033 17:81121404-81121426 CAGGGCAGAAGCCAGCTTGATGG + Exonic
1153892239 18:9528435-9528457 CAGGGTGGAAAACTGCTTAAAGG - Intronic
1153941468 18:9982174-9982196 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1153970289 18:10220240-10220262 CAGGGCGGAAAATGGTTTAAAGG - Intergenic
1153970854 18:10225793-10225815 CAGGGCCGAAAATGGTTTAAAGG - Intergenic
1156315946 18:35968709-35968731 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1156802649 18:41136553-41136575 CAGTCCAGAAAACCACTTTAGGG - Intergenic
1157377269 18:47178052-47178074 CAGGTTGGAAAACTGCTTAAAGG - Intergenic
1157671270 18:49530842-49530864 CAGGGCGGAAAACCACTTAAAGG - Intergenic
1157900338 18:51508943-51508965 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
1158087625 18:53671794-53671816 CAGGGCGGAAAACTGCTTAAAGG + Intergenic
1158545124 18:58389509-58389531 CAGGGCAGAAACAGGCTTCAGGG + Intronic
1159195653 18:65110819-65110841 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1159697008 18:71573165-71573187 CAGGGTGGAAAACCGCTTAAAGG + Intergenic
1159937586 18:74381549-74381571 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1160964167 19:1738645-1738667 CAGGTCTGAAAACCACTGAATGG - Intergenic
1161015683 19:1981714-1981736 CAGGGCAGAAAACATCTCCACGG + Intergenic
1161040034 19:2105384-2105406 CAGGGTGGAAAACCACTTAAAGG + Intronic
1161057287 19:2197068-2197090 CACGGCAGAAAACCCCTCAGCGG - Intronic
1161253662 19:3294733-3294755 CAGGGGAGAAACCCCCTTCACGG + Intronic
1161823732 19:6547771-6547793 AAGGGCAGAAAACCGTTTAAAGG - Intergenic
1162282662 19:9711840-9711862 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
1162283300 19:9717785-9717807 CAGGGCGGAAAATGGCTTAAAGG - Intergenic
1162642426 19:12022162-12022184 CAGGGTAGAAAACCACTTAAAGG + Intronic
1162643020 19:12027482-12027504 CAGGGCGGAAAACTGCTTAAAGG + Intronic
1162652858 19:12104111-12104133 CAGGGCGGAAAACCGCTTAAAGG - Intronic
1163839534 19:19598092-19598114 CAGGGCAGAAAAGGGCATTAGGG + Intronic
1163895732 19:20057281-20057303 CAGGGCAGAAAACCATGTAAAGG + Intergenic
1164024473 19:21338708-21338730 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
1164025160 19:21345109-21345131 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
1164031643 19:21412345-21412367 CAGGGTGGAAGACCACTTAAAGG - Intronic
1164051610 19:21588730-21588752 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1164060281 19:21666897-21666919 CAGGGCAGAAAACCACTTAAGGG - Intergenic
1164060963 19:21673221-21673243 CAGGGCAGAAAACCACTTAAAGG - Intergenic
1164251184 19:23477186-23477208 CAGGGCAGAAAACCACTTAAAGG - Intergenic
1164261640 19:23572914-23572936 CAGGGCAGAAAACCACTTAAAGG - Intronic
1164262135 19:23577137-23577159 TAGGGCAGAAAACCACTTAGAGG - Intronic
1164277809 19:23737016-23737038 CAGGGTAGAAAACCGCTTAAAGG + Intergenic
1165301186 19:34970391-34970413 TGGGGCGGAAAACCGCTTAAAGG - Intergenic
1165402022 19:35607276-35607298 CAGAGTGGAAAACCACTTAAAGG + Intergenic
1165726320 19:38115429-38115451 CAGGGCAGAGAACGGCAGAATGG + Intronic
1165865625 19:38935495-38935517 CAGGATGGAAAACGGCTTAAAGG - Intronic
1165866314 19:38941657-38941679 CAGGGCGGAAAACCGCTTAAAGG - Exonic
1166252533 19:41581194-41581216 CAGGGTGGAAAACCGCTTAAAGG + Intronic
1166658842 19:44631817-44631839 CAGGGCGGAAAACCACTTAAAGG - Intronic
1167123871 19:47536140-47536162 CAGGGCAGAAAACTGCTTAAAGG - Intronic
1167346456 19:48948479-48948501 CAGGGTGGAAAACTGCTTCAAGG + Intergenic
925023586 2:590431-590453 CAGGGCGGAAAACTGGTTAAAGG - Intergenic
927117855 2:19922906-19922928 CAGGGCAGAAAACTGCTTAAAGG + Intronic
927118470 2:19928158-19928180 CAGGGCAGAAAACTGCTTAAAGG + Intronic
927400927 2:22708629-22708651 CAGGACACAAAAACGCTTAGTGG + Intergenic
927450382 2:23204535-23204557 CACGGCAGAAAAGCGCTACAAGG + Intergenic
927641470 2:24848219-24848241 CAGGGTGGAAAACCCCTTAACGG + Intronic
928329050 2:30343479-30343501 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
928671748 2:33610016-33610038 TGGGGCAGAAAACCGCTTAAAGG + Intergenic
928702587 2:33914364-33914386 CAGGGCAGAAAACCACTTAAAGG - Intergenic
928703145 2:33919344-33919366 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
928975487 2:37082541-37082563 CTGGCCTGAAAACCGCTTAAAGG + Intronic
930183107 2:48384674-48384696 CAGGGCACAAAACCACTTAAAGG + Intergenic
930183760 2:48390301-48390323 CAGGGCAGAAAACCACTTAAAGG + Intergenic
930316540 2:49803019-49803041 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
930629215 2:53734044-53734066 CAGGGCGGAAAACTGCTTAAAGG - Intronic
930918092 2:56719159-56719181 AAGGGTGGAAAACCACTTAAAGG + Intergenic
930918606 2:56723868-56723890 CAGGGTGGAAAACCGCTTAAAGG + Intergenic
930993532 2:57687920-57687942 CAGGACAGAAAACCACTTAAAGG + Intergenic
931161057 2:59691187-59691209 CAGGGCAGGAAATGGCTTAGAGG - Intergenic
931360000 2:61570113-61570135 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
932327493 2:70872674-70872696 CAAGGCAGAAAACCGCTTAAAGG + Intergenic
932384414 2:71318132-71318154 TAGGATAGAAAACTGCTTAAAGG - Intronic
933011410 2:77068890-77068912 CAGGGGTGAAAACCGCTTAAAGG + Intronic
933230666 2:79803558-79803580 CAGGGCGGAAAACTGCTTAAAGG - Intronic
933500935 2:83110067-83110089 CTGGGTGGAAAACCACTTAAAGG - Intergenic
934931736 2:98431424-98431446 CAGGGTGGAAAACAGCTTAAAGG - Intergenic
935138931 2:100333798-100333820 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
935240623 2:101175074-101175096 CAGGGTGGAAAGCCGCTTAAAGG - Intronic
936171799 2:110183287-110183309 CAGGGCGGAAAACTGCTTAAAGG + Intronic
936799582 2:116251512-116251534 CAGGGTGGAAAACCACTTAAAGG + Intergenic
936800066 2:116255791-116255813 CAGGGTGGAAAACCACTTAAAGG + Intergenic
937170989 2:119868612-119868634 CAGGGCGGAAAACCGCTTAAAGG + Intronic
937610262 2:123852742-123852764 CAGGGCGGAAAATCGCTTAAAGG + Intergenic
938807271 2:134817972-134817994 GAGGCCAGAGGACCGCTTAAGGG - Intergenic
939042375 2:137206432-137206454 CAGGGCTGAAAACCTCTGAGTGG - Intronic
940301202 2:152177816-152177838 CAGGGTGGAAAACCACTTAAAGG + Intergenic
940301615 2:152181266-152181288 CAGGACGGAAAACTGCTTAAAGG - Intergenic
940310496 2:152273959-152273981 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
940311081 2:152279581-152279603 CAGGGTGGAAAGCCACTTAAAGG - Intergenic
941239104 2:163014848-163014870 CAGGGCGGGAAACCGCTTAAAGG + Intergenic
941258098 2:163259153-163259175 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
942837752 2:180320532-180320554 CAGGGTGGAAAAAGGCTTAAAGG + Intergenic
943062166 2:183050599-183050621 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
943062548 2:183053586-183053608 CAGGGCAGAAAACCATTTAAAGG - Intergenic
943222206 2:185124055-185124077 CAGGACAGAAAACCGCTTAAAGG - Intergenic
943255166 2:185585379-185585401 CAGGGCGGAAAATTGCTTAAAGG - Intergenic
943286509 2:186008097-186008119 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
943466118 2:188231162-188231184 CAGGGCGGAAAACAGCTTAAAGG - Intergenic
943528071 2:189043118-189043140 CAGGGCAGAATAATACTTAAAGG + Intronic
943903685 2:193472218-193472240 CCCGGCGGAAAACCACTTAAAGG + Intergenic
944480419 2:200152165-200152187 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
944586538 2:201178485-201178507 CAGGGCGGAAAACTGCAAAAAGG - Intergenic
945292330 2:208138522-208138544 CAGGTCGGAAAACCGCTTAAAGG - Intergenic
945790924 2:214304361-214304383 CAGGGCAGAAAACCACTTAAAGG + Intronic
946206470 2:218112415-218112437 CAGGGCAGAAAACCACTTAAAGG + Intergenic
946206961 2:218116653-218116675 CAGGGCGGAAAACCATTTAAAGG + Intergenic
946210680 2:218144725-218144747 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
946380741 2:219347134-219347156 CGGGGTGGAAAACCACTTAAAGG - Intergenic
946435768 2:219651859-219651881 TAGGGCGGAAAACCGCTTAAAGG + Intergenic
947977991 2:234384283-234384305 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
948124779 2:235556519-235556541 CAGAGCAGAAAACAGGTAAACGG - Intronic
1168936696 20:1671847-1671869 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1169404024 20:5308345-5308367 CAGGGCAGAAAACCGCTTAAAGG + Intronic
1171011728 20:21512795-21512817 CCGGAGAGGAAACCGCTTAAGGG - Intronic
1171228982 20:23467084-23467106 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1173066818 20:39721173-39721195 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
1173067440 20:39726791-39726813 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
1175691751 20:61070358-61070380 CAGGGCTGAAAAAGGCTTCAGGG - Intergenic
1175732975 20:61366701-61366723 CAGGGCGGAAAACCACTTGAAGG - Intronic
1176632649 21:9154113-9154135 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1176640665 21:9300716-9300738 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1177046464 21:16176176-16176198 CAGGTCAGAAAACAACATAAGGG - Intergenic
1177316637 21:19470806-19470828 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1177419582 21:20838900-20838922 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1177519172 21:22195140-22195162 CAGGGTGGAAAACCACTTACAGG - Intergenic
1177683834 21:24410905-24410927 CAGGGCGGAAAACCACCTAAAGG - Intergenic
1178423785 21:32462701-32462723 CAGAGTGGAAAACCACTTAAAGG + Intronic
1178438207 21:32578038-32578060 CAGGGTGGAAAACCGCTTAAAGG - Intronic
1179275104 21:39885197-39885219 CAGGACAGAAACCCATTTAACGG - Intronic
1179957078 21:44747318-44747340 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
1180349690 22:11790099-11790121 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1180373976 22:12073545-12073567 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1180388513 22:12202140-12202162 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1180452983 22:15484626-15484648 CAGGATGGAAAACCTCTTAAAGG - Intergenic
1180958147 22:19750366-19750388 CAGAGCAGACAACAGCTTAGTGG + Intergenic
1181035864 22:20169495-20169517 CAGGGCAGAAAACAGCCTACAGG + Intergenic
1181172873 22:21019910-21019932 CAGGGCGGAAAACCGCTTAAAGG - Intronic
1181593754 22:23900367-23900389 CAGGGCGGAAAACTGCTTAAAGG + Intergenic
1182226872 22:28805617-28805639 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
1182913429 22:34006564-34006586 CAGAGCGGAAAACCACTTAAAGG - Intergenic
1183078296 22:35440560-35440582 CAGGCCAGAAAACCCATTCAAGG + Intergenic
1184277211 22:43416145-43416167 CAGGGCAGAAAAAGGGTTAGGGG - Intronic
949235947 3:1808238-1808260 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
949299097 3:2562348-2562370 AAGGGCTGAAAACTGCTTATTGG - Intronic
949651657 3:6167068-6167090 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
951256683 3:20458092-20458114 TAGGGTGGAAAACTGCTTAAAGG - Intergenic
951270124 3:20614702-20614724 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
951270749 3:20620309-20620331 CATGGCGGAAAACTGCTTAAAGG - Intergenic
952410866 3:33048674-33048696 CAGGGCAAAAAGCAGCTTCAGGG + Intronic
953723429 3:45376657-45376679 CAGGGCGGAAAACCCCTTAAAGG - Intergenic
953731094 3:45448773-45448795 CAGGGGGGAAAACCACTTAAAGG - Intronic
953835013 3:46334836-46334858 CAGGGCAGAAAATTCCTTAAAGG + Intergenic
953836207 3:46347441-46347463 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
954231229 3:49219296-49219318 CAGGGCAGAAAACTGCTTAAAGG + Intronic
954507032 3:51086273-51086295 CAGGGTGGAAAACCACTTAAAGG - Intronic
954769287 3:52951755-52951777 CAGGGCAGAAAACCGCTTAAAGG - Intronic
955632295 3:60987368-60987390 CAGGGTGGAAAATCACTTAAAGG + Intronic
956709966 3:72030492-72030514 GGGGGTGGAAAACCGCTTAAAGG - Intergenic
956943603 3:74194099-74194121 CAGGGTGGAAAACCGCTTAAAGG + Intergenic
956981763 3:74647385-74647407 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
957099504 3:75809957-75809979 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
957491154 3:80929020-80929042 CAGGGCAGAAAATCGCTTAAAGG + Intergenic
957600029 3:82321777-82321799 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
957675727 3:83361590-83361612 CAGGGTGGAAAACCACTTAAAGG + Intergenic
958474439 3:94563162-94563184 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
958738880 3:98043743-98043765 CAGGGCGGAAAACCACTTAAAGG - Intergenic
959197831 3:103209095-103209117 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
959198515 3:103215623-103215645 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
959276327 3:104281754-104281776 CAGGGTGGAAAACCACTTAAAGG - Intergenic
959276890 3:104287289-104287311 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
959440741 3:106372009-106372031 CATTGCAGAAAACCTCTCAAGGG + Intergenic
959574273 3:107917651-107917673 CAGGGCGGAAAACCATTTAAAGG - Intergenic
960788432 3:121399695-121399717 CAGGGCCGAAAACTGCTTAAAGG - Intronic
961265377 3:125637531-125637553 CAGGGCGGAAAACCACGTAAAGG - Intergenic
961323145 3:126092254-126092276 CAGGGTGGAAAACCATTTAAAGG + Intronic
961323635 3:126096539-126096561 CAGGGTGGAAAACTGCTTAAAGG + Intronic
961690026 3:128662740-128662762 CAGGGCAGAAAACCGCTTAAAGG - Intronic
961853979 3:129850934-129850956 CAAGGCAGAAAACCGCTTAAAGG - Intronic
961859235 3:129901395-129901417 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
962022469 3:131514448-131514470 CAGGGCGGATAACCACTTAAAGG + Intergenic
963415097 3:144984730-144984752 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
963879946 3:150517798-150517820 CAGGGCAGAAAACCACTTAAAGG + Intergenic
963995255 3:151701414-151701436 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
964135458 3:153340364-153340386 GAGGGTGGAAAACCGCTTAAAGG + Intergenic
964197581 3:154082352-154082374 CAGGGCAGAAAACCGTTTAAAGG - Intergenic
964275396 3:155004065-155004087 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
964957106 3:162373869-162373891 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
965557292 3:170031707-170031729 CAGGGCGGAAAACGGCTTAAAGG - Intergenic
966009465 3:175056839-175056861 CAGGGTGGAAAACTGCTTACGGG - Intronic
966272923 3:178130450-178130472 CAGGGCAGAAAACTGCTTAAGGG - Intergenic
966296039 3:178424549-178424571 CAGGGCGGAAAACCGCTTAAAGG - Intronic
966495749 3:180578368-180578390 CAGGGCCGAAAACCACTTAAAGG + Intergenic
966506125 3:180703663-180703685 CAGGGCAGAAAACCGCTTAAAGG + Intronic
967179993 3:186895364-186895386 CAGGGCGGAAAACTGCTTAAAGG + Intergenic
967846225 3:194045266-194045288 GAGGGGAGAAAACCGGTAAAGGG - Intergenic
1202746228 3_GL000221v1_random:104308-104330 CAGGGTGGAAAACCACTTAAAGG - Intergenic
968424144 4:510373-510395 CAGGGTGGAAAACCGCTTAAAGG - Intronic
968855108 4:3114224-3114246 CAGGGTGGAAAACCGCTTAAAGG - Intronic
969123384 4:4926397-4926419 CAGGGTGGAAAACTGCTCAAAGG + Intergenic
970391927 4:15620790-15620812 CAGGGCGGAAAACCACTTAAAGG + Intronic
971333014 4:25698017-25698039 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
971813927 4:31462859-31462881 CAGGATGGAAAACCACTTAAAGG + Intergenic
971871489 4:32245753-32245775 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
971873422 4:32273806-32273828 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
972080669 4:35144858-35144880 CAGGGTGGAAAACCACTTAAAGG + Intergenic
972460653 4:39299071-39299093 CAGGGCAGAAAACCGCTTAAAGG + Intronic
972655473 4:41059549-41059571 CAGGGCGGAAAACCGCTTAAAGG + Intronic
972947313 4:44271626-44271648 CAGGGCAGAAAACTGCTTAAAGG + Intronic
973008352 4:45042207-45042229 CAGGGTGGAAAACCTCTTAAAGG + Intergenic
973009031 4:45048671-45048693 CAGGGCGGAAAACCTCTTAAAGG + Intergenic
973139632 4:46750566-46750588 CAGGACAGAATACCACTCAATGG + Intronic
973274609 4:48293644-48293666 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
974581190 4:63804135-63804157 CACGGCAGAAAACTGCTTAAAGG - Intergenic
974753316 4:66170576-66170598 CAAGGCGGAAAACCGCTTAAAGG - Intergenic
974767072 4:66360607-66360629 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
974978478 4:68922341-68922363 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
975092998 4:70425128-70425150 CAAGGCAGAAAACCACTTAAAGG + Intergenic
975225208 4:71863693-71863715 CAGGGCGGAAAACCACTTAAGGG + Intergenic
975351990 4:73357301-73357323 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
975353312 4:73369919-73369941 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
975575477 4:75858281-75858303 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
975580055 4:75898150-75898172 CAGGGCAGAAAACCGCTTAAAGG - Intronic
976045205 4:80938350-80938372 CAGGGCGGAAAACTGCTTAAAGG + Intronic
976128486 4:81858500-81858522 CAGGGCGGAAAACTGCTTAAAGG - Intronic
976179581 4:82386561-82386583 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
976549623 4:86379570-86379592 CAGGGAGGAAAACCGCTTAAAGG + Intronic
976977955 4:91186845-91186867 CAGGGCAGAAAACTGCTTAAAGG - Intronic
977016288 4:91696471-91696493 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
977016873 4:91701824-91701846 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
977358675 4:95978331-95978353 CAGGGTGGAAAACCTTTTAAAGG + Intergenic
977625682 4:99187457-99187479 CAGGGCAGAAAACCACTTAAAGG - Intergenic
977626124 4:99191361-99191383 CAGGGCAGAAAACCACTTAAAGG - Intergenic
977638454 4:99328085-99328107 CAGGGCAGCAAACCGCTTAAAGG - Intergenic
977641911 4:99367211-99367233 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
977652519 4:99486720-99486742 CAGAGGGGAAAACCACTTAAAGG - Intergenic
977653751 4:99498286-99498308 GAGGGCGGAAAACCGCTTAAAGG - Intergenic
977851907 4:101840527-101840549 CAGGGCGGAAAACCACTTAAAGG + Intronic
977857313 4:101909563-101909585 CAGGGGAGAAAACCGCTTAAAGG - Intronic
978011573 4:103691731-103691753 CAGGGCGGAAAACTGCTTAAAGG + Intronic
978245087 4:106562948-106562970 CAGTGCAGAGAAACCCTTAAAGG - Intergenic
979893508 4:126130895-126130917 CAGGGCTGAAAACCACTTAAAGG + Intergenic
980244991 4:130227130-130227152 CAGGGTGGAAAACCGCTTAAAGG + Intergenic
980450183 4:132959483-132959505 CAGGGTCGAAAACCACTTAAAGG + Intergenic
981813856 4:148806482-148806504 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
982482466 4:155929036-155929058 CTGGGCAGAAAACTGCTTAAAGG + Intronic
982519327 4:156393294-156393316 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
982882377 4:160735456-160735478 CAGGGCAGAAAACCACTTAAAGG - Intergenic
983548860 4:168994301-168994323 CAGGGTGGAAAACCGCTTAAAGG - Intronic
983594758 4:169453580-169453602 CAGGGCAGAAAACTGTTCAAAGG + Intronic
983972586 4:173893096-173893118 CAGGGCAGAAAACCACTTCAAGG - Intergenic
984110729 4:175610279-175610301 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
984169568 4:176343897-176343919 CTGGGTGGAAAACCACTTAAAGG + Intergenic
984170255 4:176350415-176350437 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
984280327 4:177662905-177662927 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
984763017 4:183378589-183378611 CAGGGCAGAAATGGGCTTAAAGG - Intergenic
984903383 4:184604628-184604650 CAGGGCGGAAAACTGCTTAAAGG + Intergenic
984955869 4:185045125-185045147 CAGGGTGGAAAATCACTTAAAGG - Intergenic
984964021 4:185125736-185125758 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1202755561 4_GL000008v2_random:58984-59006 CAGGGTGGAAAACCACTTAAAGG + Intergenic
985614189 5:909868-909890 CAGGGTGGAAAACCGCTTAAAGG - Intronic
985625795 5:986241-986263 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
986954632 5:13136142-13136164 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
987482849 5:18480445-18480467 TAGGGCGGAAAACCGCTTAAAGG - Intergenic
988268349 5:28981823-28981845 CAGGGCAGAAAATCCGTTTAAGG - Intergenic
988344081 5:30014356-30014378 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
988810666 5:34782085-34782107 CAGGGTGGAAAACCGCTTAAAGG - Intronic
989046610 5:37280145-37280167 CAGGGCGGAAAACCACTTAAAGG - Intergenic
989065203 5:37453494-37453516 CAGGGCAGAAAACTGCTTAAAGG - Intronic
989154660 5:38332794-38332816 CAGGGTGGAAAACCGCTTAAAGG - Intronic
989345552 5:40425420-40425442 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
989426152 5:41298246-41298268 CAGGGCAGAAAATCGCTTAAAGG - Intergenic
989618296 5:43359461-43359483 CAGGGCAGAAAACCACTTAAAGG - Intergenic
989742402 5:44788737-44788759 CAGGACAGAAAACCACTTAAAGG + Intergenic
989742895 5:44793178-44793200 CAGGGCAGAAAACCACTTAAAGG + Intergenic
989758583 5:44986079-44986101 CCAGGTGGAAAACCGCTTAAAGG + Intergenic
989759057 5:44989979-44990001 CAGGGTGGAAAACCGCTTAAAGG + Intergenic
990109331 5:52304643-52304665 CAGGGTGGAAAACCACCTAAAGG + Intergenic
990109901 5:52309874-52309896 CAGGGTGGAAAACCACTTAAAGG + Intergenic
990306479 5:54498550-54498572 CAGGGCGGAAAACAACTTAAAGG - Intergenic
990307212 5:54505248-54505270 CAGGGCGGAAAACCACTTAAAGG - Intergenic
991570456 5:68048307-68048329 CAGGGAGGAAAACTGCTTAAAGG - Intergenic
992250323 5:74869580-74869602 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
992254539 5:74908480-74908502 CAGAGCGGAAAACCACTTAAAGG - Intergenic
992447266 5:76845327-76845349 CAGGGCGGAAAACTGCTTAAAGG + Intergenic
993020242 5:82583458-82583480 CAGGATGGAAAACCACTTAAAGG + Intergenic
993222076 5:85111577-85111599 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
993405770 5:87510490-87510512 CAGGGCAGAAAACCACTTAAAGG + Intergenic
993406731 5:87520026-87520048 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
994305910 5:98203878-98203900 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
994419017 5:99509315-99509337 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
995108475 5:108401448-108401470 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
995195130 5:109358218-109358240 CAGGGAGGGAAACCGCTTAAAGG + Intronic
995592262 5:113712079-113712101 CAGGGTGGAAAACCACTTAAAGG + Intergenic
995592736 5:113716263-113716285 CATGGTGGAAAACCACTTAAAGG + Intergenic
995605937 5:113854970-113854992 AAGGGCGGAAAACTGCTTAAAGG + Intergenic
995665702 5:114539582-114539604 CAGGGCAGAAAACCACTTAAAGG + Intergenic
995666892 5:114552758-114552780 CAGGGTGGAAAACAGCTTAAAGG - Intergenic
995959412 5:117821579-117821601 CAGGGTGGAAAACAGCTTAAAGG + Intergenic
996270419 5:121597484-121597506 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
996291866 5:121860759-121860781 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
997393423 5:133535397-133535419 CAGGGCGGAAAACCGCTTAAAGG + Intronic
997628551 5:135348710-135348732 CTGGGCAGAAAAGCCCTGAAGGG + Intronic
997947994 5:138219382-138219404 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
997984200 5:138490675-138490697 GAGGGCAGCAAAAGGCTTAAGGG - Intergenic
998343047 5:141434493-141434515 CAGGGCAGAAAACTGCTTAAAGG + Intronic
999552548 5:152704929-152704951 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
999612290 5:153382659-153382681 CAATGCAGAAAACTCCTTAAAGG + Intergenic
1000401722 5:160835805-160835827 GAGGGCAGAAAACCCCATGAAGG - Intronic
1000588131 5:163125120-163125142 CAGGGCGGAAAAACGCTTAAAGG + Intergenic
1001560656 5:172666845-172666867 CAGGGCAGAAAACCCTTTCTTGG - Intronic
1002406830 5:179040754-179040776 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1003191976 6:3882300-3882322 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1003761610 6:9184847-9184869 CAGGGCAGAAAACCACTTAAAGG + Intergenic
1004010413 6:11680745-11680767 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
1004482877 6:16037778-16037800 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1005185514 6:23159719-23159741 CAGGGCGGAAAACTGCTTAAAGG + Intergenic
1005780566 6:29187200-29187222 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1005857767 6:29875981-29876003 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
1005858375 6:29881649-29881671 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
1005865919 6:29936495-29936517 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1006038775 6:31235915-31235937 CAGAGTGGAAAACCACTTAAAGG - Intergenic
1006250046 6:32775769-32775791 CAAGGCAGAAAACCACTTAAAGG + Intergenic
1006497058 6:34431464-34431486 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1007035290 6:38667513-38667535 TCGGGTGGAAAACCGCTTAAAGG + Intergenic
1007886456 6:45235886-45235908 CAGAGCAGAAAACCACTTAAAGG + Intronic
1007887025 6:45241354-45241376 CAGGGCAGAAAACCACTTAAAGG + Intronic
1008093195 6:47313014-47313036 CAGGGCGGAAAACCACTTAAAGG - Intergenic
1008093632 6:47316595-47316617 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
1008190676 6:48453283-48453305 CAGGGCCGAAAACCACTTAAAGG - Intergenic
1008587653 6:52963724-52963746 CAGGGCAGAAAACCACTTAAAGG + Intergenic
1009062347 6:58413024-58413046 CAGGATGGAAAACCTCTTAAAGG - Intergenic
1009063007 6:58419527-58419549 CTGGGCAGAAAACCTCTTAAAGG - Intergenic
1009250032 6:61287588-61287610 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1009250685 6:61294076-61294098 CTGGGCAGAAAACCTCTTAAAGG - Intergenic
1009261574 6:61497037-61497059 CATGGTGGAAAACCGTTTAAAGG - Intergenic
1009640697 6:66331597-66331619 CAGGGCGGAAAACCTCTTAAAGG - Intergenic
1009642850 6:66360848-66360870 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1009737931 6:67703150-67703172 CAGAGTGGAAAACCCCTTAAAGG - Intergenic
1009955612 6:70448873-70448895 CAGGGCAGAAAACTGCTTAAAGG - Intronic
1009980713 6:70722803-70722825 CAGCGTGGAAAACCGCTTAAAGG - Intronic
1010796031 6:80117623-80117645 CAGGGCGGAAAACCGCTTAAAGG + Intronic
1010872823 6:81063165-81063187 CAGGGCGGAAAACCACTTAGAGG + Intergenic
1011364917 6:86570848-86570870 CAGTACAGAAAAGTGCTTAAAGG + Intergenic
1011572546 6:88754720-88754742 CAGGGAGGAAAACCACTTAAAGG + Intronic
1011969046 6:93198521-93198543 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
1013030570 6:106328424-106328446 CAGGGCGGAAAACTGCTTAAAGG + Intergenic
1013202787 6:107917088-107917110 CAGAGCAGAAAACTGCTTAAAGG + Intronic
1013519177 6:110916910-110916932 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1013519785 6:110922736-110922758 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
1013739202 6:113263740-113263762 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1013739732 6:113268315-113268337 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
1014719625 6:124900480-124900502 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
1015466985 6:133558745-133558767 CAGGGAGGAAAACCGCTTAAAGG - Intergenic
1015554743 6:134449844-134449866 CTAGGCAGAAAACATCTTAAAGG - Intergenic
1015805941 6:137108676-137108698 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1015825368 6:137305436-137305458 CAGGGCAGAAAATTGCTTAAAGG - Intergenic
1015839053 6:137456629-137456651 CAGGGCGGAAAACCACTTAAAGG + Intergenic
1016346691 6:143120922-143120944 CAGGGCGGAAAACCGCTTAAAGG + Intronic
1017140192 6:151183079-151183101 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
1017835815 6:158176953-158176975 CAGGGCGGAAAACCGCTTAAAGG - Intronic
1018173066 6:161156797-161156819 CAGGGCGGAAAACCGCTTAAAGG + Intronic
1018594507 6:165463825-165463847 CAGGGCGGAAAACCACTTAAAGG + Intronic
1019233707 6:170590460-170590482 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
1019233931 6:170593410-170593432 CAGGGCGGAAAACCACTTAAAGG - Intergenic
1020054832 7:5110439-5110461 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1020337131 7:7070835-7070857 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
1020462412 7:8440715-8440737 CAGGGCAGAAAATTTCTTATTGG - Intronic
1021562840 7:21986203-21986225 CAGGGCAGAAAACCAGTTACAGG - Intergenic
1022390378 7:29938575-29938597 CAGGGCGGAAAACCGCTTAAAGG + Intronic
1023009401 7:35912275-35912297 CAGGGCAGAAAACCACTTAAAGG + Intergenic
1023283154 7:38592192-38592214 CAGGGTGGAAAACCGCTTAAAGG - Intronic
1023403780 7:39810877-39810899 CAGGGCGGAAAATTGCTTAAAGG - Intergenic
1023960653 7:44923311-44923333 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
1024065161 7:45726590-45726612 CAGGGCAGAAAACCACTTAAAGG - Intergenic
1024101661 7:46038518-46038540 CAGGGCGGAAAACCACTTAAAGG - Intergenic
1024102347 7:46044971-46044993 CAGGGCAGAAAACCACTTAAAGG - Intergenic
1024138377 7:46433980-46434002 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
1024312812 7:47985012-47985034 CAGGGCGGAAAACTGCTTAAAGG + Intergenic
1024327450 7:48120727-48120749 CAGGGCGGAAAAACGCTTAAAGG + Intergenic
1024394022 7:48845788-48845810 CAGAGTGGAAAACTGCTTAAAGG + Intergenic
1024401219 7:48926625-48926647 CAGAGTGGAAAACTGCTTAAAGG - Intergenic
1024419137 7:49141812-49141834 CAGGGCGGAAAACAGCTTAAAGG - Intergenic
1024495701 7:50043053-50043075 CAGGGCAGAAAACCGCTTAAAGG + Intronic
1024911154 7:54448998-54449020 CAGGGCAGAAAACCACTTAAAGG + Intergenic
1024911766 7:54454829-54454851 CAGGGTGGAAAACCGCTTAAAGG + Intergenic
1024912028 7:54457308-54457330 CAGGGGGGAGAAACGCTTAAAGG - Intergenic
1025102217 7:56145052-56145074 CAGGGCAGAAAGCCACTTAAAGG + Intergenic
1025103628 7:56153099-56153121 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1025122494 7:56317095-56317117 CAGGGCAGAAAGCCGCTTAAAGG + Intergenic
1025123070 7:56322428-56322450 CAGGACAGAAAACCACTTAAAGG + Intergenic
1025727274 7:64078176-64078198 CAGGTCTGAGAACCACTTAAAGG - Intronic
1025728431 7:64088926-64088948 CAGGGTGGAAAACCGCTTTAAGG - Intronic
1025743387 7:64221265-64221287 CAGGGCGGAAAACCACTTAAAGG - Intronic
1025803200 7:64807016-64807038 CAGGGTGGAAAACCACTTAAAGG + Intronic
1025816304 7:64915587-64915609 CAGGGCGGAAAACCGCTTAAAGG - Intronic
1025819679 7:64950455-64950477 CAGGGCGGAAAACCACTTATAGG + Intergenic
1026014585 7:66663050-66663072 CAGGGCGGAAAACCGCTTAAAGG + Intronic
1026268093 7:68812994-68813016 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1026290372 7:69000697-69000719 CAGGTCAGAAGACCACTGAAAGG - Intergenic
1026328342 7:69330468-69330490 CAGGGCAGAAAACCACTTAAAGG + Intergenic
1026633176 7:72056256-72056278 CAGGAAAGAAAACCTCTAAAAGG + Intronic
1026872257 7:73860313-73860335 CAGGGCGGAAAACTGCTTAAAGG - Intergenic
1027518128 7:79167928-79167950 CAGGGTGGTAAACCGCTTAAAGG + Intronic
1027979641 7:85201134-85201156 CAGGGGAGGAAAACGATTAATGG + Intergenic
1028309975 7:89319069-89319091 CAGGGCGGAAAACCACTTAAAGG - Intronic
1028732358 7:94166038-94166060 CAGGGTGGAAAACCGCTTAAAGG + Intergenic
1028779719 7:94722623-94722645 CAGGGCGGAAATCCGCTTAAAGG - Intergenic
1028780418 7:94729130-94729152 CAGGGCGGAAAACCGCTCAAAGG - Intergenic
1030277575 7:107736992-107737014 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1030292319 7:107885064-107885086 CAGGGCGGAAAACCACTTAAAGG - Intergenic
1030365920 7:108645963-108645985 CAGGGCGAAAAACTGCTTAAAGG - Intergenic
1030783289 7:113627825-113627847 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
1030943173 7:115681170-115681192 CAAGGCAGAACACAGCTTAGCGG + Intergenic
1031308802 7:120167732-120167754 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1031795761 7:126172841-126172863 CAGGGCGGAAAACCACTCACAGG + Intergenic
1033878698 7:145855182-145855204 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
1034012336 7:147543296-147543318 CAGGGCAGAAAACCGCTTAAAGG - Intronic
1034403888 7:150888442-150888464 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1034538135 7:151738550-151738572 CAGGGCGGAAAACCGCTTAAAGG + Intronic
1034942325 7:155238524-155238546 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1034942972 7:155244006-155244028 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1035588385 8:794594-794616 CAGGGTAGAAAACCACTTAAAGG - Intergenic
1036037259 8:5032546-5032568 AAGGGCAGAAAACAGCCTACAGG + Intergenic
1036557541 8:9873527-9873549 CAGGGCAGACAACCTCTGCAAGG - Intergenic
1036821213 8:11941821-11941843 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
1037005624 8:13776105-13776127 CAGGGCAGAAAACAGCTTAAAGG - Intergenic
1038033115 8:23662080-23662102 CAGGGCAGAAAGAAGTTTAATGG + Intergenic
1038718872 8:30015369-30015391 CAGGGAGGAAAACTGCTTAAAGG + Intergenic
1038733353 8:30147404-30147426 CAGGGCGGAAAACTGCTTAAAGG - Intronic
1038733875 8:30151712-30151734 CAGAGCAGAAAACCCCTTAAAGG - Intronic
1039036676 8:33367265-33367287 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1039338562 8:36621910-36621932 CCGGGCTGAAAACCACTTAAAGG - Intergenic
1039691600 8:39870543-39870565 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
1039692180 8:39875651-39875673 CAGGGCAGAAAACCACTTAAAGG + Intergenic
1040318704 8:46278200-46278222 CAGGGTGGAAAACCGCTTAAAGG + Intergenic
1040381407 8:46876695-46876717 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
1040529653 8:48256197-48256219 CAGGGCGAAAAACCGCTTAAAGG + Intergenic
1040608826 8:48962447-48962469 CAGGGTGGAAAATCTCTTAAAGG + Intergenic
1040609399 8:48967651-48967673 CAGGGCAGAAAACCTCTTAAAGG + Intergenic
1040645391 8:49391017-49391039 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1040744641 8:50626693-50626715 CAAGGCAGAAAACCGCTTAAAGG - Intronic
1040782436 8:51125777-51125799 CAGGGCAGAAAACCACTTAAAGG - Intergenic
1040854454 8:51933886-51933908 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1041046972 8:53896642-53896664 CAGACCAGAAAACCAATTAAAGG + Intronic
1041356246 8:57003646-57003668 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1041493484 8:58460866-58460888 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1043024010 8:75044207-75044229 CAAGGCAGAAAACTGCTTAAAGG + Intergenic
1043024571 8:75049755-75049777 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1043201427 8:77374004-77374026 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
1043910595 8:85859112-85859134 CAGGGTGAAAAACCGCTTAAAGG - Intergenic
1043951705 8:86316684-86316706 CAGGGCGGAAAACTGCTTAAAGG - Intronic
1044016280 8:87051708-87051730 CAGGGTGGAAAACCACTTAAAGG - Intronic
1044442281 8:92236702-92236724 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
1044442900 8:92242365-92242387 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1046001065 8:108421440-108421462 CAGGGCAGAAAACCGCTTAAAGG - Intronic
1046389782 8:113555130-113555152 GAGAGCGGAAAACTGCTTAAAGG - Intergenic
1046479814 8:114801000-114801022 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1046641728 8:116739120-116739142 CAGGGCAGAAAACCGCTTAAAGG + Intronic
1047562810 8:126007881-126007903 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
1047563420 8:126013638-126013660 TAGAGCGGAAAACTGCTTAAAGG + Intergenic
1048686257 8:136908236-136908258 CAGGGCAGAGAACTGTTTAAAGG - Intergenic
1048701992 8:137102005-137102027 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1048772369 8:137908617-137908639 CCGGGTGGAAAACCGCTTGAAGG + Intergenic
1048918122 8:139203627-139203649 CAGAGCGGAAAACCAATTAAAGG - Intergenic
1049460582 8:142725862-142725884 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1049857384 8:144871210-144871232 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1049860884 8:144897895-144897917 CAGGGTGGAAAACCCCTTAAAGG - Intronic
1050129232 9:2392894-2392916 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1050397994 9:5220405-5220427 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1050906638 9:11013899-11013921 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
1051228746 9:14931174-14931196 CAAGTCACAAAACAGCTTAATGG - Intergenic
1051271508 9:15359920-15359942 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
1051844270 9:21434034-21434056 CAGGGCAGAAAACTGCTTAAAGG + Intronic
1052419080 9:28218749-28218771 CAGGGCAGAAATCCAGTTATAGG - Intronic
1052606443 9:30708376-30708398 CAGGGCAGAAAACCACTTAAAGG - Intergenic
1052801799 9:32975206-32975228 CAGGTCATAAAGCCTCTTAAAGG + Intronic
1053126122 9:35582129-35582151 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
1053205220 9:36180363-36180385 CCGGGTGGAAAACTGCTTAAAGG + Intergenic
1053539591 9:38959605-38959627 CAGGGCAGAAAACCACTTAAAGG - Intergenic
1054626550 9:67404313-67404335 CAGGGCAGAAAACCACTTAAAGG + Intergenic
1055318327 9:75056217-75056239 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1055408363 9:75999608-75999630 CAGGGCGGAAAACCGCTTAAAGG - Intronic
1055452495 9:76443525-76443547 CAGGGTGGAAAACCGCTTAAAGG - Intronic
1055625447 9:78172747-78172769 CAGGGCGGAAAACTGCTTAAAGG + Intergenic
1055723524 9:79202034-79202056 CAGGGCAGAAAGCAGCTTTTTGG + Intergenic
1056566756 9:87779637-87779659 CGGGGCGGAAAACTGCTTAAAGG - Intergenic
1056915187 9:90740074-90740096 CAGGGCGGAAAACATCTTAAAGG - Intergenic
1057168459 9:92946531-92946553 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1057285611 9:93751395-93751417 CAGGGCGGAAAACCACTTAAAGG - Intergenic
1057286094 9:93755632-93755654 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
1057380876 9:94566346-94566368 CAGGGTGGAAAACCGCTTAAAGG + Intronic
1057625161 9:96670045-96670067 CAGGGCAGAAAACCGCTTAAAGG + Intergenic
1057627821 9:96693375-96693397 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1058211315 9:102173546-102173568 CAATGCAGAAAAGCCCTTAAAGG - Intergenic
1058226238 9:102368036-102368058 CTGGGCAGAAAACCACTTAAAGG + Intergenic
1058335616 9:103824773-103824795 CAGGGCGGAAAACCACTTAAAGG - Intergenic
1059875884 9:118634273-118634295 CAGGGCGGAAAATCACTTAAAGG - Intergenic
1060326501 9:122621249-122621271 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1061603074 9:131685458-131685480 CAGGGCGGAAAACAGCTTAAAGG + Intronic
1061698120 9:132393395-132393417 CAGGGCGGAAAACCGCTTAAAGG + Intronic
1203755481 Un_GL000218v1:121736-121758 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1203714855 Un_KI270742v1:134333-134355 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1203536362 Un_KI270743v1:43820-43842 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1186095762 X:6100190-6100212 CAGGGCGGAAAACCGCTTAAAGG - Intronic
1186353620 X:8766832-8766854 CAGGGCAGAAAACCACTTAAAGG - Intergenic
1186920316 X:14271367-14271389 CAGCGTAGAAAACCACCTAAAGG + Intergenic
1187115034 X:16340792-16340814 CAGGGTGGAAAACCGCTTAAAGG + Intergenic
1187381143 X:18803287-18803309 CAGGGCGGAAAACCGCTGAAAGG - Intronic
1188038175 X:25341451-25341473 CAGGGCAGAAAACCACTTAAAGG + Intergenic
1188116037 X:26243918-26243940 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1188469959 X:30527464-30527486 CAGGACGGAAAACCACTTAAAGG - Intergenic
1188768149 X:34122312-34122334 CAGGGCGGAAAACTGCTTAAAGG + Intergenic
1188847423 X:35090326-35090348 CAGGGCGGAAAACTGCTTAAAGG + Intergenic
1188865678 X:35310651-35310673 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
1188894115 X:35645509-35645531 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1188965499 X:36546207-36546229 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
1189670322 X:43401208-43401230 CAGGGCACAAAACCACTTAAAGG + Intergenic
1189978002 X:46481849-46481871 CAGGGCGGAAAACCGCTTAAAGG - Intronic
1190184142 X:48220094-48220116 CAGGACGGAAAAACGCTTAAAGG + Intronic
1190614895 X:52220212-52220234 CAGGGTGGAAAACAGCTTAAAGG + Intergenic
1190974307 X:55385026-55385048 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1191227162 X:58055287-58055309 CAGGGAGAAAAACTGCTTAAAGG + Intergenic
1191580899 X:62759546-62759568 CAGAGCAGAAAACCGCTTAAAGG - Intergenic
1191703316 X:64066086-64066108 CAGGGCGGAAAACCGCTTAAAGG - Intergenic
1191833348 X:65438760-65438782 CAGGGCGGAAAACCGCTTAAAGG - Intronic
1191833905 X:65443668-65443690 CAGGCTGGAAAACCGCTTAAAGG - Intronic
1191848391 X:65567681-65567703 CAGGACAGAAAATCTCTTAAAGG - Intergenic
1191919426 X:66238982-66239004 CAGGGCAGAAAACCACTTAAAGG - Intronic
1191949115 X:66569465-66569487 CAGGGCAGAAAACCGCTTAAGGG - Intergenic
1192687786 X:73324957-73324979 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1192767628 X:74158645-74158667 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1193048990 X:77081574-77081596 CAGGGTGGAAAACCTCTTAAAGG + Intergenic
1193063214 X:77229045-77229067 CAGGGCAGAAAACCTCTTAAAGG + Intergenic
1193209275 X:78786592-78786614 CAGGGTGGAAAACTGCTTAAAGG + Intergenic
1193289026 X:79750115-79750137 CAGTGTGGAAAATCGCTTAAAGG - Intergenic
1193313965 X:80042784-80042806 CAGGGCTGAAAACCACTTAAAGG + Intergenic
1193314482 X:80047937-80047959 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
1193786989 X:85771742-85771764 CAATGCAGAAAAGCCCTTAAAGG - Intergenic
1193915994 X:87364533-87364555 TAGGGCAGAAAACCGCTTAAGGG + Intergenic
1194057313 X:89151501-89151523 GAGGGTGGAAAACCACTTAAAGG + Intergenic
1194122145 X:89974937-89974959 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1194309416 X:92286015-92286037 CGGGGCGGAAAACCACTTAAAGG - Intronic
1194543559 X:95204662-95204684 CAGGGCGGAAAACAGCTTAAAGG + Intergenic
1194913248 X:99673365-99673387 CAGAGCGGAAAACCACTTAAAGG - Intergenic
1195307186 X:103595311-103595333 CAGGGCGGAAAACCGCTTAAAGG + Intergenic
1196298795 X:114030694-114030716 CAGGGCAGAAAACCACTTAAAGG + Intergenic
1196390916 X:115206449-115206471 CAGGGCAGACAACCGCTTAAAGG + Intronic
1196840483 X:119854577-119854599 CAAGGCAGAAAGCTGCCTAAGGG + Intergenic
1197109470 X:122755987-122756009 CAGGGTGGAAAACTGCTTAAAGG - Intergenic
1197479269 X:126962597-126962619 CAGGGTGGAAAACCACTTAAAGG + Intergenic
1198715048 X:139549656-139549678 CAGGGCGGAAAACTGCTTAAAGG - Intronic
1199008306 X:142729094-142729116 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1199040726 X:143112026-143112048 CAGGGAGGAAAACCGCTTAAAGG + Intergenic
1200475000 Y:3632371-3632393 CAGGGCAGAAAACCGCTTAAAGG - Intergenic
1200617710 Y:5400262-5400284 CAGGGCGGAAAACCGCTTAAAGG - Intronic
1200970294 Y:9145592-9145614 CAGTGCAGAAAACCACTTAAAGG - Intergenic
1201169093 Y:11239341-11239363 CAGGGTGGAAAACTACTTAAAGG - Intergenic
1201362641 Y:13170059-13170081 TGGGACAGAAAACCACTTAAAGG - Intergenic
1201363202 Y:13175665-13175687 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1201370610 Y:13259012-13259034 CAGGGTGGAAAACCGCTTAAAGG + Intronic
1201408568 Y:13673991-13674013 CAGGGTGGAAAATCACTTAAAGG - Intergenic
1201670864 Y:16518680-16518702 CAGGTTGGAAAACTGCTTAAAGG + Intergenic
1201684127 Y:16682429-16682451 CAGGGTGGAAAATTGCTTAAAGG - Intergenic
1201700764 Y:16878982-16879004 CAGGGTGGAAAAACACTTAAAGG + Intergenic
1201889536 Y:18926802-18926824 CAGGGCAGAAAACGTCTTAAAGG + Intergenic
1201892991 Y:18963060-18963082 CAGGGTGGAAAACCGCTTAAAGG - Intergenic
1201926478 Y:19293409-19293431 CAGGGCAGAAAACTGCTTAAAGG + Intergenic
1201926952 Y:19297915-19297937 CCAGGCAGAAAACCACTTAAAGG + Intergenic
1201959189 Y:19660128-19660150 AAGGGCGGAAAACCACTTAAAGG - Intergenic
1202019420 Y:20449529-20449551 CAGGGTGGAAAACCACTTAAAGG - Intergenic
1202041019 Y:20684214-20684236 CAGGGCAGAAAACTGCTTAAAGG - Intergenic
1202083909 Y:21115072-21115094 CTGGGTGGAAAACTGCTTAAAGG - Intergenic
1202132316 Y:21624426-21624448 GAGGGTGGAAAACCACTTAAAGG - Intergenic
1202140716 Y:21718728-21718750 CAGTGCAGAAAACCACTTAAAGG + Intergenic
1202146149 Y:21785069-21785091 CAGTGCAGAAAACCACTTAAAGG - Intergenic