ID: 1096308339

View in Genome Browser
Species Human (GRCh38)
Location 12:50498663-50498685
Sequence CAGGGCAGAAAACCGCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096308339_1096308347 13 Left 1096308339 12:50498663-50498685 CCTTTAAGCGGTTTTCTGCCCTG No data
Right 1096308347 12:50498699-50498721 TTCCTTGCCCTCATTCCCATGGG No data
1096308339_1096308352 28 Left 1096308339 12:50498663-50498685 CCTTTAAGCGGTTTTCTGCCCTG No data
Right 1096308352 12:50498714-50498736 CCCATGGGTGTTCCACCTTCCGG No data
1096308339_1096308346 12 Left 1096308339 12:50498663-50498685 CCTTTAAGCGGTTTTCTGCCCTG No data
Right 1096308346 12:50498698-50498720 GTTCCTTGCCCTCATTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096308339 Original CRISPR CAGGGCAGAAAACCGCTTAA AGG (reversed) Intergenic