ID: 1096308344

View in Genome Browser
Species Human (GRCh38)
Location 12:50498682-50498704
Sequence AAGGAACACCTGGCCCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096308344_1096308352 9 Left 1096308344 12:50498682-50498704 CCTGCATGGGCCAGGTGTTCCTT No data
Right 1096308352 12:50498714-50498736 CCCATGGGTGTTCCACCTTCCGG No data
1096308344_1096308354 14 Left 1096308344 12:50498682-50498704 CCTGCATGGGCCAGGTGTTCCTT No data
Right 1096308354 12:50498719-50498741 GGGTGTTCCACCTTCCGGCATGG No data
1096308344_1096308358 23 Left 1096308344 12:50498682-50498704 CCTGCATGGGCCAGGTGTTCCTT No data
Right 1096308358 12:50498728-50498750 ACCTTCCGGCATGGGCGTTAGGG No data
1096308344_1096308355 15 Left 1096308344 12:50498682-50498704 CCTGCATGGGCCAGGTGTTCCTT No data
Right 1096308355 12:50498720-50498742 GGTGTTCCACCTTCCGGCATGGG No data
1096308344_1096308357 22 Left 1096308344 12:50498682-50498704 CCTGCATGGGCCAGGTGTTCCTT No data
Right 1096308357 12:50498727-50498749 CACCTTCCGGCATGGGCGTTAGG No data
1096308344_1096308346 -7 Left 1096308344 12:50498682-50498704 CCTGCATGGGCCAGGTGTTCCTT No data
Right 1096308346 12:50498698-50498720 GTTCCTTGCCCTCATTCCCATGG No data
1096308344_1096308347 -6 Left 1096308344 12:50498682-50498704 CCTGCATGGGCCAGGTGTTCCTT No data
Right 1096308347 12:50498699-50498721 TTCCTTGCCCTCATTCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096308344 Original CRISPR AAGGAACACCTGGCCCATGC AGG (reversed) Intergenic