ID: 1096308343

View in Genome Browser
Species Human (GRCh38)
Location 12:50498681-50498703
Sequence AGGAACACCTGGCCCATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096308343_1096308355 16 Left 1096308343 12:50498681-50498703 CCCTGCATGGGCCAGGTGTTCCT No data
Right 1096308355 12:50498720-50498742 GGTGTTCCACCTTCCGGCATGGG No data
1096308343_1096308346 -6 Left 1096308343 12:50498681-50498703 CCCTGCATGGGCCAGGTGTTCCT No data
Right 1096308346 12:50498698-50498720 GTTCCTTGCCCTCATTCCCATGG No data
1096308343_1096308357 23 Left 1096308343 12:50498681-50498703 CCCTGCATGGGCCAGGTGTTCCT No data
Right 1096308357 12:50498727-50498749 CACCTTCCGGCATGGGCGTTAGG No data
1096308343_1096308347 -5 Left 1096308343 12:50498681-50498703 CCCTGCATGGGCCAGGTGTTCCT No data
Right 1096308347 12:50498699-50498721 TTCCTTGCCCTCATTCCCATGGG No data
1096308343_1096308358 24 Left 1096308343 12:50498681-50498703 CCCTGCATGGGCCAGGTGTTCCT No data
Right 1096308358 12:50498728-50498750 ACCTTCCGGCATGGGCGTTAGGG No data
1096308343_1096308352 10 Left 1096308343 12:50498681-50498703 CCCTGCATGGGCCAGGTGTTCCT No data
Right 1096308352 12:50498714-50498736 CCCATGGGTGTTCCACCTTCCGG No data
1096308343_1096308354 15 Left 1096308343 12:50498681-50498703 CCCTGCATGGGCCAGGTGTTCCT No data
Right 1096308354 12:50498719-50498741 GGGTGTTCCACCTTCCGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096308343 Original CRISPR AGGAACACCTGGCCCATGCA GGG (reversed) Intergenic