ID: 1096308345

View in Genome Browser
Species Human (GRCh38)
Location 12:50498692-50498714
Sequence GAATGAGGGCAAGGAACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096308345_1096308358 13 Left 1096308345 12:50498692-50498714 CCAGGTGTTCCTTGCCCTCATTC No data
Right 1096308358 12:50498728-50498750 ACCTTCCGGCATGGGCGTTAGGG No data
1096308345_1096308352 -1 Left 1096308345 12:50498692-50498714 CCAGGTGTTCCTTGCCCTCATTC No data
Right 1096308352 12:50498714-50498736 CCCATGGGTGTTCCACCTTCCGG No data
1096308345_1096308354 4 Left 1096308345 12:50498692-50498714 CCAGGTGTTCCTTGCCCTCATTC No data
Right 1096308354 12:50498719-50498741 GGGTGTTCCACCTTCCGGCATGG No data
1096308345_1096308355 5 Left 1096308345 12:50498692-50498714 CCAGGTGTTCCTTGCCCTCATTC No data
Right 1096308355 12:50498720-50498742 GGTGTTCCACCTTCCGGCATGGG No data
1096308345_1096308357 12 Left 1096308345 12:50498692-50498714 CCAGGTGTTCCTTGCCCTCATTC No data
Right 1096308357 12:50498727-50498749 CACCTTCCGGCATGGGCGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096308345 Original CRISPR GAATGAGGGCAAGGAACACC TGG (reversed) Intergenic