ID: 1096308345

View in Genome Browser
Species Human (GRCh38)
Location 12:50498692-50498714
Sequence GAATGAGGGCAAGGAACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1271
Summary {0: 485, 1: 355, 2: 126, 3: 55, 4: 250}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096308345_1096308357 12 Left 1096308345 12:50498692-50498714 CCAGGTGTTCCTTGCCCTCATTC 0: 485
1: 355
2: 126
3: 55
4: 250
Right 1096308357 12:50498727-50498749 CACCTTCCGGCATGGGCGTTAGG No data
1096308345_1096308354 4 Left 1096308345 12:50498692-50498714 CCAGGTGTTCCTTGCCCTCATTC 0: 485
1: 355
2: 126
3: 55
4: 250
Right 1096308354 12:50498719-50498741 GGGTGTTCCACCTTCCGGCATGG No data
1096308345_1096308352 -1 Left 1096308345 12:50498692-50498714 CCAGGTGTTCCTTGCCCTCATTC 0: 485
1: 355
2: 126
3: 55
4: 250
Right 1096308352 12:50498714-50498736 CCCATGGGTGTTCCACCTTCCGG No data
1096308345_1096308355 5 Left 1096308345 12:50498692-50498714 CCAGGTGTTCCTTGCCCTCATTC 0: 485
1: 355
2: 126
3: 55
4: 250
Right 1096308355 12:50498720-50498742 GGTGTTCCACCTTCCGGCATGGG No data
1096308345_1096308358 13 Left 1096308345 12:50498692-50498714 CCAGGTGTTCCTTGCCCTCATTC 0: 485
1: 355
2: 126
3: 55
4: 250
Right 1096308358 12:50498728-50498750 ACCTTCCGGCATGGGCGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096308345 Original CRISPR GAATGAGGGCAAGGAACACC TGG (reversed) Intergenic
900153423 1:1191954-1191976 GAATGAGGGCAAGGAACACCTGG - Intronic
900466518 1:2828287-2828309 GAATGAGGACAAGGAACACCTGG - Intergenic
902390669 1:16103176-16103198 GAATGAGGGCAAGGAACACCTGG - Intergenic
902391300 1:16108660-16108682 GAATGAGGGCAAGGAACACTTGG - Intergenic
902904072 1:19541602-19541624 GAATGAGGGCAAGGAACACCTGG + Intergenic
902904691 1:19547315-19547337 GAATGAGGGCAAGGAACACCTGG + Intergenic
902960923 1:19962326-19962348 TAATGATGGAAAGGAACTCCTGG + Intergenic
902965411 1:19997541-19997563 GAATGAGGGCAAGGAATACCTGG + Intergenic
902966025 1:20003345-20003367 GAATGAGGGCAAGGAACACCTGG + Intergenic
904324026 1:29715815-29715837 GAATGAGGACAAGGAACACCTGG + Intergenic
904324262 1:29717643-29717665 GAATGAGGGCAAGGAACACCTGG - Intergenic
904455834 1:30647550-30647572 GAATGTGGGCAAGGAGCTCTGGG - Intergenic
904572883 1:31480490-31480512 GAATGAGGGCAAGGAACACCTGG + Intergenic
904574251 1:31492808-31492830 GAATGAGGGCAAGGAACACCTGG - Intergenic
905810732 1:40911190-40911212 GAGTGAGGGCAAGGAAAATGAGG + Intergenic
905843219 1:41203641-41203663 GAATGAAGGCAAGGAACACCTGG + Intronic
906009744 1:42512192-42512214 GAATGAGGGCAAGGAACACCTGG - Intronic
906043073 1:42804554-42804576 GAATGAGGGCAAGGAACACCTGG - Intergenic
906774164 1:48513606-48513628 GAATGAGGGCAAGGAACACCTGG - Intergenic
906774875 1:48520104-48520126 GAATGAGGGCAAGCAACACCTGG - Intergenic
906840722 1:49135740-49135762 GAATGAGGGCAAGGAACACTGGG - Intronic
907465192 1:54630416-54630438 GAATGACGGCAAGGAACACCTGG + Intronic
907465809 1:54635913-54635935 GAATGAGAGCAAGGAACACCTGG + Exonic
907798843 1:57744013-57744035 GAATGAGGGCAAGGAACACCTGG - Intronic
908369771 1:63469922-63469944 GAATGAGGGCAAGGAACACCTGG + Intronic
908581396 1:65520932-65520954 GAATGAGAGCAAGGAACACCTGG - Intronic
908784407 1:67721037-67721059 GAGTGATGGCTAGGAGCACCAGG - Intronic
908894981 1:68888377-68888399 GAATGAGGGCAAGGAACACCTGG + Intergenic
909048498 1:70739424-70739446 GAATGAGGGCAAGAAACACCTGG - Intergenic
909098145 1:71315696-71315718 GAATGAGGGCAAGGAACACCTGG - Intergenic
909208511 1:72791962-72791984 GAATGAGGGCAAGAAACACCTGG - Intergenic
909576020 1:77177355-77177377 GAATAAGGGCAAGGAACACCAGG + Intronic
910537001 1:88309891-88309913 GAATGAGGGCAAGGAATACCTGG - Intergenic
911020870 1:93386539-93386561 GAATGAGGGCAAAGAACACCTGG - Intergenic
911131112 1:94389378-94389400 GAATGAGGGCAAGGAACACCTGG + Intergenic
911136316 1:94444917-94444939 GAATGAGGGCAAGGGACACCTGG + Intronic
911136923 1:94450432-94450454 GAATGAGGGCAAGGAACACCTGG + Intronic
911283407 1:95959384-95959406 GAATGAGGGTAAGGAACACCTGG + Intergenic
911600744 1:99845422-99845444 GAATGAGGGCAGGGAACACCTGG - Intergenic
911837235 1:102635980-102636002 GAATGAGGGCAAGCAAATTCTGG - Intergenic
911977377 1:104516351-104516373 GAATGAGAACAAGGAACACCTGG - Intergenic
912856483 1:113172965-113172987 AAATGAGGGCAAGGAACACCTGG + Intergenic
912875930 1:113359360-113359382 GAATGAGGGCAAGGAACACCTGG + Intergenic
912933818 1:113985960-113985982 AAATGAGGGCAAGGAACACCTGG - Intergenic
913193514 1:116433449-116433471 AAATGAGGGCAGGGAGCAGCAGG + Intergenic
914768284 1:150659356-150659378 GAATGAGGGCAAGGAACACCTGG + Intronic
914927468 1:151900888-151900910 GAATAAGGGCAAGGAACACCTGG + Intronic
914981825 1:152421586-152421608 GAATGAGCGCAAGGAACACCTGG - Intergenic
914982174 1:152424536-152424558 GAATGAGGGCAAGGAATACCTGG - Intergenic
915006015 1:152637294-152637316 GAAGGAGTGCAAGAAACACCAGG - Intergenic
915179680 1:154047489-154047511 GAATGAGGACAAGGAACACCTGG + Intronic
915180341 1:154053548-154053570 GAATGAGGGCAAGGAACACCTGG + Intronic
915261469 1:154679536-154679558 GAATGAGGGCAAGGAACACCTGG + Intergenic
915379641 1:155428596-155428618 GAATAAGGGCAAGAAACACCTGG + Intronic
915401330 1:155624085-155624107 GAATGAGGGCAAGGAATACCTGG + Intergenic
916220966 1:162444862-162444884 GAATGAGGGCAAGGAGGAAAAGG + Intergenic
916360923 1:163967556-163967578 GAATGAGGGCAAGGAACACCTGG + Intergenic
916506968 1:165436787-165436809 AAAAGAGGCCAAGGAACTCCAGG - Intronic
916531061 1:165656976-165656998 GAAGCAGGGCAGGGAAGACCTGG + Intronic
916703012 1:167317696-167317718 GAAGGAGGGCAAGGAACACCTGG - Intronic
916703551 1:167322929-167322951 GAATGACGGCAAGGAACACTTGG - Intronic
916932406 1:169592327-169592349 GAATAAGAGTAAGGAACACGTGG + Intronic
917293268 1:173493219-173493241 GAATGAGGGCAAGGAACACCTGG + Intergenic
917717766 1:177755332-177755354 GAAGGAGGGCCAAAAACACCTGG + Intergenic
917717892 1:177756478-177756500 GAAAGAGGGCAAAGACTACCAGG + Intergenic
917799155 1:178554434-178554456 GAATGAGGGCAAGGAACACCTGG - Intergenic
917799797 1:178560329-178560351 GAATGAGGGCAAGGAATACCTGG - Intergenic
917903838 1:179570544-179570566 GAATGAAGGCAAGGAACACCTGG - Intronic
918103600 1:181397715-181397737 GGATGAGGGGGAGGGACACCAGG - Intergenic
918234932 1:182571356-182571378 GAATGAGGGCAAGGAATACCTGG + Intergenic
918379015 1:183936269-183936291 TAATGAGGTCAAGGAACCTCTGG + Exonic
918837647 1:189488371-189488393 GAATGAGGGCAAGGAACACCTGG - Intergenic
919200768 1:194352674-194352696 GAATGAGGGCAAGGAACACCTGG + Intergenic
919282573 1:195510119-195510141 GAATGAGGGCAAGGAACACCTGG + Intergenic
920031073 1:203037836-203037858 GAATGATGGAAAGGAACCCAGGG - Intronic
920085691 1:203414596-203414618 GAATGAGGGTAAGCAACACCTGG + Intergenic
920413036 1:205777133-205777155 GAACGAGGGCAAGGAACACCTGG - Intergenic
920427631 1:205890821-205890843 GAATGAGGGCAAGGAACACCTGG + Intergenic
920428181 1:205895777-205895799 GAATGAGAGCAAGGAACACCTGG + Intergenic
921226539 1:213025840-213025862 GAATGAGGGCAAGGAACACCTGG - Intergenic
921227233 1:213032289-213032311 GAGTGAGGGCAAGGAACATCTGG - Intergenic
921465429 1:215481513-215481535 GAATGAGGGCAAGGAACACCTGG + Intergenic
921976028 1:221204270-221204292 GAATGAGGGCAAGAAAAATGGGG + Intergenic
922681165 1:227597298-227597320 GAATGAGGGCAAGGAACACCTGG - Intronic
923294568 1:232581142-232581164 GAATGTGGGAAAGGGACACGAGG - Intergenic
923321625 1:232839889-232839911 GAATGAGATCAAGGAACACCTGG + Intergenic
923865470 1:237934608-237934630 GAATGAGGCCAAGGAACACCTGG - Intergenic
924089591 1:240488371-240488393 AAATGAGGGAAAGGATCACCAGG - Intergenic
924424653 1:243940312-243940334 GTATGAGGGCACTGAAAACCAGG + Intergenic
924516987 1:244774457-244774479 GAATGAGGGCAAGGAACACCCGG + Intergenic
924765067 1:247024768-247024790 GAATGAGGGCAAGGAACACCTGG + Intergenic
924765640 1:247029793-247029815 GAATGAGGGCAAGGAACACCTGG + Intergenic
924904807 1:248441251-248441273 GAATGAGGGCAAAGAAGCCAGGG - Exonic
1063116440 10:3075174-3075196 GAATGAGGGCAAGGAGCACCTGG - Intronic
1063314309 10:4986491-4986513 GAATGAGGGCAAGGAACACCTGG - Intronic
1063327564 10:5120063-5120085 GAATGATGGCAAGGAACAGCTGG + Intronic
1063468346 10:6263335-6263357 GAATGAGAGCAAGGAACACCTGG - Intergenic
1063789255 10:9423418-9423440 GAATGAGGGCAAGGAACACCTGG - Intergenic
1066112103 10:32206730-32206752 GAATGAGGACAAGAAACATCTGG - Intergenic
1066283937 10:33945792-33945814 GAATGAGGGCAACGAACACCTGG - Intergenic
1066344500 10:34570889-34570911 GAATGTGGTCTAGGGACACCTGG - Intronic
1066459535 10:35601126-35601148 GAATGATGGCAAGGAATACATGG - Intergenic
1066541985 10:36457363-36457385 GAATGAGGGCAAGGAACACCTGG + Intergenic
1066619299 10:37326871-37326893 GAATGAGGGCAAGGAATACCTGG + Intronic
1066702726 10:38147123-38147145 GGAGCAGGGCAAGGAACACCTGG - Intergenic
1066801544 10:39198100-39198122 GAATGAGGGCAAGGAACACCTGG - Intergenic
1066803023 10:39210719-39210741 GAATGAGGGCAAGGAATACCTGG - Intergenic
1066988152 10:42486652-42486674 GGAGCAGGGCAAGGAACACCTGG + Intergenic
1066989046 10:42495029-42495051 GAATGAGGGCAAGGAACACCTGG + Intergenic
1066989772 10:42501840-42501862 GAATGAGGGCAAGGAATACCTGG + Intergenic
1066990258 10:42506430-42506452 GAATGAGGGCAAGGAACATCTGG - Intergenic
1066990719 10:42510586-42510608 GAATGAGGGCAAGGAACACCTGG - Intergenic
1067133909 10:43591603-43591625 GAATGAGGGCAAGGAACACCTGG + Intergenic
1067135212 10:43601854-43601876 GAATGAGGACAAGGAACACCTGG - Intergenic
1067233835 10:44430623-44430645 GAATGAGGGCAAGGAACACCTGG + Intergenic
1068006919 10:51402206-51402228 GAATGAAGATAAGGAACACATGG - Intronic
1068075452 10:52248150-52248172 GAATGAGGGCCAGGAACACCTGG - Intronic
1068166206 10:53335953-53335975 GAATGAGGGCAAGGAACACCTGG - Intergenic
1068166946 10:53342755-53342777 GAATGAGGGCAAGGAACACCTGG - Intergenic
1068177865 10:53485515-53485537 GAATGAGGGCAAGGAACACCTGG - Intergenic
1068203378 10:53814007-53814029 GAATGAGGTTAAGAAAGACCTGG + Intronic
1068337367 10:55652660-55652682 GAATGAGAGCAAGGAACACCTGG + Intergenic
1068445637 10:57119096-57119118 GAATGAGGGCAAGGAACACCTGG + Intergenic
1068671202 10:59725418-59725440 GAATGAGGGCAAGGAACACCTGG - Intronic
1068674832 10:59760073-59760095 GAATGAGGGCAAGGAACACCTGG + Intergenic
1068675455 10:59765160-59765182 GAATGAGGGCAAGGAACACCTGG - Intergenic
1068770009 10:60810346-60810368 GAATGAGGGCTAGTTACACACGG + Intergenic
1069056222 10:63847560-63847582 GAATGAAGGCAAGGAACACCTGG + Intergenic
1069070237 10:63984764-63984786 GAATGAGGGCAAAGAACACCTGG - Intergenic
1069111574 10:64453730-64453752 GAATGAGGGCAAGCATCACCTGG + Intergenic
1069151492 10:64966249-64966271 GAATGAGGGCAAGGAACACCTGG + Intergenic
1069162289 10:65106925-65106947 GAATGAGGGCAAGGACCACCTGG + Intergenic
1069172143 10:65245545-65245567 GAATGAGGGCAAGGAATACCTGG - Intergenic
1069346878 10:67480501-67480523 GAATGAGGACAAGGAACACCTGG + Intronic
1069491125 10:68861427-68861449 GAATGAGGACAAGGAACACCTGG - Intronic
1069491948 10:68868460-68868482 GAATGAGGGCAAGGAACACCTGG - Intronic
1069668775 10:70183926-70183948 CAATGTGGGGAAGGACCACCTGG - Intergenic
1069830890 10:71281881-71281903 GAAAGAGGCCAAGGAAAGCCCGG - Intronic
1070350173 10:75584071-75584093 GAATGAGGGCAGGGAAGAACAGG - Intronic
1070894985 10:79975933-79975955 GAATGAGGGCAAGGAACACCTGG - Intronic
1070947060 10:80401154-80401176 GAATGAGGGCAAGGAACACCTGG + Intergenic
1070975658 10:80603839-80603861 GGATTAGGGCATGGGACACCGGG + Intronic
1071119564 10:82261815-82261837 GAATGAGGGCAAGGAACACCTGG - Intronic
1071198259 10:83187106-83187128 GAATGAGAGCAAGGAACATCTGG - Intergenic
1071478352 10:86043504-86043526 TAATGAGGGCAAGGATCACCAGG - Intronic
1072714738 10:97743203-97743225 GAATGTGGGGGAAGAACACCTGG + Intronic
1072981661 10:100103292-100103314 GAATGAGGGCAAGGAACACCTGG - Intergenic
1073094908 10:100973405-100973427 CACTGAATGCAAGGAACACCTGG - Intronic
1073232162 10:101981293-101981315 GAATGAGAGCCAGAGACACCAGG + Intronic
1073862190 10:107759249-107759271 GGCTGGGGGTAAGGAACACCTGG + Intergenic
1074013062 10:109504244-109504266 GAATGAGGGCAAGGAACACCTGG - Intergenic
1074660800 10:115655051-115655073 GAGAGAGACCAAGGAACACCAGG + Intronic
1074693991 10:116031142-116031164 GAGTGTGGGCAAGGGACCCCTGG - Intergenic
1074980469 10:118615589-118615611 GAATGAGGGCAAGGAACACCTGG - Intergenic
1075014053 10:118897086-118897108 GATTAAGGGCAAGGAACACCTGG + Intergenic
1075015381 10:118906961-118906983 GAAGGAGGGCAGGGAGCCCCAGG - Intergenic
1075240457 10:120773860-120773882 GAATGAGGGCTAGGAAAATGAGG - Intergenic
1075885865 10:125898503-125898525 GAATGAGGGCAAGGGATTCCAGG + Intronic
1075890367 10:125944620-125944642 GAATGAGGGCAAGGAACACCTGG + Intronic
1076416152 10:130290940-130290962 GAATGAGGGCAAGGAACACCCGG + Intergenic
1076505905 10:130972381-130972403 GAATGATGGCAAGGAACACCTGG + Intergenic
1077180458 11:1210136-1210158 GAATGAGGGCAAGGAACACCTGG + Intergenic
1077210075 11:1366734-1366756 GAATGGGGGCAAGGAACACCTGG - Intergenic
1077559647 11:3251339-3251361 GCAAGAGGGCAAGGAGAACCAGG - Intergenic
1077565540 11:3297142-3297164 GCAAGAGGGCAAGGAGAACCAGG - Intergenic
1078206525 11:9234634-9234656 GAATGAGGGCAAGGAACACCTGG + Intronic
1078561179 11:12374342-12374364 GAATGAGGGCAAGGAACACTTGG + Intergenic
1078689357 11:13563419-13563441 GAATGAGGGCAAGGAACACCTGG - Intergenic
1079830703 11:25264058-25264080 GAATGAGGGAAAGGAACAACTGG - Intergenic
1080106215 11:28513854-28513876 GAATGAGGGCAAAGAACACCTGG - Intergenic
1081013820 11:37850676-37850698 GAATGAGGGCAAGGAACACCTGG + Intergenic
1081186481 11:40048992-40049014 GAATGAGGGCAAGGAACACCTGG + Intergenic
1081328072 11:41770218-41770240 GAATGAGGGCAAGGAACACCTGG - Intergenic
1081329926 11:41790349-41790371 GAATGGGGGCAAGGAAGTACTGG + Intergenic
1081932690 11:46883348-46883370 GAATGAGGGCAAGGAACACCTGG + Intronic
1081949408 11:47030324-47030346 GAGTGAGAACAAGGAGCACCTGG + Intronic
1082127265 11:48447897-48447919 GAATGAAGGCAAGGAACTCCTGG - Intergenic
1082188750 11:49216332-49216354 GAATGAGGGCAAGGAACACCTGG - Intergenic
1082249844 11:49965882-49965904 GAATGAGGGCAAAGAACACCTGG + Intergenic
1082280361 11:50265247-50265269 GAATGAGGGCAAGGAACACCTGG + Intergenic
1082301733 11:50514058-50514080 AAATGAGGGCAAAGAACACCTGG + Intergenic
1082304473 11:50554027-50554049 GAATGAAGGCATGGGACATCTGG + Intergenic
1082560831 11:54618828-54618850 GAATGAAGGAAAGGAACTCCTGG - Intergenic
1082914575 11:58418498-58418520 GAATGAGGGCAAGGAACACCTGG + Intergenic
1082965937 11:58966185-58966207 GAATGAGGGCAAGGAACACCTGG + Intronic
1083065898 11:59923699-59923721 GAATGAGGGCAAGGAACACCTGG + Intergenic
1083066490 11:59929397-59929419 AAATGAGGGCAAGGAACACCTGG + Intergenic
1084005346 11:66319764-66319786 GAATGAGAGCAAGGAACACCTGG + Intergenic
1084024975 11:66442354-66442376 GAATGAGGGCAAGGAACACCTGG - Intronic
1084790100 11:71469686-71469708 GAATGAGGGCAACAAACACCTGG - Intronic
1084919639 11:72458647-72458669 GACTGAGGGTAAGGGAAACCTGG + Intergenic
1085069297 11:73528225-73528247 GAATGAGGGCTAGGAAAATGAGG + Intronic
1085337664 11:75708487-75708509 GAATGAGAGCAAGGAACACCTGG - Intergenic
1085355604 11:75833886-75833908 GAATGAAGGCAAGGAACACCTGG - Intronic
1086066337 11:82749328-82749350 GAATGAGGGCAAGGAACACCTGG - Intergenic
1086677772 11:89630347-89630369 GAATGATGGCAAGGAGCACCTGG + Intergenic
1086752318 11:90512561-90512583 GAATGAGGGCAAGGAACACCTGG - Intergenic
1086781043 11:90906343-90906365 TAAGGAGGGCATGGAACAGCAGG + Intergenic
1086950527 11:92886078-92886100 GAGTGAGGGCAGTGATCACCAGG - Intronic
1087064527 11:94015024-94015046 GAATGAGGGCAAGGAACACCTGG + Intergenic
1087147737 11:94828544-94828566 GAATGAGGGCAAGGTAGAAGTGG - Intronic
1087229132 11:95640146-95640168 TACTGAGGGCAAGGAACACCTGG - Intergenic
1087371532 11:97291207-97291229 GAATGAGGGCAAGGAAGACCTGG + Intergenic
1087500463 11:98945436-98945458 GAATGAGGGCAAGGAACACCTGG - Intergenic
1087527657 11:99337576-99337598 GAATGAGGGCAAGGAACACCTGG - Intronic
1087628514 11:100623606-100623628 GAATGAGGGAAAGGAACACCTGG + Intergenic
1087874252 11:103337035-103337057 GAACGAGGGCAAGGAAAACCTGG + Intronic
1087881895 11:103426024-103426046 GAATGAGGGCAATGAACACCTGG + Intronic
1088216693 11:107518537-107518559 GAATGAGGGCAACAAACACCTGG + Intronic
1088491854 11:110396349-110396371 GAATGAGGGTAAGCAACACCTGG + Intergenic
1088506725 11:110534594-110534616 GAATGAAGGCAAGGAACACCTGG - Intergenic
1090037215 11:123259465-123259487 GAATGAGGGCAAGGAACACCTGG + Intergenic
1090167447 11:124565134-124565156 GAATGAGGGCAAGGAACACCTGG - Intergenic
1090305448 11:125687412-125687434 GAATGAGGGTAAGGAACACCTGG + Intergenic
1091231746 11:133992239-133992261 GAAGGAGGGGAAGGAAGTCCTGG + Intergenic
1091931923 12:4403221-4403243 GGAGGAGGGCCAGGGACACCTGG - Intergenic
1092150605 12:6245793-6245815 GAATAAGGGCAAGGAACACCTGG - Intergenic
1092292596 12:7171450-7171472 GAATGAGGGCAAGGAACACCTGG - Intergenic
1092473968 12:8803342-8803364 GGATGAGGGCAAGGAACACCTGG - Intergenic
1092568653 12:9697227-9697249 GAATGAGGGCAAGGAACACCTGG + Intronic
1092598127 12:10030103-10030125 GAATGAGGGCAAGGAGCAGCTGG + Intergenic
1092623357 12:10298607-10298629 GAATGAGAGCAAGGAATACCTGG + Intergenic
1092686253 12:11050435-11050457 GAATGAGAGCAAGGAACACCTGG - Intronic
1092881865 12:12892970-12892992 GAATGAGGGGAAGGAAGGGCCGG + Intronic
1093147332 12:15582187-15582209 CAATGAGGGCAAGGAACACCTGG - Intronic
1094342119 12:29424325-29424347 GAATGAGGGCAAGGAACACCTGG - Intronic
1094573866 12:31665886-31665908 GAATGAGGGCAAGGAACACCTGG - Intronic
1094728810 12:33151423-33151445 GAATGAGGGCAAAAAACACCTGG - Intergenic
1094728897 12:33151993-33152015 GAATAAGGGCAAGGAACACCTGG - Intergenic
1094821330 12:34228187-34228209 GAATGAGGGCAAAGAACACCTGG + Intergenic
1095095576 12:38146520-38146542 GAATGAGGGCAATGAACACCTGG + Intergenic
1095179141 12:39127018-39127040 GAATGAAGGCAAGGAACACCTGG - Intergenic
1095184806 12:39189320-39189342 GAATGAGGGCAAGGAACACCTGG - Intergenic
1095186014 12:39201070-39201092 GAATGAGGGCAAGGAACACCTGG - Intergenic
1095617318 12:44206311-44206333 GAATGACGGCAAGGAAAACCTGG - Intronic
1095780940 12:46058953-46058975 GAATGAGGGCAAGGAACACCTGG - Intergenic
1095912562 12:47443698-47443720 GAATCATGGCAAGGAACACCTGG - Intergenic
1095913104 12:47448615-47448637 GAATGAGTGCAAGGAACACCTGG - Intergenic
1095967218 12:47877083-47877105 GAATGAGTGAAAGAAACACAAGG + Intronic
1096125061 12:49113110-49113132 GAATGAGGGCAAGGAACACCTGG - Intergenic
1096308345 12:50498692-50498714 GAATGAGGGCAAGGAACACCTGG - Intergenic
1096441952 12:51650708-51650730 GAATGAGGGCAAGGAACACCTGG + Intronic
1096442011 12:51651114-51651136 GAATGAGAGCAAGGAACACCTGG - Intronic
1096450261 12:51734559-51734581 GAATGACGGCAAGGAACACCTGG - Intronic
1096450891 12:51740120-51740142 GAATGAGGGCAAGGAACACCTGG - Intronic
1097137742 12:56873147-56873169 GAATGAGGGCAAGGAACACCTGG - Intergenic
1097199862 12:57269269-57269291 GAATAAGGGAAGGGCACACCAGG - Intronic
1097492305 12:60285204-60285226 GAATGAGGGCAAGGAACACCTGG - Intergenic
1097548187 12:61031374-61031396 GAATGAGGGCAAGGAACACCCGG - Intergenic
1097816096 12:64075370-64075392 GCAAGAGGGCAAGGAACACCTGG - Intronic
1098246607 12:68525411-68525433 GAATGAGGGCAAGGAATACCTGG + Intergenic
1099608288 12:84833339-84833361 GAATTAGGGAGAGGAACACAAGG + Intergenic
1099749400 12:86753228-86753250 GAATGAGGGCAAGGAACACCCGG + Intronic
1099787503 12:87285099-87285121 GAATGAGGGCAAGGAACACCTGG - Intergenic
1100306104 12:93351648-93351670 GAATGAGGGCAAGGAATACCTGG - Intergenic
1100414266 12:94355714-94355736 GAACGAGGGCAAGGAACACCTGG + Intronic
1100414672 12:94358946-94358968 GAATGAGGACAAGGAATACCTGG + Intronic
1100472490 12:94905849-94905871 GAATGAAGGCAAGGAACACCTGG + Intronic
1101223179 12:102661631-102661653 GAATGAGGGCAAGGAACACCTGG - Intergenic
1101223868 12:102668036-102668058 GAATGAGGGCAAGGAACACCTGG - Intergenic
1101501587 12:105309101-105309123 GAATGAGGGCAAGGAACACCTGG - Intronic
1101767041 12:107711283-107711305 GAATGAGGGCAAGGAACGCCTGG - Intronic
1101992234 12:109495843-109495865 GAATGAGGGCAAGGAACACCTGG - Intronic
1102322246 12:111946564-111946586 GAATGAGGGCAAGGAACACCTGG - Intronic
1102608779 12:114092284-114092306 GAATGAGGGCAAGGAACACCTGG + Intergenic
1102667963 12:114592218-114592240 GAATGAGGGCAAGAAACACCTGG + Intergenic
1103231872 12:119338138-119338160 GAATGTGAGCTAGGAACCCCTGG - Intronic
1103412049 12:120719413-120719435 GAATGAGTGCAAGGAACACAGGG - Intronic
1103735541 12:123058562-123058584 GAATGACAGCAGGGAACAGCAGG - Intronic
1103830399 12:123774744-123774766 GAATGAGGGCAAGGAACACCTGG - Intronic
1104226144 12:126835854-126835876 GAATGAGGGCAAGGAACACCTGG + Intergenic
1104446302 12:128836328-128836350 GAATGAGGGCAAGGAAAACCTGG + Intergenic
1105282622 13:18977224-18977246 GAATGAGGGCAAGGAACACCTGG + Intergenic
1105352241 13:19626452-19626474 GAATGAGGGCAAGGAACACCTGG + Intergenic
1105352756 13:19630848-19630870 GAATGAGGGCAAGGAACACCTGG + Intergenic
1105469359 13:20678593-20678615 GGAGCAGGGCAAGGAAAACCTGG - Intronic
1105470046 13:20685261-20685283 GGAGCAGGGCAAGGAAAACCTGG - Intronic
1105697481 13:22903092-22903114 GAATGAGGGTAAGGAACACCTGG + Intergenic
1105738519 13:23297626-23297648 GAATGAGGTCAAGGAAAACCTGG - Intronic
1105856085 13:24373386-24373408 GAACGAGGGCAAGGAACACCTGG + Intergenic
1106416793 13:29552553-29552575 GAATGAGGGCAAGGAACACCTGG + Intronic
1106421287 13:29588464-29588486 GCAGGAGTGCAAGGAACTCCTGG - Intronic
1106646815 13:31643880-31643902 GAATGAGGGCAAGGAACACTTGG + Intergenic
1106710178 13:32322596-32322618 GAATGAGGGCAAGGAACACCTGG - Intronic
1107933975 13:45329436-45329458 GGCTGAGGGCAAGGAACATGAGG + Intergenic
1108402716 13:50063412-50063434 GAATGAGGACAAGGAACACCTGG + Intergenic
1108602375 13:52005949-52005971 GAATGAAGGCAAGGAACACCTGG + Intronic
1108837180 13:54565450-54565472 GAACTAGTGCAAGGAACAACTGG + Intergenic
1108876829 13:55058501-55058523 GTATGAGGGCTAGGTACAGCTGG - Intergenic
1108972332 13:56392876-56392898 GAATGAGGGCAAGGAACACCTGG - Intergenic
1109095270 13:58106469-58106491 GAATGAGGGCAAGGAACACTTGG - Intergenic
1110027874 13:70565059-70565081 GAAAGAAGGCAAGGAACACCTGG + Intergenic
1110434519 13:75464306-75464328 GAACGAGGGCAAGGAACACTTGG + Intronic
1110652007 13:77952511-77952533 GAATGAGGGCTAGGAAAATGAGG - Intergenic
1111056515 13:82957534-82957556 GAATAAGGGCAAGGAACACTTGG - Intergenic
1111173458 13:84560969-84560991 GAATGAGGGCAAGGAACACCTGG + Intergenic
1111277015 13:85963588-85963610 GAATGAGGGCAAGGAACACCTGG - Intergenic
1111362631 13:87195146-87195168 GAATGAGGGCAAGGAATACCTGG + Intergenic
1111387475 13:87545540-87545562 TAATGAGGGCAAGGAACACCTGG + Intergenic
1111415929 13:87943945-87943967 GAATGGGGGCAAGGAACACCTGG - Intergenic
1111447924 13:88374140-88374162 GAATGAGGGCAAGGAACACCTGG + Intergenic
1111690068 13:91552721-91552743 GAATGAGGGCAAGGAACACCTGG - Intronic
1111812963 13:93115150-93115172 GAATGAGGGCAAGGAATACCTGG + Intergenic
1111868122 13:93795436-93795458 GAGTGAGGGCTAGGAAAACGAGG - Intronic
1113727355 13:112615162-112615184 GAATCAGGGCTAGGAACGCGTGG - Intergenic
1113830040 13:113288546-113288568 GAATGAGGGCAAGGAACACCTGG - Intergenic
1113923187 13:113925948-113925970 GAATGAGGGCAAGGAACGCCTGG + Intergenic
1114028869 14:18557593-18557615 GAATGAGAGCAAGGAACACCTGG - Intergenic
1114562376 14:23602727-23602749 GAACGAGGGCAAGGACCAGAGGG - Intergenic
1114622561 14:24105271-24105293 GAATGAGGGCAAGGAACACATGG - Intronic
1114677706 14:24455254-24455276 GAATGAGGGCAAGGAACACCTGG - Intergenic
1115128349 14:30023447-30023469 GAATGAGGGCAAGGAACACCTGG + Intronic
1115500415 14:34044520-34044542 GAATGATGGCAAGGAGAACACGG + Intronic
1115959463 14:38819369-38819391 GAATGAGGGCAAGTAACACCTGG + Intergenic
1116027659 14:39534704-39534726 GAATGAGGGTAAGGAACGCCTGG - Intergenic
1116232561 14:42235744-42235766 GAATGAGGGCAAGGAACACCTGG + Intergenic
1116238785 14:42314039-42314061 GAATGACAGCAAGGAACACCTGG - Intergenic
1116664268 14:47754689-47754711 GAATGAGGGCAAGGAACACCTGG - Intergenic
1116672469 14:47861169-47861191 GAATGAGGGCAAGGAACACCTGG + Intergenic
1117082259 14:52164724-52164746 GAATGAGGGCAAGGAACACCTGG + Intergenic
1117083150 14:52172214-52172236 GAATTAAGACAAGGAACACCTGG + Intergenic
1118538299 14:66793042-66793064 GAATGAGGGCAAGGAACACCTGG - Intronic
1118587623 14:67370179-67370201 GAATGAGGGCAAGGAACACCTGG - Intronic
1118949930 14:70426813-70426835 GAATGAGGGCAAGGAACACCTGG - Intergenic
1118959306 14:70514236-70514258 ACATGAGTGCAAGGAACAGCTGG - Intergenic
1119025611 14:71149879-71149901 GAATGAGAGCAAGGAACACCTGG + Intergenic
1119138763 14:72245578-72245600 GAATGAGGGCAAGGAACACCTGG - Intronic
1119562367 14:75601278-75601300 GAATGAGGGCAAGGAACACCTGG - Intronic
1119881516 14:78103558-78103580 AGATGAGGCCAAGGAACACACGG - Intergenic
1120261294 14:82189214-82189236 GAATGAGGACAAGGAATACCTGG + Intergenic
1120323421 14:82994708-82994730 GAATGAGGGCAAGGAACACCTGG + Intergenic
1120421145 14:84287578-84287600 GAATGAGGGCAAGGAACACCTGG + Intergenic
1120480741 14:85046478-85046500 GAATGAGGGCAAGGAACACCTGG + Intergenic
1121445907 14:93978775-93978797 AAATGAGGGCTCTGAACACCAGG - Intergenic
1121498466 14:94414354-94414376 GAATGAGGGCAAGGAACATCTGG + Intergenic
1121677934 14:95769633-95769655 GAATGAGGGCAAGGAACATCTGG - Intergenic
1122652684 14:103234128-103234150 GAATGAGGGCAAGGAACACCTGG + Intergenic
1122653280 14:103239103-103239125 GAATGAGGGCAAGGAACACCTGG + Intergenic
1123177807 14:106438279-106438301 GAATGAGGGCAAGGAACACCTGG + Intergenic
1202843904 14_GL000009v2_random:149222-149244 GAATGAGAACAAGGAATACCTGG - Intergenic
1202872210 14_GL000225v1_random:175450-175472 GAATGAGGGCAAGGGATTCCAGG - Intergenic
1202879353 14_KI270722v1_random:43223-43245 GAATGAGGACAAGGAATACCTGG + Intergenic
1123673449 15:22684188-22684210 GAATGAGGGCAAGGAACACCTGG - Intergenic
1123788498 15:23695975-23695997 GAATGAAGGCAAGGAACACCTGG - Intergenic
1123789136 15:23701817-23701839 GAATGAGGGCAAGGAACACCTGG - Intergenic
1123891371 15:24783463-24783485 GGATGAGGGCAAGGAACACCTGG - Intergenic
1124020832 15:25921481-25921503 GAATGAGGGCAAGGAACACCTGG - Intergenic
1124176879 15:27434694-27434716 CATTGAGGGCAGTGAACACCTGG + Intronic
1124325452 15:28757173-28757195 GAATGAGGGCAAAGAACACCTGG - Intergenic
1124969822 15:34476357-34476379 GAAGTAGGGCAAGGAAGACAAGG - Intergenic
1125211377 15:37219308-37219330 CAATGAGGGCCAGGAGAACCTGG - Intergenic
1125527738 15:40388741-40388763 GAATGAGGGCTAGGAACACCTGG - Intronic
1126687624 15:51262077-51262099 AAATGAGGGCAAGGAACACCTGG + Intronic
1126841921 15:52725638-52725660 GAATGAGGGCAAGGAACATCTGG - Intergenic
1126955441 15:53928419-53928441 GAATGAGGGCAAGGAACACCTGG - Intergenic
1127346469 15:58105830-58105852 GTATCAGGCAAAGGAACACCAGG + Intronic
1127360063 15:58237444-58237466 GAATGAGGGCAAGGAACACCTGG + Intronic
1127768383 15:62210054-62210076 GGAGCAGGGCAAGGAACGCCTGG - Intergenic
1128835326 15:70804740-70804762 GAATGAGGGCAAGGAACACCTGG + Intergenic
1129066357 15:72907807-72907829 GAAGGAGGGAAAGGAATTCCTGG + Intergenic
1129072543 15:72963228-72963250 GAATGAGGGCAAGGAACACCTGG - Intergenic
1129313072 15:74725742-74725764 GGGTGAGGGCTGGGAACACCTGG + Intergenic
1129384837 15:75190547-75190569 GAATGAGGGCAAGGAATACCTGG + Intergenic
1130009888 15:80142890-80142912 GAATGAGGGCAAGGAACACCTGG - Intergenic
1130017108 15:80196101-80196123 GAATGAGGACAAGGGATACAGGG - Intergenic
1130096941 15:80862907-80862929 GACTGAGGGCAGGGAAAACTGGG + Intronic
1130999228 15:88925112-88925134 GAATGAGGGCAAGGAACACCTGG + Intergenic
1131011116 15:89019243-89019265 GAATGAGGACAAGAAACGCGAGG + Intergenic
1131037625 15:89234074-89234096 GAATGAGGGCAAGCAATACCTGG - Intergenic
1131038296 15:89240154-89240176 GAATAAAGGCAAGGAAAACCTGG - Intergenic
1131165552 15:90139756-90139778 GAATGAGAGCAAGGAACACCTGG - Intergenic
1132193262 15:99888258-99888280 GAATGAGGGCAGGGACCACCTGG + Intergenic
1132695432 16:1199746-1199768 GGCTGAGGGCAGGGAACCCCGGG - Intronic
1132909580 16:2301941-2301963 GGTTGTGGGCAAGGAACACCTGG + Intronic
1132984501 16:2757397-2757419 GAATGAGGGAAATGGAAACCTGG + Intronic
1133044207 16:3077198-3077220 GAATGAGGGCAAGGGACACCTGG - Intronic
1133044711 16:3081404-3081426 GAATGAGGGCAAGGAACACCTGG - Intronic
1133223858 16:4330911-4330933 GAATGAGGGCAAGGAACACCTGG + Intronic
1133936338 16:10272467-10272489 AAATGAGGGCAAGGAACACCTGG - Intergenic
1133953401 16:10418268-10418290 GAATGAGGGCAAGGAACACCTGG - Intronic
1134013773 16:10874361-10874383 GAATGGGGGCAAAGAGCACGAGG - Intergenic
1134256136 16:12613195-12613217 GAATGAGGGCTAGGAAAATGAGG - Intergenic
1134315528 16:13115529-13115551 GAATGAGGGCAAGGAACACCTGG - Intronic
1134757508 16:16681198-16681220 GAGTCAGGGGAAGGAACTCCAGG + Intergenic
1134988560 16:18677968-18677990 GAGTCAGGGGAAGGAACTCCAGG - Intergenic
1135789422 16:25379828-25379850 GAATGAGGGCAAGGAACACCTGG + Intergenic
1135934536 16:26768424-26768446 GGATGAGGGCAAGGAAAGGCAGG - Intergenic
1136638287 16:31539847-31539869 GAATGAGGGCAAGGAACACCTGG + Intergenic
1136638668 16:31543017-31543039 GAATGAGGGCAAGGAACACCTGG + Intergenic
1136644875 16:31604735-31604757 GAATGAGGGCAAGGAACACCTGG - Intergenic
1136659110 16:31739821-31739843 GAATGAGGGCAAGGAACACCTGG + Intronic
1136743339 16:32559866-32559888 GAACGATGGAAAGGAACACCAGG - Intergenic
1136746314 16:32595028-32595050 TAATGATTGCAAGGAACAACTGG - Intergenic
1136922224 16:34342931-34342953 GAATGATGGCAAGGAACACCTGG + Intergenic
1136982349 16:35068875-35068897 GAATGATGGCAAGGAACACCTGG - Intergenic
1136983656 16:35081403-35081425 GAATGAGGGCAAGGAAAACCTGG - Intergenic
1137004628 16:35262881-35262903 GAATGAAGGCAAGGAACACCTGG + Intergenic
1137301500 16:47152604-47152626 GAATGTGGGCAAGAAACAACTGG + Intergenic
1137328874 16:47470427-47470449 GAATGAGGGCAAGGAACACCTGG - Intronic
1137341984 16:47617008-47617030 GAATGAGGGCAAGGAACACCTGG - Intronic
1138841125 16:60508054-60508076 GTATGAGTGCAAGGAACACCTGG + Intergenic
1139081336 16:63525124-63525146 GAATGCGGGCAAGGAACACCTGG + Intergenic
1139223009 16:65203943-65203965 GCATGAGGGCAAGGAACTGCAGG + Intergenic
1139644789 16:68320567-68320589 GAATGAGGGCAAGGAATACCTGG - Intronic
1140432068 16:74912941-74912963 GAATGAGGGCAAGGAACACCTGG - Intronic
1140680625 16:77381408-77381430 GAAGCAGGGAAAGGAACAGCAGG - Intronic
1142135194 16:88448725-88448747 GAGTGAGGGGAAGGGACCCCAGG - Intergenic
1142161394 16:88559396-88559418 AAAAAAGGGCAGGGAACACCAGG - Intergenic
1142357287 16:89607618-89607640 GGAGCAGGGCAAGGAACACCTGG + Intergenic
1142371413 16:89685019-89685041 GAATGAGGGCAAGGAACACCTGG + Intronic
1142416742 16:89947326-89947348 GAATGAGGGCAAGGAACACCTGG + Intergenic
1203026260 16_KI270728v1_random:515363-515385 GAACGATGGAAAGGAACACCAGG + Intergenic
1203045461 16_KI270728v1_random:819068-819090 GAACGATGGAAAGGAACACCAGG - Intergenic
1203048443 16_KI270728v1_random:854232-854254 TAATGATTGCAAGGAACAACTGG - Intergenic
1142475412 17:185961-185983 GAATGAGGGCAAGGAACACCCGG + Intergenic
1143430103 17:6875507-6875529 GAATGAGGGCAAGGAACACCTGG - Intergenic
1143430738 17:6881378-6881400 GAATGAGGGCAAGGAACACCTGG - Intronic
1144473660 17:15565700-15565722 GAAGGAGGAGAAGGAGCACCAGG - Intronic
1144506788 17:15838385-15838407 GAATGAGGACAAGGAACACCTGG + Intergenic
1144922864 17:18779109-18779131 GAAGGAGGAGAAGGAGCACCAGG + Exonic
1145170970 17:20656320-20656342 GAATGAGGACAAGGAACACCTGG + Intergenic
1145219982 17:21080407-21080429 GAATGAGGGCAAGGAACACCTGG - Intergenic
1145259906 17:21348548-21348570 GAATGGGGGAAATGAACACTGGG + Intergenic
1145281264 17:21468563-21468585 GAATGAGGGCAAGGAACACCTGG + Intergenic
1145316710 17:21739390-21739412 GAATGGGGGAAATGAACACTGGG - Intergenic
1145800961 17:27684381-27684403 GAATGAGGGCAAGGAACACCTGG + Intergenic
1145802944 17:27702255-27702277 GAATGAGGGCAAGGAACATCTGG + Intergenic
1146038837 17:29432368-29432390 AAATGAGGGCAAGGAACACCTGG - Intronic
1146101348 17:29985742-29985764 GAAAGAGGGCAAGGAACACCTGG - Intronic
1146150317 17:30463010-30463032 GAATGAAGGCAAGGAACACCTGG - Intronic
1146293886 17:31633232-31633254 GAATGAGGGCAAGGAACACCTGG + Intergenic
1146294447 17:31638653-31638675 GAATGAGGGCAAGGAACACCTGG + Intergenic
1146525637 17:33564782-33564804 GAATGGGGGCAAGGAACACCTGG + Intronic
1147251348 17:39154284-39154306 GAGTGAGGGCGAGGAGCTCCGGG - Intronic
1147719298 17:42528780-42528802 GAATGAGGGCAAGGAACACGTGG - Intergenic
1147791373 17:43016087-43016109 GAATGTGGGCAAGGTCCTCCTGG - Exonic
1147793777 17:43028629-43028651 GAATGAGGGCGAGATACACAAGG + Exonic
1148639020 17:49171004-49171026 GAATAAGGGCAAGGAACACCTGG - Intergenic
1149139713 17:53417248-53417270 GAAGGAGGGCAAGGAACACCTGG - Intergenic
1149783489 17:59416681-59416703 GAATGAGGGCAAGGAACATCGGG + Intergenic
1150439215 17:65177782-65177804 GAATGAAGTCAAGGTAAACCAGG + Exonic
1150992948 17:70282087-70282109 GAAGGAGGGCAAGGAACACCTGG + Intergenic
1151574268 17:74943739-74943761 GTTTCAGGGCAAGGAAGACCTGG - Intronic
1151725355 17:75880703-75880725 CAGAGAGGGCCAGGAACACCGGG - Intronic
1151893409 17:76964337-76964359 GATGCAGGGCAGGGAACACCTGG + Intergenic
1152064264 17:78101822-78101844 GAATGAGGGCAAGGAACACCAGG - Intronic
1152768482 17:82153505-82153527 GAAGGAGGGCATGGATCACAGGG + Intronic
1153134789 18:1903371-1903393 GAATGAGGGCAAGGAACACCTGG - Intergenic
1153351636 18:4087341-4087363 GAATGAGGGCAAGGAACACCTGG + Intronic
1153892247 18:9528464-9528486 GAATGAGAGCAAGGAACATGTGG - Intronic
1153941462 18:9982145-9982167 GAATGAGAGCAAGGAACAACTGG + Intergenic
1153970298 18:10220269-10220291 GAATGAGGGCAAGGAACATCTGG - Intergenic
1153970862 18:10225822-10225844 GAATGAGGGCAAGGAACATCTGG - Intergenic
1155316662 18:24578364-24578386 GAAAGAGGCCAAGGAATTCCAGG - Intergenic
1156094859 18:33517118-33517140 GAATGAGGGCAAGGAACACCTGG + Intergenic
1156315937 18:35968680-35968702 GAATGAGGGCAAGCAACACCTGG + Intergenic
1156789394 18:40953448-40953470 GAATGGGGAAAAGGAACACTTGG - Intergenic
1157377277 18:47178081-47178103 GAATGAGGGCAAGGAATACCTGG - Intergenic
1157671279 18:49530871-49530893 GAATGAGGGCAAGGAACACCTGG - Intergenic
1157710932 18:49849268-49849290 GTTTGAGGGCAGGGACCACCAGG + Intronic
1157900346 18:51508972-51508994 GAATGATGGCAAGGAACACCTGG - Intergenic
1158087616 18:53671765-53671787 GAATGAGGGCAAGGAACACCTGG + Intergenic
1158579053 18:58665534-58665556 GAATGAGGGCTTGGAACACTAGG - Intergenic
1159195662 18:65110848-65110870 GAATGAAGGCAAGGAACACCTGG - Intergenic
1159696999 18:71573136-71573158 GAATGAGGGCAAGGAACACCTGG + Intergenic
1159937595 18:74381578-74381600 GAATGAGGGCAAGGAACACCTGG - Intergenic
1161016618 19:1986668-1986690 CAGTGAGGTCAAGGACCACCAGG + Intronic
1161040026 19:2105355-2105377 GAATGAGGGCAAGGAACACCTGG + Intronic
1161717058 19:5882174-5882196 GAGTGTGGGCTGGGAACACCTGG + Intronic
1161823740 19:6547811-6547833 GAGTGAGGGCAAGGAACACCTGG - Intergenic
1162252996 19:9462246-9462268 GAATGAGGGCAAGGAACACCTGG + Intergenic
1162270293 19:9609012-9609034 GAATGAGGGCAAGGAACACCTGG + Exonic
1162275583 19:9651572-9651594 GAATGAGGGCAAGCAACACCTGG + Intronic
1162283307 19:9717814-9717836 GAATGAGGACAAGGAACACCTGG - Intergenic
1162642418 19:12022133-12022155 GAATGAAGGCAGGGAACACCTGG + Intronic
1162643011 19:12027453-12027475 GAATGAGGGCAAGGAACACCTGG + Intronic
1162652262 19:12098689-12098711 GAATGAGGGCAAGGAACACCTGG - Intronic
1162652867 19:12104140-12104162 GAATGAGGGCAAGGAACGCCTGG - Intronic
1162673391 19:12278128-12278150 GAATGAGGGCAAGGAACACCTGG + Intronic
1162743843 19:12788536-12788558 GGAGGAGGGCAAGGAACAGTGGG - Intronic
1163895725 19:20057252-20057274 GAATGAGGGCAAGGAACACCTGG + Intergenic
1164024481 19:21338737-21338759 GAATGAGGGCAAGGAACACCTGG - Intergenic
1164025169 19:21345138-21345160 GAATGAGGGCAAGGAACACCTGG - Intergenic
1164031652 19:21412374-21412396 GAATGAGGGCAAGGAATACCTGG - Intronic
1164032340 19:21418866-21418888 GAATGAGGGCAAGGAACACCTGG - Intronic
1164041630 19:21497755-21497777 GAATGAGGGCAAGGAACATCTGG - Intronic
1164051601 19:21588701-21588723 GAATGAGGGCAAGGAACACCTGG + Intergenic
1164060287 19:21666926-21666948 GAATGAGGGCAAGGAACACCTGG - Intergenic
1164060968 19:21673250-21673272 GAATGAGGGCAAGGAACACCTGG - Intergenic
1164230723 19:23285450-23285472 GAATGAGGGCAAGGAACACCTGG + Intergenic
1164251192 19:23477215-23477237 GAATGAGGGCAAGGAGCACCTGG - Intergenic
1164256413 19:23532198-23532220 GGAGCAGGGCAAGGGACACCTGG + Intronic
1164257339 19:23540315-23540337 GGAGCAGGGCAAGGAACACCTGG + Intronic
1164261647 19:23572943-23572965 GAATGAGGGCAAGGAACACCTGG - Intronic
1164277802 19:23736987-23737009 GAATGAGGGCAAGGAACACCTGG + Intergenic
1164289259 19:23852634-23852656 GAATGAGGGCAAGGAACACCTGG - Intergenic
1164295304 19:23904499-23904521 GAACGAGGGCAAGGAACACTTGG + Intergenic
1164322629 19:24163538-24163560 GAATGAGGGCAAGGAACACCTGG - Intergenic
1165301195 19:34970420-34970442 GAATGAGAGCAAGGAACACCTGG - Intergenic
1165402015 19:35607247-35607269 GAATGAGGGCAAGGAACACCTGG + Intergenic
1165445171 19:35852738-35852760 GTATCAGGGCAAGGAAGAGCTGG - Intronic
1165865632 19:38935524-38935546 GAATGAGGGCAAGGAACACCTGG - Intronic
1165866323 19:38941686-38941708 GAACGAGGGCGAGGAACACCTGG - Exonic
1166201907 19:41243121-41243143 GAATGAGGGCAAGGGAAGCCAGG + Intronic
1166315743 19:41988508-41988530 GAACAAGGGCAAGGAGCGCCGGG - Exonic
1166459244 19:42971643-42971665 GAGTGAGGGCTAGGAAAACGAGG + Intronic
1167123878 19:47536169-47536191 GAATGAGGGCAAGGAACACCTGG - Intronic
1167177952 19:47878867-47878889 GAAACAGGGCAATGAAGACCAGG + Intronic
1167346447 19:48948450-48948472 GAATGAGGGCAAGGAATCCCTGG + Intergenic
1167863107 19:52300963-52300985 GGAGCAGGACAAGGAACACCTGG - Intronic
1167863825 19:52307849-52307871 GGAGAAGGGCAAGGAACACCTGG - Intronic
1167879269 19:52442266-52442288 GAATGATGGCAAAGAACACCTGG + Intronic
1167917680 19:52755422-52755444 GAATGAGGGCAAGGAACACCTGG - Intergenic
1168189177 19:54725575-54725597 GAAGCAGTGCAAGGAACAACAGG + Intronic
1202654975 1_KI270708v1_random:12232-12254 GAATGAGGACAAGGAATACCTGG + Intergenic
925023594 2:590460-590482 GAATGACGGTAAGGAACACCTGG - Intergenic
925821312 2:7802208-7802230 GAAAGAGAGCAAGCAACAGCAGG - Intergenic
926860489 2:17303718-17303740 GAAGGAGGGCAAGGCAGAGCTGG - Intergenic
927117847 2:19922877-19922899 GAATGAGGGCAAGGAACACCTGG + Intronic
927118462 2:19928129-19928151 GAATGAGGGCAAGGAACACCTGG + Intronic
927641462 2:24848190-24848212 AAATGAGGACAAGGAACACCTGG + Intronic
928329059 2:30343508-30343530 GAATGAGGGCAAGGAACACCTGG - Intergenic
928671740 2:33609987-33610009 GAATGAGGGCAAGGAACACCTGG + Intergenic
928702595 2:33914393-33914415 GAATGAGGGCAAGGAACACCTGG - Intergenic
928703153 2:33919373-33919395 GAATGAAGGCAAGAAACACCTGG - Intergenic
928975485 2:37082522-37082544 GAATGAGGGCAAGGAACACCTGG + Intronic
930183100 2:48384645-48384667 GAATGAGGGCAAGGAACACCTGG + Intergenic
930183752 2:48390272-48390294 GAATGAGGGCAAGGAAAACCTGG + Intergenic
930316549 2:49803048-49803070 CAATGAGGGCAAGGAACACCTGG - Intergenic
930512922 2:52368605-52368627 TAAAGAGGGCAAGGAACAGATGG - Intergenic
930629224 2:53734073-53734095 GAATGAGGGCAAGGGACACCTGG - Intronic
930873038 2:56185844-56185866 CAATGAGAGGAAGGAATACCAGG - Intronic
930918598 2:56723839-56723861 GAATGAGGGCAAGGAACACATGG + Intergenic
930993525 2:57687891-57687913 GAATGAGGGTGACGAACACCTGG + Intergenic
931359994 2:61570084-61570106 GAATGAGGGCAAGGAACACCTGG + Intergenic
931415848 2:62079545-62079567 GAGTGAGGGCAAGGAAAATGAGG - Intronic
932384420 2:71318161-71318183 GAATGAGGGCAAGGAACACCTGG - Intronic
933011402 2:77068861-77068883 GAATGAGGGCAAGGAACACCTGG + Intronic
933230675 2:79803587-79803609 GAATGAGGGCAAGGAACACCTGG - Intronic
933420123 2:82034311-82034333 GAATGAGGGCAAGGATCACCTGG - Intergenic
933500943 2:83110096-83110118 GAAGGAGGACAAGGAACACCTGG - Intergenic
934931745 2:98431453-98431475 GAATGAGTGCAAGGAACACCTGG - Intergenic
935025317 2:99271012-99271034 GAATGAGGGAAAGGAACACCTGG - Intronic
935026103 2:99278424-99278446 GAATGAGGGCAAGGAACAGCTGG - Intronic
935138923 2:100333767-100333789 GAACGAGCACAAGGAACACCTGG + Intergenic
935240632 2:101175103-101175125 GAATGAGGGCAAGGAACACCTGG - Intronic
935520254 2:104095742-104095764 GAATGAGGGCAAGGAACACCTGG - Intergenic
935646252 2:105337656-105337678 GAGTGAGGAGAAGGAACTCCTGG - Exonic
935747838 2:106204675-106204697 GGATGAGGGCAGGGCACAGCAGG + Intergenic
935915243 2:107942753-107942775 GAATGAGGGCAAGGAACACCTGG - Intergenic
935915855 2:107948512-107948534 GAATGAGTGGAAGGAACATCTGG - Intergenic
936171790 2:110183258-110183280 GAATGAGGGAAAGGAACACCTGG + Intronic
936485685 2:112923689-112923711 GACTGTGGGCAAGGAACAAGGGG - Intergenic
936771158 2:115915062-115915084 GAATGAGGGCAAGGAACACCTGG + Intergenic
936799574 2:116251483-116251505 GAATGACGGCAAGGAACACCTGG + Intergenic
937170980 2:119868583-119868605 GAATGAGGGCAAGGAACACCTGG + Intronic
937610255 2:123852716-123852738 AAATGAGGGCAAGGAACAGCTGG + Intergenic
937951508 2:127391376-127391398 GAATGAGGGAAAGAAACAGAGGG - Intergenic
938747300 2:134291670-134291692 GAATGAGGGCAAGAGACATATGG + Intronic
940301192 2:152177787-152177809 GAATGAGGGCAAGGAACCCCTGG + Intergenic
940301623 2:152181295-152181317 GAATGACAGCAAGGAACACCTGG - Intergenic
940310503 2:152273988-152274010 GAATGAGGGCAAGGAACACCTGG - Intergenic
940311089 2:152279610-152279632 GAATGAGGGCAAGGAACACCTGG - Intergenic
940887812 2:159005120-159005142 GAATGAGGGCAAGGAACAACTGG - Intronic
941239095 2:163014819-163014841 GAATGAGGGCAAGGAACATCTGG + Intergenic
941249637 2:163146388-163146410 GAATGAGGGCAAGGAACACCTGG - Intergenic
941258106 2:163259182-163259204 GAAGGAGGGCAAGGAACAGCTGG - Intergenic
941331534 2:164183453-164183475 GCATAACGGCAAGGAACACAGGG - Intergenic
941990750 2:171554590-171554612 AAATGAGGGCCCCGAACACCAGG - Exonic
942215754 2:173717751-173717773 GACTGAGGGAGAGGAACATCTGG - Intergenic
942837742 2:180320503-180320525 GAATGAGGGCAAGGAACACCTGG + Intergenic
943062554 2:183053615-183053637 GAATGAGGGCAAGAAACACCTGG - Intergenic
943255173 2:185585408-185585430 GAATGAGGTCAAGGAATACCTGG - Intergenic
943286501 2:186008068-186008090 GAATGAGGGCAAGGAACACCTGG + Intergenic
943466127 2:188231191-188231213 GAATGAGGGCAAGGAACACCTGG - Intergenic
943801025 2:192057523-192057545 AAATGAGGGCAAGGAATTTCTGG - Intronic
943901770 2:193447805-193447827 GAATGAGGGCAAGGAACACCTGG - Intergenic
943903679 2:193472190-193472212 GAATGAGGGCAAGGAACACCTGG + Intergenic
944148152 2:196528506-196528528 GAATCAGGGGCAGAAACACCAGG + Intronic
944480411 2:200152136-200152158 GAATGAACGCAAGAAACACCTGG + Intergenic
944496602 2:200313478-200313500 GAATAAGGGAAAGGAAGACAAGG - Intronic
944586547 2:201178514-201178536 GAATGAGGGCAAGGAACACCTGG - Intergenic
945292338 2:208138551-208138573 GAATGAGGACAAGGAACACCTGG - Intergenic
945672321 2:212817037-212817059 GAATGAGGGACAGGGAAACCAGG - Intergenic
945790917 2:214304333-214304355 GAATGAGGGCAAGGAACACCTGG + Intronic
945993848 2:216419531-216419553 GAGTGAGGACCAGGATCACCAGG - Intronic
946206462 2:218112386-218112408 GAATGAGGGCAAGGAACACCTGG + Intergenic
946210673 2:218144696-218144718 GAATGAGGGCAAGGAACACCTGG + Intergenic
946380751 2:219347163-219347185 GAATGAGGGCAAGGAACACCTGG - Intergenic
946435760 2:219651830-219651852 GAATGAGGGCAAGGAATACCTGG + Intergenic
946975019 2:225138998-225139020 GAATGAGGGCAAGGAACACCTGG - Intergenic
947903489 2:233742442-233742464 GAATAAGGGCAAGGAACACCTGG - Intronic
947977982 2:234384254-234384276 GAATGAGGGCAAGGAACACCTGG + Intergenic
948399059 2:237669791-237669813 GAATGAGCTCATGGAACAGCCGG - Intronic
948418133 2:237831990-237832012 GAATAAGGGGAATGAACACAGGG - Intronic
1168936705 20:1671876-1671898 GAATGAGGGCAAGGAACACCTGG - Intergenic
1169404016 20:5308316-5308338 GAATGAGGGCAAGGAACACCTGG + Intronic
1169672304 20:8115950-8115972 GAAAGAGAGCAAGGTACCCCTGG + Intergenic
1169830904 20:9823725-9823747 GAGAGAGGGCAAGTAACACATGG - Intronic
1171214492 20:23342304-23342326 AAATGGGGGCAAGGTACACAAGG + Intergenic
1171228973 20:23467055-23467077 GAATTAGGGCAAGGAACACCTGG + Intergenic
1172715784 20:36962445-36962467 GAATGAGGGCAAGGAACACCTGG + Intergenic
1173066810 20:39721144-39721166 CAATGAGGGCAAGGAACACCTGG + Intergenic
1173067432 20:39726762-39726784 CAATGAGGGCAAGGAACACCTGG + Intergenic
1173444162 20:43102970-43102992 AACTGATGGCAAGGAAGACCTGG + Intronic
1173504426 20:43575754-43575776 GATTAAGGGGAAGGAACAGCTGG + Intronic
1174388078 20:50198547-50198569 GAATGAGGGGAGGGCTCACCAGG + Intergenic
1174559141 20:51417483-51417505 GAGTGAGGGGAAGGAATTCCAGG - Intronic
1174822987 20:53743656-53743678 GAACGAGGCCCAGGTACACCAGG + Intergenic
1174888441 20:54362448-54362470 GAAGTAGGGCAAGTAAAACCTGG - Intergenic
1175059037 20:56224916-56224938 GAATGAGGGCAAGGAACACCTGG + Intergenic
1175732984 20:61366730-61366752 GAATGAGGGCAAGGAACACCTGG - Intronic
1176632657 21:9154142-9154164 GAATGAGAACAAGGAATACCTGG - Intergenic
1176640657 21:9300687-9300709 GAATGAGGACAAGGAATACCTGG + Intergenic
1177316628 21:19470777-19470799 GGATGAGGGCAAGGAACACCCGG + Intergenic
1177419574 21:20838871-20838893 GAATGAGGGCAAGGAATACCTGG + Intergenic
1177624816 21:23646259-23646281 GAATGAGGCACATGAACACCTGG + Intergenic
1177683843 21:24410934-24410956 GAATGAGGGCAAGGAACACCTGG - Intergenic
1178102542 21:29285348-29285370 GAATGAGGTCAAGGAACCATTGG - Intronic
1178321564 21:31610129-31610151 GAATGAGGGCAAGGGACACCTGG - Intergenic
1178423778 21:32462672-32462694 GAATGAGGGCAAGGAACACCTGG + Intronic
1178438216 21:32578067-32578089 GAATGATGGCAAGGAACACCTGG - Intronic
1178617412 21:34146033-34146055 GAATGAGGGAAAGGAACACCTGG - Intergenic
1179957087 21:44747347-44747369 GAATGAGGGTGAGGAACACCTGG - Intergenic
1180285888 22:10744034-10744056 GAATGAGGGCAAGGGATTCCAGG + Intergenic
1180349682 22:11790070-11790092 GAATGAGGACAAGGAATACCTGG + Intergenic
1180373968 22:12073516-12073538 GAATGAGGACAAGGAATACCTGG + Intergenic
1180388521 22:12202169-12202191 GAATGAGGACAAGGAACACCTGG - Intergenic
1180452989 22:15484655-15484677 GAATGAGAGCAAGGAACACCTGG - Intergenic
1181172882 22:21019939-21019961 GAATGAGGGCAAGGAAAACCTGG - Intronic
1181593745 22:23900338-23900360 GAATGAGGGCAAGGAACACCTGG + Intergenic
1181784273 22:25215222-25215244 GAATGAGGGCAAGGAACACCTGG + Intergenic
1182226880 22:28805646-28805668 AAATGAGGGCAAGGAACACCTGG - Intergenic
1182913436 22:34006593-34006615 GAATGAGGGCAAGGAACACCTGG - Intergenic
1183058392 22:35320597-35320619 GAAAGATGGGAAGGACCACCTGG - Intronic
1183066516 22:35367228-35367250 TAATGAGAGCAAAGATCACCTGG + Intergenic
1183794821 22:40108000-40108022 GATTGTTGGCAAGGAAAACCTGG + Intronic
949235956 3:1808267-1808289 GAATGAGGGCAAGGAACTCCTGG - Intergenic
949304939 3:2629171-2629193 TAATAAGGGGAAGGAACATCAGG + Intronic
949606154 3:5656646-5656668 CCATGAGGGCAAGGATCACTTGG - Intergenic
949651666 3:6167097-6167119 GAATGAGGACAAGGAACACCTGG - Intergenic
950699330 3:14729322-14729344 AGATGTGGGGAAGGAACACCAGG + Intronic
951256691 3:20458121-20458143 GAATGAGGGCAAGGAACACCTGG - Intergenic
951270133 3:20614731-20614753 GAATGAGGGCAAGGAACACCTGG - Intergenic
951270756 3:20620338-20620360 GAATGAGGGCAAGGAACACCTGG - Intergenic
951821916 3:26823381-26823403 GAATGAGGGCAAGGAACACCTGG - Intergenic
951948753 3:28174023-28174045 GAATGGGGGCCAGGAATAGCTGG - Intergenic
952162326 3:30706321-30706343 GAATAAAGGTAAGGAACACGTGG + Intergenic
952517431 3:34119987-34120009 GAATGAGAACAAGGAACACCTGG + Intergenic
952930758 3:38359317-38359339 GAATGAGGGCAAGGAACACCTGG - Intronic
952938456 3:38420888-38420910 AGAGCAGGGCAAGGAACACCTGG + Intronic
952939054 3:38426887-38426909 AGAGCAGGGCAAGGAACACCTGG + Intergenic
953723438 3:45376686-45376708 GAATGAGGGTAAGGAACACCTGG - Intergenic
953731104 3:45448802-45448824 GAATGAGGGCAAGGAACACCTGG - Intronic
953835005 3:46334807-46334829 GAATGAGGGCAAGGAACACCTGG + Intergenic
954233079 3:49233818-49233840 GAATGAGGGCAAGGAACACTTGG + Intronic
954507040 3:51086302-51086324 GAATGAGGGCAAGGAACACCTGG - Intronic
954769295 3:52951784-52951806 GAATGAGGGCAAGGAACACCTGG - Intronic
955632287 3:60987339-60987361 GAATGAGGGCAAGGAACACCTGG + Intronic
955638154 3:61053075-61053097 GAATGAGGACTAGAAGCACCAGG + Intronic
956030434 3:65031192-65031214 AAAGGAGGACAAGGAACACTAGG + Intergenic
956545547 3:70397402-70397424 GACTGAGTGGAAGGATCACCTGG - Intergenic
956709975 3:72030521-72030543 GAATGAGGGCAAGGAACACCTGG - Intergenic
956943593 3:74194070-74194092 GAATGAGGGCAAGGAACATCTGG + Intergenic
956981771 3:74647414-74647436 GAATGAGGGCAAGGAACACCTGG - Intergenic
957099512 3:75809986-75810008 GAATGAGGGCAAGGAACACCTGG - Intergenic
957365059 3:79212142-79212164 GAATGAGAGCAAGGAACACCTGG - Intronic
957491146 3:80928991-80929013 GAATGAGAGCAAGGAACACCTGG + Intergenic
957600021 3:82321748-82321770 GAATGAGGGCAAGGAACACCTGG + Intergenic
957675718 3:83361561-83361583 GAATGAGGGCAAAGAACACCTGG + Intergenic
958474447 3:94563191-94563213 GAATGAGGGCAAGGAACACCTGG - Intergenic
958738887 3:98043772-98043794 GAATGAGGGCAAGGAACACCTGG - Intergenic
959198508 3:103215594-103215616 GAATGAGGGCAAGGAAGACCTGG + Intergenic
959276335 3:104281783-104281805 GAATGAGGGCAAGGAATACCTGG - Intergenic
959276897 3:104287318-104287340 GAATGAAGGCAAGGATCACCTGG - Intergenic
959574280 3:107917680-107917702 GAATGAGGGCAAGGAACACTTGG - Intergenic
960015740 3:112885614-112885636 GAAAGAGGGTAAGGAACACCTGG + Intergenic
960676310 3:120198762-120198784 AAATGAGGTCAAGAAACAACAGG - Intronic
960788440 3:121399724-121399746 GAATGAGGGCAAGGAACACCTGG - Intronic
961265386 3:125637560-125637582 GAATGAGGGTAAGGAACACCAGG - Intergenic
961323136 3:126092225-126092247 GAATGAGGGCAAGGAACACCTGG + Intronic
961323627 3:126096510-126096532 GAATGAGGGCAAGGAACACCTGG + Intronic
961690034 3:128662769-128662791 GAATGAGGGCAAGGAACACCTGG - Intronic
961853986 3:129850963-129850985 GAATGAGGGCAAGGAACACCTGG - Intronic
961859226 3:129901366-129901388 TAATGAGGGCAAGGAGCACCTGG + Intergenic
961859822 3:129906930-129906952 TAATGAGGGCAAGGAACACCTGG + Intergenic
962022460 3:131514419-131514441 GAATGAGGGCAAGGAACACCTGG + Intergenic
963415106 3:144984759-144984781 GAATGAGGGCAAGGAACACCTGG - Intergenic
963511423 3:146252557-146252579 GAGTGAGGGTGAGGAACACCTGG + Intergenic
963538414 3:146557008-146557030 ACATGAGGGCAAGGAACACCTGG + Intergenic
963879939 3:150517769-150517791 GAATGAGGGCAAGGAACACCTGG + Intergenic
963995247 3:151701385-151701407 AAATGAGGGCAAGGAACATCTGG + Intergenic
964135450 3:153340335-153340357 GAATGAGGGCGAGGAACACCTGG + Intergenic
964197589 3:154082381-154082403 GAATGAGGGCAAGAAACACCTGG - Intergenic
964275388 3:155004036-155004058 GAATGAGGGCAAGGAACACCTGG + Intergenic
964957099 3:162373841-162373863 GAATGAGGGCAAGGAACACCTGG + Intergenic
965314661 3:167177133-167177155 GAATGAGGGCAAGGAACACCTGG - Intergenic
965315397 3:167183755-167183777 GAATGAGGGCAAGGAACACCTGG - Intergenic
965557302 3:170031736-170031758 GAATGAGGGCAAGGAACACCTGG - Intergenic
966008942 3:175052246-175052268 GAATGAGGGCAGGGAACACCTGG - Intronic
966009475 3:175056868-175056890 GAATGAGGGCAAGGAACACCTGG - Intronic
966059739 3:175740420-175740442 GAATGAGGGCTAGGAAAATGAGG + Intronic
966272932 3:178130480-178130502 GAATGAAGGCAAGGAACACCTGG - Intergenic
966296048 3:178424578-178424600 GAATGAAGGCAAGGAACACCTGG - Intronic
966495742 3:180578339-180578361 GAATGACGGCAAGGAACACCTGG + Intergenic
966506119 3:180703634-180703656 GAATGAGGGCAAGGAACACCTGG + Intronic
966967795 3:185013137-185013159 GAATGAGGGCAAGGAACATCTGG - Intronic
966968504 3:185019657-185019679 GAATGAGGGCAAGGAACACCTGG - Intronic
966978210 3:185105333-185105355 GAATGAGGGCAAGGAACACCTGG + Intronic
966978806 3:185110668-185110690 GAATTAGGGCAAGGAACACCTGG + Intronic
967179984 3:186895335-186895357 GAATGAGGGCAAGGAACACCTGG + Intergenic
968054330 3:195679657-195679679 TAATGAGGGCAAGGAACACCTGG + Intergenic
1202746236 3_GL000221v1_random:104337-104359 GAATGAGGACAAGGAATACCTGG - Intergenic
968424153 4:510402-510424 GAATGAGGGTAAGGAACACCTGG - Intronic
968855117 4:3114253-3114275 GAATGAGGGCAAGGAACACCTGG - Intronic
969123376 4:4926368-4926390 GAATGACAGCAAGGAACAACTGG + Intergenic
969832114 4:9806252-9806274 GAATGAGGTCAAGGAACACTTGG + Intronic
969895794 4:10303327-10303349 GGAGCAGGGCAAGGAACGCCTGG - Intergenic
970391918 4:15620761-15620783 GAATGAGGGCAAAGAACACCTGG + Intronic
970422285 4:15916582-15916604 GAATGAGGGCAAGGAACACCTGG - Intergenic
970772683 4:19634329-19634351 GAATGAGGGCAAGAAACACCTGG + Intergenic
970986541 4:22165819-22165841 GAATGATGGAAAGGAGCACATGG - Intergenic
971333022 4:25698046-25698068 GAATGAGGGCAAGGAACACCTGG - Intergenic
971813919 4:31462830-31462852 GAATGAGGGCAAGGAACACCTGG + Intergenic
971871480 4:32245724-32245746 GAATGAGGGCAAGGAACACCTGG + Intergenic
971873431 4:32273835-32273857 GAATGAGGGCAAGGAACACCTGG - Intergenic
971917531 4:32892746-32892768 GAATGAGGGCAAGGAACACCTGG + Intergenic
971976747 4:33699584-33699606 GAATGAGAGCAAGGAACACCTGG + Intergenic
972080125 4:35139868-35139890 GAAAGAGGGCAAGGAACACCTGG + Intergenic
972080662 4:35144829-35144851 GAATGAGGGCAAGGAACACTTGG + Intergenic
972291906 4:37697453-37697475 GAATGAGGATAAGAAAAACCTGG - Intergenic
972360177 4:38319338-38319360 GAAGTAGGGCAAGGAAAGCCCGG - Intergenic
972444491 4:39130399-39130421 GAATGAGGGTAAGGAACACCTGG - Intergenic
972460645 4:39299042-39299064 GAATGAGGGCAAGGAACACCTGG + Intronic
972655464 4:41059520-41059542 GAATGAGGGCAAGGAACACCTGG + Intronic
972931717 4:44080065-44080087 GAATGAGGGCAAGGAACACCTGG - Intergenic
972947305 4:44271597-44271619 GAATGAGGGCAAGGAACACCTGG + Intronic
973008343 4:45042178-45042200 GAATGAGGGTAAGGAACACCTGG + Intergenic
973009022 4:45048642-45048664 GAATGAGGGCAAGGAACACCTGG + Intergenic
973274616 4:48293673-48293695 GAATGAGAGCAAGGAACACCTGG - Intergenic
973982419 4:56317180-56317202 CAAGGAGCGCAAGGACCACCTGG - Intronic
974095597 4:57360469-57360491 GAATTAGGGCAAGGAACACCTGG + Intergenic
974235170 4:59171865-59171887 GAATGAGGGCAAGGAACACCTGG + Intergenic
974535076 4:63164172-63164194 GAATGAGGGCAAGGAACACCTGG - Intergenic
974581197 4:63804164-63804186 GAATGAGGGCAAGGAACACCTGG - Intergenic
974635749 4:64562762-64562784 GAATGAGGGCAAGGAACACCTGG + Intergenic
974636456 4:64569440-64569462 GAATGAGGGCAAGGAACACCTGG + Intergenic
974753322 4:66170605-66170627 GAATGAGGGCAAGGAACACTTGG - Intergenic
974767063 4:66360578-66360600 GAATGAGGGCAAGGAACTCCTGG + Intergenic
974974178 4:68869541-68869563 GAGTGAGGGCAAGGAACACCTGG - Intergenic
974981174 4:68959328-68959350 GAATGAGGGCAAGGAAGACCTGG - Intergenic
975092992 4:70425099-70425121 GAATGAGGGCAAGGAACACCTGG + Intergenic
975225198 4:71863664-71863686 GAATGAGGGCAAGGAGCACCTGG + Intergenic
975226816 4:71882289-71882311 GAGTGAGGGCTAGGAAAACAAGG + Intergenic
975351982 4:73357272-73357294 GAATGAGGGCAAGGAACATCTGG + Intergenic
975353303 4:73369890-73369912 GAACGAGGGCAAAGAACACCTGG + Intergenic
975412461 4:74069909-74069931 GAATGAGGGCAAGGAACACCTGG - Intergenic
975575484 4:75858310-75858332 GAATGAGGGCAAGGAACATCTGG - Intergenic
975580062 4:75898179-75898201 GAATGAGGGCAGGGAACATCTGG - Intronic
976045196 4:80938321-80938343 GAATGAGGGCAAGGAACACCTGG + Intronic
976128494 4:81858529-81858551 GAATGACGGCAAGGAACACCTGG - Intronic
976179590 4:82386590-82386612 GAATGAGGGCAAGGAACACCTGG - Intergenic
976264017 4:83173370-83173392 GGATGAGGGCAAGGAACACCCGG - Intergenic
976549614 4:86379541-86379563 GAATGAGGGCAAGGAACACCTGG + Intronic
976556882 4:86460651-86460673 GAATAAGGGCAAGCAACACCTGG + Intronic
976857816 4:89626081-89626103 GAATGAGGGCTAGGAAAATTAGG + Intergenic
976977335 4:91181042-91181064 GAATGAGGGCAATGAACATCTGG - Intronic
976977963 4:91186874-91186896 GAATGAGGGCAAGGAACACCTGG - Intronic
977016295 4:91696500-91696522 GAATGAGGGCAAGGAACATCTGG - Intergenic
977016881 4:91701853-91701875 GAATTAGGGCAAGGAACACCTGG - Intergenic
977358666 4:95978302-95978324 GAATGAGGGCGAGGAACACCTGG + Intergenic
977443234 4:97097243-97097265 GAATGAGGGCAAGAAACAACTGG - Intergenic
977443794 4:97102453-97102475 GAATGAGGGCAAGGAACACCTGG - Intergenic
977489779 4:97697743-97697765 AAATGAGGGCAAGTAACACCTGG + Intronic
977625688 4:99187486-99187508 GGATGAGGTCAAGGAACACCTGG - Intergenic
977626130 4:99191390-99191412 GAATGAGGGCAAGGAACACCTGG - Intergenic
977638461 4:99328114-99328136 GAATGAGGGCAAGGAACACCTGG - Intergenic
977641903 4:99367182-99367204 GAATAAGAGCAAGGAACACCTGG + Intergenic
977642513 4:99372750-99372772 GAATGAGGGCAAGGAACACCTGG + Intergenic
977653759 4:99498315-99498337 GAATGAGGGAAAGGAACACCTGG - Intergenic
977851900 4:101840498-101840520 GAATGAGGGTAAGAAGCACCTGG + Intronic
977857322 4:101909592-101909614 GAATGAGGGCAAGGAAAACCTGG - Intronic
978011564 4:103691702-103691724 GAATGAGGGCAAGGAACACCCGG + Intronic
978032413 4:103951271-103951293 GAATGAGGGCAAGGAACACCTGG - Intergenic
979149090 4:117285514-117285536 GAATGAGGGCAAGGAACACCTGG + Intergenic
979982264 4:127271787-127271809 GAATGAGGGCAAGGAACACCTGG - Intergenic
979982851 4:127277322-127277344 GAATGAGGGCAAGGAACACCTGG - Intergenic
980244982 4:130227101-130227123 GAATGAAGGCAAGGAATACCTGG + Intergenic
980334441 4:131452573-131452595 TAATGAGGGCTAGGAACTTCAGG - Intergenic
980667765 4:135960874-135960896 GAATGAGGGCAACGGACACCTGG - Intergenic
980762656 4:137255949-137255971 GAATGATGGCAAGGAACACCTGG - Intergenic
981197447 4:141938227-141938249 GAATGAGGGCAAGAAACACCTGG - Intergenic
981197827 4:141941470-141941492 GAATGAGGGCAAGAAACACCTGG - Intergenic
981813865 4:148806511-148806533 GAATAAGGGCAAGGAACACCTGG - Intergenic
981917841 4:150053982-150054004 GAATGCAGGCAAGGAACACCTGG + Intergenic
982108952 4:152035715-152035737 GAATGAAGGCAAGGAAGAGCAGG + Intergenic
982281585 4:153688726-153688748 GAATGAGGGCAAGGAACACCTGG - Intergenic
982282147 4:153694278-153694300 GAATGAGGGCAAGGAACACCTGG - Intergenic
982482459 4:155929006-155929028 GAATTAGGGCAAGGAACACCTGG + Intronic
982519318 4:156393265-156393287 GAATGAGGGCAAGGAACACCTGG + Intergenic
982882385 4:160735485-160735507 GAATGAGGGTAAGGAACACCTGG - Intergenic
983548869 4:168994330-168994352 GAATGAGGGCAAGGAACACCTGG - Intronic
983567926 4:169174385-169174407 TAATGAGGGCACGAATCACCTGG + Intronic
983594750 4:169453551-169453573 GAATGAGGGCAAGGAACACCTGG + Intronic
983972594 4:173893125-173893147 GAATGAGGGCAAGGAACACCTGG - Intergenic
984060427 4:174983181-174983203 GGAGCAGGGCAAGGAACACCTGG - Intergenic
984061165 4:174990450-174990472 GCAGCAGGGCAAGGAACACCTGG - Intergenic
984110736 4:175610307-175610329 GAATGAGGACATGGAACACCTGG - Intergenic
984148211 4:176090997-176091019 GAATGAGGGCAAGGAACACCTGG - Intronic
984169560 4:176343868-176343890 GAATGAGGGCAAGGAACACCTGG + Intergenic
984170247 4:176350386-176350408 GAATGAGGGCAAGGAACACCTGG + Intergenic
984280336 4:177662934-177662956 GAATGATGGCAAGGAATACCTGG - Intergenic
984363426 4:178767645-178767667 GAATGAGGGCAAGGAACACCTGG + Intergenic
984510148 4:180669208-180669230 GACTGGGGGCAGGGAACCCCAGG - Intergenic
984763027 4:183378618-183378640 GAATGAGGGCAAGGAACACCTGG - Intergenic
984903375 4:184604599-184604621 GAATGAGGGCAAGGAACACCTGG + Intergenic
984955878 4:185045154-185045176 GAATGAGGGCAAGGAACACCTGG - Intergenic
984956586 4:185051530-185051552 GAATGAGGGCAAGGAACACCTGG - Intergenic
984964013 4:185125707-185125729 GAATGAGGGCAAGGAACACCTGG + Intergenic
985050018 4:185980639-185980661 GAATGAGGGCAAGAAACACCTGG + Intergenic
1202755553 4_GL000008v2_random:58955-58977 GAATGAGGACAAGGAATACCTGG + Intergenic
985500627 5:242310-242332 GAATGAGGGCAAGGGACACCTGG + Intronic
985501394 5:249453-249475 GAATGAGGGCAAGGGACACCTGG + Intronic
985545016 5:505074-505096 GAATGAGGGGATGGAATCCCGGG + Intronic
985614198 5:909897-909919 GAATGAGGGCAAGGGACACCTGG - Intronic
985625804 5:986270-986292 GAATGAGGGCAAGGAACACCTGG - Intergenic
985735488 5:1578182-1578204 GAATGAGGGCAAGGGACACCTGG - Intergenic
985736763 5:1587385-1587407 GAATGAGGGCAAGGAACACCTGG - Intergenic
985810082 5:2076205-2076227 GAATGAGGGACAGCAGCACCTGG + Intergenic
986467239 5:8037891-8037913 GAATGAAGGCAAGGAATAGCTGG - Intergenic
986954641 5:13136171-13136193 GAATGAGGGCAAGGAACACCAGG - Intergenic
987080186 5:14419061-14419083 GAAGGAGGGAAAGGAACGTCAGG + Intronic
987573972 5:19702839-19702861 GAATGAGAGCAAGGAACACCTGG + Intronic
987574588 5:19708592-19708614 GAATCAGGACAAGGAACACCTGG + Intronic
988206193 5:28138425-28138447 GAATGAGGGCTAGGAAAATGAGG - Intergenic
988344090 5:30014385-30014407 CAATGAGGGCAGGGAACACCTGG - Intergenic
988810675 5:34782114-34782136 AAATAAGGGCAAGGAACACCTGG - Intronic
988811238 5:34787083-34787105 GAATGAGGGTAAGGAACACCTGG - Intronic
989046618 5:37280174-37280196 GAATGAAGGCAAGGAACACCTGG - Intergenic
989065211 5:37453523-37453545 GAATGAGGGCAAGGAACACCTGG - Intronic
989116547 5:37959410-37959432 GAATGAGGGCAAGGAACACCTGG + Intergenic
989154669 5:38332823-38332845 GAATGAGGGCAAGGAACACCTGG - Intronic
989345544 5:40425391-40425413 GAATGAGGGCAAGGAACACCTGG + Intergenic
989426161 5:41298275-41298297 GAATGACCACAAGGAACACCTGG - Intergenic
989742395 5:44788708-44788730 GAATGAGGACAAGGAACACCTGG + Intergenic
989742888 5:44793149-44793171 GAATGAGGGCAAGGAACACCTGG + Intergenic
989758577 5:44986050-44986072 GAATGAGGGCAAGGAACACGTGG + Intergenic
989759048 5:44989950-44989972 GAATGAGGGCAAGGAACACCTGG + Intergenic
989783357 5:45297308-45297330 GAATGAGGACAAGGAACACCTGG - Intronic
990109323 5:52304614-52304636 GAATGAGGGCAAGGAATACCTGG + Intergenic
990109893 5:52309845-52309867 GAATGAGGGCAAGGAACACCTGG + Intergenic
990306488 5:54498579-54498601 GAATGAGGGCAAGGAACACCTGG - Intergenic
990307221 5:54505277-54505299 GAATGAGGGCAAGGAACACCTGG - Intergenic
990712681 5:58603320-58603342 CAAGAAGCGCAAGGAACACCTGG - Intronic
990886417 5:60599630-60599652 GAATGAGGGCAAGGAACACCTGG + Intronic
991570464 5:68048336-68048358 GAATGAGGGCAAGGAACACCTGG - Intergenic
992250314 5:74869551-74869573 GAATGAGGGCAAGGAACACCTGG + Intergenic
992351393 5:75932711-75932733 GGAGCAGGGCAAGGAAAACCTGG - Intergenic
992430984 5:76711599-76711621 GAATGAGCGCAAGGAACACCTGG + Intergenic
992447257 5:76845298-76845320 GAATGAGTGCAAGGAACACCTGG + Intergenic
992623751 5:78618360-78618382 GAATTTGGGCAAGGAGCAGCTGG + Intronic
992995512 5:82328763-82328785 GAATGAGGGCAAGGAACACCTGG + Intronic
993020234 5:82583429-82583451 GAATGAGGGCAAGGAACACCTGG + Intergenic
993021821 5:82601231-82601253 GGAGCAGGGCAAGGAACACCTGG + Intergenic
993222068 5:85111548-85111570 GAATGAGGGCAAGGAACACCTGG + Intergenic
993405762 5:87510461-87510483 GAATGAGGGCAAGGAAAACCTGG + Intergenic
993406723 5:87519997-87520019 GAATGAGGGCAAGGAACACCTGG + Intergenic
994305901 5:98203849-98203871 GAATGTGGGCAAGGAACACCTGG + Intergenic
994419026 5:99509344-99509366 GAATGAGGGCAAGGAACACCAGG - Intergenic
995145620 5:108784860-108784882 GAATGAGGGCAAGAAACACCTGG - Intronic
995195120 5:109358189-109358211 GAATGAGGGCAAGGAACACCTGG + Intronic
995450999 5:112300650-112300672 GAAGGAGCTCAAAGAACACCTGG - Intronic
995592254 5:113712050-113712072 GAATGAGGGCAAGGAACACCTGG + Intergenic
995592728 5:113716234-113716256 AAATGAGGGCAAGGAATACCTGG + Intergenic
995605930 5:113854941-113854963 GAATGAGGGCAAGGAACACTTGG + Intergenic
995665695 5:114539553-114539575 GAATGAGGGCAAGGAACAGCTGG + Intergenic
995666900 5:114552787-114552809 GAATGAGGGCAAGGAACACCTGG - Intergenic
995711077 5:115036426-115036448 GAATGAGGGCAAGGAACACCTGG - Intergenic
995711685 5:115042129-115042151 GAATGAGGGTGAGGAACGCCTGG - Intergenic
995959403 5:117821550-117821572 GAATGAGGGCAAGGAACACCTGG + Intergenic
995969611 5:117952321-117952343 GGCTGAGGGCAAGGGGCACCTGG + Intergenic
996175508 5:120351176-120351198 GAATAAGGGCAAGGAACACCTGG + Intergenic
996192386 5:120561801-120561823 GAATGAGGGCAAAGAGAAACAGG - Intronic
996270412 5:121597455-121597477 GAATGAGGGCAAGGAACACTTGG + Intergenic
996291874 5:121860788-121860810 GAATGAGGGCAAGGAACACCTGG - Intergenic
996934470 5:128932537-128932559 GAATGAGGGCAAGGAACACCTGG - Intronic
997073427 5:130643532-130643554 GAATGAGGGCAAGGAACACCTGG - Intergenic
997099483 5:130953227-130953249 GAATGAGGGCTAGGAAAATGAGG - Intergenic
997393414 5:133535368-133535390 GAATGAGGGCAAGGAACACCTGG + Intronic
997680262 5:135745365-135745387 GAATGAGGGCAAGGAACACGTGG - Intergenic
998073591 5:139218304-139218326 GAATGAGGGCAAGGAACACCTGG - Intronic
998343039 5:141434464-141434486 GAATGAGGGCAAGGAACACCTGG + Intronic
999285475 5:150391901-150391923 AAATTAGGGCAAGTAAGACCTGG - Intronic
999392089 5:151200630-151200652 GAATGAGGAAAAGGAAATCCTGG + Intronic
999552541 5:152704900-152704922 GAATGAGGGCAAGGAATACCTGG + Intergenic
1000210996 5:159105812-159105834 GACTGTGGGCAAGGGCCACCGGG - Intergenic
1000588122 5:163125091-163125113 GAATGAGGGCAAGGAACACCTGG + Intergenic
1000725792 5:164769275-164769297 GAATGAGGGCAAGGAACACCTGG - Intergenic
1002406822 5:179040725-179040747 GAATGAGGGCAAGGAACACCTGG + Intergenic
1003191983 6:3882329-3882351 GAATGGGGGCAAGGAACACCTGG - Intergenic
1003196149 6:3916845-3916867 GAATGAGGGCAAGGAACACCTGG + Intergenic
1003433960 6:6068446-6068468 GAATGAGGGCAAGGAACACCTGG - Intergenic
1003761604 6:9184818-9184840 GAATGAGGGCAAGGAACACCTGG + Intergenic
1003783063 6:9451275-9451297 GATTGAGGGCAAGGCAGGCCAGG - Intergenic
1004010421 6:11680774-11680796 GAATGAGGGCAAGGAAAACCTGG - Intergenic
1004373830 6:15075083-15075105 GAAGGATGGCCAGCAACACCAGG - Intergenic
1004482869 6:16037749-16037771 GAATGAGGGCAAGGAACACCTGG + Intergenic
1004529598 6:16441096-16441118 GGGTGAGGGCAAGGAACCCTGGG + Intronic
1004725831 6:18310301-18310323 GAATGAGGGCAAAGAACACCTGG - Intergenic
1004778822 6:18882041-18882063 GAATGAGGGCAAGGAACGCCTGG - Intergenic
1005185505 6:23159690-23159712 GAATGAGGGCAAGGAACACCTGG + Intergenic
1005515452 6:26550318-26550340 GAGTGAGGGCTAGGAAAACGAGG - Intergenic
1005668684 6:28082615-28082637 GAATGAGGGCAAGGAACACCTGG - Intronic
1005683058 6:28225619-28225641 GACTCAGGGAAAGAAACACCCGG + Intronic
1005780558 6:29187171-29187193 GAATGAGGGCAAGGAACACCTGG + Intergenic
1005858383 6:29881678-29881700 GAATGAGGGCAAGGAACACCTGG - Intergenic
1005865928 6:29936524-29936546 GAATGAGGGCAAGGGACACCTGG - Intergenic
1005999215 6:30952472-30952494 AGATCAGGCCAAGGAACACCAGG - Exonic
1006038782 6:31235944-31235966 GAATGGGGGCAAGGAACACCTGG - Intergenic
1006050488 6:31339115-31339137 GAATGAGGGCAAGGAACACCTGG - Intronic
1006250040 6:32775740-32775762 GAATGAGGGCAAGGAACACCTGG + Intergenic
1006724797 6:36190234-36190256 GAATGAGGGAAAACAACAGCAGG - Intergenic
1006989330 6:38199868-38199890 GAATGGGGGCAAGAAAAGCCTGG + Intronic
1007035282 6:38667484-38667506 GAATGAGGGCAAGGAACACCTGG + Intergenic
1007610513 6:43145930-43145952 GGGTGAGGGCAAGGACCAGCTGG - Intronic
1007886451 6:45235857-45235879 GAATGAAGGCAAGGAATACCTGG + Intronic
1007887017 6:45241325-45241347 GAATGAGGGCAAGGAATACCTGG + Intronic
1007998171 6:46330638-46330660 GAAGGAAGAGAAGGAACACCAGG - Intronic
1008077683 6:47162852-47162874 GACTGAGGGCAGGCAACACTTGG - Intergenic
1008093204 6:47313043-47313065 GAATGAGGGCAAGGAACACCTGG - Intergenic
1008093641 6:47316624-47316646 GAATAAGGGCAAGGAACACCTGG - Intergenic
1008190684 6:48453312-48453334 GAATGAGGGCAAGGAATACCTGG - Intergenic
1008587645 6:52963695-52963717 GAATGAGGGCAAGGAACACCTGG + Intergenic
1009062353 6:58413053-58413075 GAATGAAGGCAAGAAACAACTGG - Intergenic
1009063014 6:58419556-58419578 GAATGAGGGTAAGGAACTCCTGG - Intergenic
1009250038 6:61287617-61287639 GAATGAAGGCAAGAAACAACTGG - Intergenic
1009250692 6:61294105-61294127 GAATGAGGGTAAGGAATTCCTGG - Intergenic
1009261580 6:61497066-61497088 GAATGAGGGCAAGGAACACCTGG - Intergenic
1009640706 6:66331626-66331648 GAATGAGGGCAAGGAACACCTGG - Intergenic
1009642842 6:66360819-66360841 GAATGAGGGCAAGGCACACCTGG + Intergenic
1009737938 6:67703179-67703201 GAATGAGGGCAAGGAACACCTGG - Intergenic
1009753317 6:67901126-67901148 GAATGAGGGCAAGGAACACCTGG + Intergenic
1009955238 6:70445711-70445733 GAATGAGGGCAAGGAACACCTGG - Intronic
1009955620 6:70448902-70448924 GAATGAGGGCAAGAAACACCTGG - Intronic
1009980720 6:70722832-70722854 GAATGAAGGCAAGGAACACCTGG - Intronic
1010433662 6:75806617-75806639 GAATGAGGGCAAGGAACACCTGG + Intronic
1010796022 6:80117594-80117616 GGATGAGGGCAAGGAACACCTGG + Intronic
1010872814 6:81063136-81063158 GAATGAGGGCAAGGAACACCTGG + Intergenic
1011572538 6:88754691-88754713 GAATGAGGTCAAGGAACACCTGG + Intronic
1011774329 6:90711547-90711569 CAATGAGGCCAAGGAAAAGCAGG - Intergenic
1011969053 6:93198550-93198572 GAATGAGGGCAAGGAACACCTGG - Intergenic
1013030561 6:106328395-106328417 GAATGAGGGCAAGGAACACCTGG + Intergenic
1013255896 6:108385319-108385341 GAATGAGGGCAAGGAACACCTGG + Intronic
1013475046 6:110499303-110499325 GAATGAGGGCAAGGAACACCTGG + Intergenic
1013475728 6:110505689-110505711 GAATGACGGCAAGGAACACCTGG + Intergenic
1013519172 6:110916881-110916903 GAATGCGGGCAAGGAACACCTGG + Intergenic
1013739209 6:113263769-113263791 GAATGAGGGCGAGGAAAACCTGG - Intergenic
1013739741 6:113268344-113268366 GAATGACGGCAAGGAACACCTGG - Intergenic
1014719634 6:124900509-124900531 GAATGAGGGCAAGGAACACCTGG - Intergenic
1014863877 6:126504995-126505017 GAAAGAGGGCAAGGAACACCTGG + Intergenic
1015347625 6:132178588-132178610 GAATGAGGGCAAGGAACACCTGG + Intergenic
1015466994 6:133558774-133558796 GAATGAGGGCAAGGAACACCTGG - Intergenic
1015825376 6:137305465-137305487 GAATGAGGGCAAGGAACACCTGG - Intergenic
1015839044 6:137456600-137456622 GAATGAGGGCAAGGAACACCTGG + Intergenic
1016346682 6:143120893-143120915 GAATGAGGGCAAGGAACACCTGG + Intronic
1016835657 6:148474082-148474104 GATTGAGGACAAAGAACAACAGG - Intronic
1016849430 6:148601816-148601838 GAATGAGGGCAAGGAACACCTGG + Intergenic
1017140183 6:151183050-151183072 GAATGAGGGCAAGGAATACCTGG + Intergenic
1017373311 6:153737891-153737913 GAATGAGGGCAAGGAACACCTGG - Intergenic
1017835824 6:158176982-158177004 GAATGAGGGCAAGGAACACCTGG - Intronic
1018576488 6:165265010-165265032 AAATGAGGACAAGACACACCGGG + Intergenic
1018594498 6:165463796-165463818 GAATGAGGGCAAGGAATACCTGG + Intronic
1018652689 6:166005337-166005359 CAAGGACGGCATGGAACACCTGG - Intergenic
1019233715 6:170590489-170590511 GAATGAGGGCAAGGAACACCTGG - Intergenic
1020054839 7:5110468-5110490 GAATGAGGGCAAGGAACACCTGG - Intergenic
1020337140 7:7070864-7070886 GAATGAGGGCAGGGAACACCTGG - Intergenic
1021418358 7:20416547-20416569 GAATGAGGGCAAGGAACACCTGG - Intergenic
1021574090 7:22091756-22091778 GAATGAGGGCGAGGAAAACGAGG - Intergenic
1022390369 7:29938546-29938568 GAATCAGGGCAAGGAACACCTGG + Intronic
1022540381 7:31129306-31129328 GCCTGGGGGCAAGGAACAGCTGG - Intergenic
1022802533 7:33789959-33789981 TAATGGGGTAAAGGAACACCTGG - Intergenic
1023009394 7:35912246-35912268 GAATGAAGGCAAGGAACACCTGG + Intergenic
1023242898 7:38167919-38167941 GAATGAGAGCAAGGAACACCTGG - Intergenic
1023403788 7:39810906-39810928 GAATGAGGGCAAAGAAAACCTGG - Intergenic
1023436584 7:40146679-40146701 GAATGAGGGCAAGGAACACCTGG - Intronic
1023804236 7:43860044-43860066 AAATGAGGACAAGGAACACCTGG - Intergenic
1023804770 7:43864836-43864858 GAATGAGGACGAGGAACACCTGG - Intergenic
1023834246 7:44059096-44059118 GAGTGAGGAGAAGGGACACCTGG + Intronic
1023960662 7:44923340-44923362 GAATAAGGGCAAGGAACACCTGG - Intergenic
1024065168 7:45726619-45726641 GAATGAAGGCAAGGAACACCTGG - Intergenic
1024101670 7:46038547-46038569 GAATGAGGGCAAGGAACACCTGG - Intergenic
1024102355 7:46045000-46045022 GAATGAGGGCAAGGAACACCTGG - Intergenic
1024138386 7:46434009-46434031 GAATGAGGGCAAGGAACACCTGG - Intergenic
1024271738 7:47647633-47647655 TAACGAGGGCAAGGGATACCAGG + Intergenic
1024312803 7:47984983-47985005 GAATGAGGGCAAGGAACACCTGG + Intergenic
1024327442 7:48120698-48120720 GAATGAGGGCAAGGAATATCTGG + Intergenic
1024394013 7:48845754-48845776 GAATGAGGGCAAGGAACACCTGG + Intergenic
1024401228 7:48926659-48926681 GAATGAGGGCAAGGAACACCTGG - Intergenic
1024419146 7:49141841-49141863 GAATGAGGGCGAGGAACACCTGG - Intergenic
1024495693 7:50043024-50043046 GAATGAGGGCAAGGAACACCTGG + Intronic
1024712593 7:52033863-52033885 GAACGAGGGCAAGGAACACCTGG - Intergenic
1024911147 7:54448969-54448991 GAATGACGGCAAGGAACACCTGG + Intergenic
1024912038 7:54457337-54457359 GAATGAGGGCAAGGAATACCTGG - Intergenic
1025102210 7:56145023-56145045 GAATGAGGGCAAGGAGCACCTGG + Intergenic
1025103620 7:56153070-56153092 GAATGACGGCAAGGAACACCTGG + Intergenic
1025122488 7:56317067-56317089 GAATGAGGGCAAGGAACACCTGG + Intergenic
1025123064 7:56322399-56322421 GAATGAAAGCAAGGAACACCTGG + Intergenic
1025728440 7:64088955-64088977 GAATGAGGGCAAGGAACACCTGG - Intronic
1025743395 7:64221294-64221316 GAATGAGAGCAAGCAACACCTGG - Intronic
1025803191 7:64806987-64807009 GAATAAGGGCAAGGCACACCTGG + Intronic
1025809221 7:64863620-64863642 GAATGAGGACAAGAAACACCTGG + Intergenic
1025819672 7:64950426-64950448 GAATGAGAGCGAGGAACACCTGG + Intergenic
1026005104 7:66594145-66594167 GAATGAGGGCAAGGAACACCTGG + Intergenic
1026014576 7:66663021-66663043 GAATGAGGGCAAGAAACACCTGG + Intronic
1026268102 7:68813023-68813045 GAATGAGGGCAAGGAACACCTGG - Intergenic
1026446439 7:70488521-70488543 GACTGAGGAGAAAGAACACCAGG - Intronic
1026872266 7:73860342-73860364 GAATGAGGGCAAGGAACACCTGG - Intergenic
1027518119 7:79167899-79167921 GAATGAGGGCAAGGAACACCCGG + Intronic
1028309983 7:89319098-89319120 GAACGAGGGCAAGGAACACCTGG - Intronic
1028732350 7:94166009-94166031 GAATGAGGGCAAGGGACACCTGG + Intergenic
1028779728 7:94722652-94722674 GAATGAGGGCAAGGAACACCTGG - Intergenic
1028780427 7:94729159-94729181 GAATGAGGGCAAGGAACACCTGG - Intergenic
1029151084 7:98480948-98480970 GATTGAGGGCAGGAAACTCCTGG + Intergenic
1029341795 7:99951066-99951088 GAATGAGGGCAAGGAACACTTGG - Intergenic
1029604540 7:101590695-101590717 TAATGAGGGCCTGGCACACCTGG + Intergenic
1030277583 7:107737021-107737043 GAATGAGGGCAAAGAACACCTGG - Intergenic
1030365927 7:108645992-108646014 GAATGAGGGCAAGGAACACCTGG - Intergenic
1030460951 7:109835736-109835758 GAATGAAGGCAGAGGACACCTGG + Intergenic
1030783296 7:113627854-113627876 GAATGAGGGCAAGGAACATCTGG - Intergenic
1031308793 7:120167703-120167725 GAATGAGGGCAAGGAACACCTGG + Intergenic
1031795753 7:126172812-126172834 GAATGAGGGCAAGGAACACTTGG + Intergenic
1032320197 7:130879247-130879269 GAATAAGGGAATAGAACACCAGG + Intergenic
1032725718 7:134588577-134588599 GAATGAGGGTAAAGAACACCTGG - Intergenic
1033303033 7:140203058-140203080 GAATGAGGGCAAGGAACACCCGG + Intergenic
1033359236 7:140626408-140626430 GAATGGGAGGAAGGACCACCCGG + Intronic
1033878689 7:145855153-145855175 GAATGAGGACAAGGAACACCTGG + Intergenic
1034246905 7:149651840-149651862 GAATGAGGGCAAGGAACACCTGG - Intergenic
1034356819 7:150457287-150457309 GAATGAGGGCAAGGAACACCTGG - Intronic
1034403896 7:150888471-150888493 GAATGAGGGCAAGGTACACCTGG - Intergenic
1034538127 7:151738521-151738543 AAATGAGGGCAAGGAACACCTGG + Intronic
1034581258 7:152044384-152044406 GAATGAGGGCAAGGAACACCTGG - Intronic
1034942334 7:155238553-155238575 GGATGAGGGCGAGGAACACCTGG - Intergenic
1034942980 7:155244035-155244057 GGATGAGGGCAAGGAACACTTGG - Intergenic
1035554345 8:555019-555041 GTATGAAGGCAAGGAAAAGCAGG + Intergenic
1035588392 8:794623-794645 GAATGCGGGCAAGGAACACCTGG - Intergenic
1035732801 8:1864696-1864718 AAATGAGGGAAAGCAACAGCAGG - Intronic
1036821222 8:11941850-11941872 GAATGAGGGCAAGGAACACCTGG - Intergenic
1038275429 8:26117106-26117128 GAATTTGGGCAAGGATCAGCTGG - Intergenic
1038509283 8:28115840-28115862 GAAGGAGGGCAAGGAAAAACAGG - Intronic
1038677134 8:29633424-29633446 GAATTTGGGCAAGGCACAACAGG + Intergenic
1038733362 8:30147433-30147455 GAATGAGGGCAAAGAACACCTGG - Intronic
1038733881 8:30151741-30151763 GAATGAGGGCAAGGAACACCTGG - Intronic
1039036669 8:33367236-33367258 GAATGATGGCAAGGAACACCTGG + Intergenic
1039338571 8:36621939-36621961 GAATGAGGGCAAGGAACACCCGG - Intergenic
1039511447 8:38095222-38095244 GAATGAGGGCAAGGAACATCTGG + Intergenic
1039691592 8:39870514-39870536 GAATGAGGGCAAGGAACACCTGG + Intergenic
1039692172 8:39875622-39875644 GAATGAGGGCAAGGAACACCTGG + Intergenic
1040318695 8:46278171-46278193 GAATGAGGGCAAGGAACACCTGG + Intergenic
1040319352 8:46284682-46284704 GAACGAGGGCAAGGAACACCTGG + Intergenic
1040381398 8:46876666-46876688 GAATGAAGGCAAGGAATGCCTGG + Intergenic
1040381867 8:46880896-46880918 GAATGAAGACAAGGAACACCTGG + Intergenic
1040528427 8:48244875-48244897 GAATGAGGGCAAGGAACACCTGG - Intergenic
1040529028 8:48250365-48250387 GAATGAGGGCAAGGAACACCTGG - Intergenic
1040529646 8:48256168-48256190 GAATAAGGGCAACGAACACCTGG + Intergenic
1040608817 8:48962418-48962440 GAATGAGGGCAAGGAACACCTGG + Intergenic
1040609393 8:48967622-48967644 TAATGAGGGCAAGGAACACCTGG + Intergenic
1040645382 8:49390988-49391010 GGAATAGGGCAAGGAACACCTGG + Intergenic
1040744648 8:50626722-50626744 GAATGAGGGCAAGGAACACCTGG - Intronic
1040782444 8:51125806-51125828 GAATGAGGGCAAGGAACACCTGG - Intergenic
1040854446 8:51933857-51933879 GAATGAGGGCAAGGAACACCTGG + Intergenic
1040955956 8:52980201-52980223 GAATGAGGGCAAGGAACACCTGG - Intergenic
1040956390 8:52983918-52983940 GAATGAGGGCAAGGAACACCTGG - Intergenic
1040988803 8:53326842-53326864 GAATGAGGGCAAGGAACACCTGG + Intergenic
1041018750 8:53617199-53617221 GAATAAGGGCAAGGAACACCTGG + Intergenic
1041019448 8:53623705-53623727 GAATGAGGGCAATGAACACCTGG + Intergenic
1041065266 8:54076647-54076669 GAATGAGGGCAAGGAACACCTGG + Intronic
1041493476 8:58460837-58460859 GAATGAGAGCAAGGAACACCTGG + Intergenic
1042446244 8:68888802-68888824 GAATGAGGGCAAGGAACACCTGG + Intergenic
1042731970 8:71945964-71945986 AAATCAGTGTAAGGAACACCTGG - Intronic
1042841035 8:73124124-73124146 GGAGCAGGGCAAGGAAAACCTGG - Intergenic
1043024003 8:75044178-75044200 GAATGAGGGCAAGGAACACCTGG + Intergenic
1043024563 8:75049726-75049748 GAATGAGGGCAAGGAACACCTGG + Intergenic
1043201419 8:77373975-77373997 GAATGAGGGCAAGGAACACCTGG + Intergenic
1043758131 8:84030181-84030203 GAGTGAGTGGAAGAAACACCAGG - Intergenic
1043910603 8:85859141-85859163 GAATGAGGGCAAGGAATACCTGG - Intergenic
1043951711 8:86316713-86316735 GAATGAGGGCAAGGAACACCTGG - Intronic
1044016288 8:87051737-87051759 GAATGAAGGCAAAGAACACCTGG - Intronic
1044313040 8:90717278-90717300 GAATGAGGGCAAGGAACAGCTGG + Intronic
1044442274 8:92236673-92236695 GAATGAGGGCAAGGAACATCTGG + Intergenic
1046001073 8:108421469-108421491 GAATGAGGGCAAGGAATACCTGG - Intronic
1046158217 8:110322185-110322207 GAATGAGGGCAAGAAACACCTGG - Intergenic
1046180145 8:110634091-110634113 GAGTGAGAGCAAGCAACAGCAGG - Intergenic
1046389788 8:113555159-113555181 GAATGAGGGCAAGGAACACCTGG - Intergenic
1046479501 8:114797212-114797234 GAATGAAGGCAAGGAACATCTGG - Intergenic
1046479807 8:114800971-114800993 GAATGAGGGCAAGGAACACCTGG + Intergenic
1046493314 8:114981736-114981758 GAATGAGGGCAAGGAACACCTGG + Intergenic
1046641721 8:116739091-116739113 GAATAAGAGCAAGGAACACCTGG + Intronic
1046765723 8:118067396-118067418 GAATGAGGGGAAGGAATACATGG + Intronic
1046998700 8:120552269-120552291 GAATGAGGTCTAAGAAAACCTGG + Intronic
1047347105 8:124039117-124039139 GAATGCTGGCAAGGAACACAGGG - Intronic
1048060693 8:130916629-130916651 GAATGAGGGCAAGGAACACCTGG + Intronic
1048101528 8:131357573-131357595 GAATGAGGGCAATGAACACCCGG + Intergenic
1048686763 8:136912699-136912721 GAATGAGGGCAAGGAACACCTGG - Intergenic
1048702001 8:137102034-137102056 GAATGAGGGCAAGGAATACCTGG - Intergenic
1048772360 8:137908588-137908610 GAATGAGGGCAAGGAACACCTGG + Intergenic
1048918129 8:139203656-139203678 GAATGAGGGCAAGGAATACCTGG - Intergenic
1049460574 8:142725833-142725855 GAATAAGGGCAAGGAACACCTGG + Intergenic
1049605256 8:143526338-143526360 GAATGAGTGGCAGGAAGACCAGG + Intronic
1049857375 8:144871181-144871203 GAATGAGGGCAAGGAATACCTGG + Intergenic
1049860893 8:144897924-144897946 GAATGAGGGCAAGGAACACCTGG - Intronic
1050129223 9:2392865-2392887 GAATAAGGGCAAGGAACACCTGG + Intergenic
1050633707 9:7587072-7587094 GAATGAGGGCAAGTAACACCTGG - Intergenic
1050906645 9:11013928-11013950 GAATGAGGGCAAGGAATAACTGG - Intergenic
1051271517 9:15359949-15359971 GAATGAGGGCAAGGAATACCTGG - Intergenic
1051844264 9:21434005-21434027 GAATGAGGGCAAGGAACACCTGG + Intronic
1053205212 9:36180334-36180356 GAATGAGGGCAAGGAACACCTGG + Intergenic
1054750080 9:68896918-68896940 GAAGGAAGGGAAGGAACAACGGG - Intronic
1055318319 9:75056188-75056210 GAATGAGGACAAGGAACACCTGG + Intergenic
1055408372 9:75999637-75999659 GAATGAGGGCAAGCAACACCTGG - Intronic
1055452504 9:76443554-76443576 GAATGAGGGCAAGGAACACCTGG - Intronic
1055625439 9:78172718-78172740 GAATGAGGGCAAGGAACACCTGG + Intergenic
1056379962 9:86048052-86048074 GACACAGGGCAAGGAACATCTGG - Intronic
1056415906 9:86376106-86376128 AAATGAGGGCAAGGAACCCCTGG + Intergenic
1056566766 9:87779666-87779688 GAATGAGGGCAAGGAACACCTGG - Intergenic
1056915197 9:90740103-90740125 GAATGAGGCCAAGGAACACCTGG - Intergenic
1057168467 9:92946560-92946582 GAATGAGGGCAAGTAACACCTGG - Intergenic
1057285619 9:93751424-93751446 GAATGAGGGCAAGGAACACCTGG - Intergenic
1057286102 9:93755661-93755683 GGATGGGGGCAAGGAACACCTGG - Intergenic
1057380867 9:94566317-94566339 GAATGAGGGCAAGGAACACCTGG + Intronic
1057625154 9:96670016-96670038 GAATGAGGGCAAGGAACACCTGG + Intergenic
1057627829 9:96693404-96693426 GAATGAGGGCAAGGAACACCTGG - Intergenic
1057664149 9:97030781-97030803 GAATGAGAGCAAGGAACACCTGG - Exonic
1057730794 9:97606480-97606502 AAATGAGGGCAATGGAGACCTGG + Intronic
1057934851 9:99228443-99228465 CAAAGAGGCCAAGGAACTCCTGG - Intronic
1058226230 9:102368007-102368029 GAAAGAGGGCAAGGAACACCTGG + Intergenic
1058335625 9:103824802-103824824 GAATGAGGGCAAGGGACACCTGG - Intergenic
1058520477 9:105810593-105810615 GAATGAGGGCAAGGAACACCTGG - Intergenic
1059869134 9:118551565-118551587 AAATGAGGGAAAGGAAAACTGGG - Intergenic
1059875892 9:118634302-118634324 GGATGAGGGCAAGGAACACCTGG - Intergenic
1060195623 9:121621495-121621517 GGCTGAGGGGAAGGCACACCAGG - Intronic
1060326510 9:122621278-122621300 GAATGAGGGCAAGGAACACCTGG - Intergenic
1060975067 9:127760252-127760274 GGCAGAGGGCAAGGAGCACCAGG - Intronic
1061602488 9:131680503-131680525 GAATGAGGGCAAGGAACACCTGG + Intronic
1061603066 9:131685429-131685451 GAATGAGGGCAAGGAACACGGGG + Intronic
1061606990 9:131718201-131718223 CTCTGAGGGAAAGGAACACCTGG + Intronic
1061698111 9:132393366-132393388 GAATGAGGGCAAGGAACACCGGG + Intronic
1061799728 9:133107219-133107241 CAAGAAGGGCAAGGAGCACCTGG - Exonic
1203687146 Un_GL000214v1:5936-5958 GAATGAGGACAAGGAATACCTGG + Intergenic
1203732240 Un_GL000216v2:101088-101110 GAATGAGAGCAAGGGATTCCAGG + Intergenic
1203755489 Un_GL000218v1:121765-121787 GAATGAGAACAAGGAATACCTGG - Intergenic
1203714863 Un_KI270742v1:134362-134384 GAATGAGGACAAGGAATACCTGG - Intergenic
1203536354 Un_KI270743v1:43791-43813 GAATGAGGACAAGGAATACCTGG + Intergenic
1203649129 Un_KI270751v1:98117-98139 GAATGAGGACAAGGAATACCTGG - Intergenic
1186095771 X:6100219-6100241 GAATGAGGGCAAGGAACACCTGG - Intronic
1186277676 X:7957584-7957606 GAATGAGGGCAAGGAACACCTGG - Intergenic
1186319297 X:8406953-8406975 AAATGAGGGCATGAAAAACCAGG + Intergenic
1186353626 X:8766861-8766883 GAATGAGGGCAAGGAATACCTGG - Intergenic
1186518605 X:10186060-10186082 GAATGGGGTCACAGAACACCAGG + Intronic
1187010347 X:15272058-15272080 GAATGAGTACAAGTAAAACCGGG + Intergenic
1187115026 X:16340763-16340785 GAATGAGGGCAAGGAACATCTGG + Intergenic
1187381151 X:18803316-18803338 GAATGAAGGCAAGGAACACCTGG - Intronic
1187989371 X:24852772-24852794 GAATGAGGCCAAGGATCTTCCGG - Intronic
1188038168 X:25341422-25341444 GAATGAGGGCAAGGAACAGCTGG + Intergenic
1188116046 X:26243947-26243969 GAATGAGGGCAAGGAACACCTGG - Intergenic
1188469965 X:30527493-30527515 GAATGAGGGCAAGGAACACCTGG - Intergenic
1188481356 X:30639956-30639978 GAATAAGGGCAAGGAACGCCTGG - Intergenic
1188768140 X:34122283-34122305 GAATGAGGGCAAGGAACACCTGG + Intergenic
1188847414 X:35090297-35090319 GAATGAGGGCAAGGAACACCTGG + Intergenic
1188865685 X:35310680-35310702 GAATGAGGTCAAGGAACACCTGG - Intergenic
1188894123 X:35645538-35645560 GAATGAGGGCAAGGAATACCTGG - Intergenic
1188965508 X:36546236-36546258 GAATGAGGGCAAGGAATACCTGG - Intergenic
1189413756 X:40795711-40795733 CAAGAAGCGCAAGGAACACCTGG + Intergenic
1189670314 X:43401179-43401201 GAATGAGGACAAGGAATACCTGG + Intergenic
1189751777 X:44230003-44230025 AAATGAGCTTAAGGAACACCAGG + Intronic
1189978010 X:46481878-46481900 GAATGAGGGCAAGGGACACCTGG - Intronic
1190184135 X:48220065-48220087 GAATGAGAGCAAGGAACACCTGG + Intronic
1190324770 X:49199840-49199862 GAGTGAGGGCAAGGGACAAGGGG - Intronic
1190614887 X:52220183-52220205 GAATGAGGGCAAGGAAGAACTGG + Intergenic
1190974314 X:55385055-55385077 GAATGAGGGCAAGGAACACCTGG - Intergenic
1191149274 X:57203378-57203400 GAATAAGGGCAAGGAACACCTGG - Intergenic
1191149818 X:57208902-57208924 GCATGAGGGCAAGGAACACATGG - Intergenic
1191703325 X:64066115-64066137 GAATAAGGGCAAGGAAAACCTGG - Intergenic
1191833357 X:65438789-65438811 GGATGAGGGCAAGGAACACCTGG - Intronic
1191833913 X:65443697-65443719 GAATGAGGGCAAGGAACACCTGG - Intronic
1191848398 X:65567710-65567732 GAATGAGGGCAAGGAACACCTGG - Intergenic
1191919434 X:66239011-66239033 GAATGAGGGCAAGGAACACCTGG - Intronic
1191949124 X:66569494-66569516 GAATGAGGGCAAGGAACACCTGG - Intergenic
1192687112 X:73318680-73318702 GAATGAGGGCAAGGAACACCTGG - Intergenic
1192687795 X:73324986-73325008 GAATGAGGGCAAGGAACACCTGG - Intergenic
1192767637 X:74158674-74158696 GAATGAGGGTGAGAAACACCTGG - Intergenic
1192884567 X:75323322-75323344 GAATGAGGGCAAGGAACACCTGG + Intergenic
1192885203 X:75329487-75329509 GAATGAGGGCAAGGAACAGCTGG + Intergenic
1193048525 X:77077768-77077790 GAATGAGGGCAAGGAACACCTGG + Intergenic
1193048981 X:77081545-77081567 GAATGAGGTCAAGGAACACCTGG + Intergenic
1193063207 X:77229016-77229038 GAATGAGGACAAGGAACACCTGG + Intergenic
1193074494 X:77341131-77341153 GAATGAGGGCAAGGAACACCTGG + Intergenic
1193120548 X:77818768-77818790 GAATGAGGGCTAGGAAAATGAGG - Intergenic
1193209267 X:78786563-78786585 GAATGAGGGCAAGGAACACGTGG + Intergenic
1193289033 X:79750144-79750166 GAATGAGGGCAAGGAACACCTGG - Intergenic
1193313957 X:80042755-80042777 GAATGAGGGCAAGGAACACCTGG + Intergenic
1193314474 X:80047908-80047930 GAATGAGGGCAAGGAACACCTGG + Intergenic
1193396379 X:80988616-80988638 GAATGAGGGCAAGGAACACCTGG - Intergenic
1193787281 X:85774628-85774650 AAATGAGGGCAAGGAACACCTGG - Intergenic
1193915986 X:87364504-87364526 GAGTGAGGGCAAGGAACACCTGG + Intergenic
1194122153 X:89974966-89974988 GAATGAGGGCAAGGAACACCTGG - Intergenic
1194162221 X:90468086-90468108 GAATGAGGGCAAGGAACACCTGG - Intergenic
1194309426 X:92286044-92286066 GAATGAGGGCAAGAAACACCTGG - Intronic
1194355250 X:92874992-92875014 GAATGTGGGCAAGGAACACCTGG - Intergenic
1194536342 X:95109112-95109134 GAATAAGGGCAAGGAATACCTGG - Intergenic
1194543551 X:95204633-95204655 GGATGAGGGCAAGGAACACCTGG + Intergenic
1194696017 X:97052163-97052185 GAATGAGAGCAGGGAAGACAAGG + Intronic
1194704364 X:97156959-97156981 GAATGAGGGCTAGGAAAATGAGG + Intronic
1194913255 X:99673394-99673416 GAATGAGGGCAAGGAACACCTGG - Intergenic
1194938927 X:99985962-99985984 GAATGAGCGCAATGAGTACCTGG + Intergenic
1195334122 X:103832415-103832437 GAAGGAGGACAAGGGAGACCAGG - Intergenic
1195546091 X:106114233-106114255 GAATGAGGACAAGGAACACCTGG - Intergenic
1196298787 X:114030665-114030687 GAATGAGGGCAAGGAACACCTGG + Intergenic
1196390908 X:115206420-115206442 GAATGAGGGCAAGGAACACCTGG + Intronic
1196471622 X:116035349-116035371 GAATGAGGGCAAGGAAAACCTGG + Intergenic
1196472201 X:116041068-116041090 GAATGAGGGCAAGGAACACCTGG + Intergenic
1196994412 X:121365749-121365771 AGAGTAGGGCAAGGAACACCTGG + Intergenic
1197109479 X:122756016-122756038 GAATGAGGGCAAGGAACACCTGG - Intergenic
1197479260 X:126962568-126962590 GAATGAGGGCAAGGAACACCTGG + Intergenic
1198690077 X:139272824-139272846 GAATGAGGTCGAGGAAAAACAGG - Intergenic
1198715057 X:139549685-139549707 GAATGAGGGCAAGGAACACCTGG - Intronic
1199008313 X:142729123-142729145 GAACGAGGGCAAGGAACATCTGG - Intergenic
1199040716 X:143111997-143112019 GAATGAGGGCAAGGAACACCCGG + Intergenic
1200412260 Y:2872519-2872541 GAATGAGGGCAAGGAACACCTGG - Intronic
1200475008 Y:3632400-3632422 GAATGATGGCAAGGAACACCTGG - Intergenic
1200508498 Y:4045823-4045845 GAATGAGGGCAAGGAACACCTGG - Intergenic
1200617719 Y:5400291-5400313 GAATGAGGGCAAGAAACACCTGG - Intronic
1200663606 Y:5992014-5992036 GAATGTGGGCAAGGAACACCTGG - Intergenic
1200813965 Y:7512749-7512771 GAATTAGGGCAAGGAACACCTGG + Intergenic
1200862014 Y:8003169-8003191 GGTTTAGGGCAATGAACACCTGG - Intergenic
1200906193 Y:8485275-8485297 GAATGAGGGCAAGGAACACCTGG - Intergenic
1200979054 Y:9244708-9244730 GAATGAGGGCAAGGAATACCTGG + Intergenic
1201169101 Y:11239370-11239392 GAATGAGGACAAGGAATACCTGG - Intergenic
1201358940 Y:13125616-13125638 GGAGTAGGGCAAGGAACACTTGG - Intergenic
1201362647 Y:13170088-13170110 GAATGAGGGCAAGGAACGCCTGG - Intergenic
1201363210 Y:13175694-13175716 CAATAAGAGCAAGGAACACTTGG - Intergenic
1201369934 Y:13252657-13252679 GAATGAGGGCAAGGAACACCTGG + Intronic
1201370601 Y:13258983-13259005 GAATGAGGGCAAGGAACGCCTGG + Intronic
1201408575 Y:13674020-13674042 GAATAAGGGCAAGGAACAACTGG - Intergenic
1201670857 Y:16518652-16518674 GAATGAGGGCAAGGAATACCTGG + Intergenic
1201700757 Y:16878954-16878976 GAATGAGGGCAAGGAACACCTGG + Intergenic
1201857046 Y:18556209-18556231 GAATGAGGGCGAGGAACACCTGG - Intronic
1201857362 Y:18559466-18559488 GAATGAGGGCAAGAAACAGCTGG - Intronic
1201875959 Y:18760914-18760936 GAATGAGGGCAAGAAACAGCTGG + Intronic
1201876275 Y:18764171-18764193 GAATGAGGGCGAGGAACACCTGG + Intronic
1201889529 Y:18926773-18926795 GAATGAGGGCAAGGAACACCTGG + Intergenic
1201893000 Y:18963089-18963111 GAATGAGGGCAAGGAACACCTGG - Intergenic
1201926470 Y:19293380-19293402 GAAAGAGGGCAAGGAATTCCTGG + Intergenic
1201926947 Y:19297887-19297909 GAATGACGGCAAGGAACACCTGG + Intergenic
1201959195 Y:19660157-19660179 GAATGAAGGCAAAGGAGACCTGG - Intergenic
1202019428 Y:20449558-20449580 GAATGACGGCAAGGAACACCTGG - Intergenic
1202041027 Y:20684243-20684265 GAATGAGGGCAAGGAACACCTGG - Intergenic
1202083917 Y:21115101-21115123 GAATGAGGGCAAGGAACATCTGG - Intergenic
1202132322 Y:21624455-21624477 AAATGAGGGCAGGGAATACCTGG - Intergenic
1202164199 Y:21969354-21969376 GAATGAGGGCAAAAAACACCTGG - Intergenic
1202169788 Y:22031269-22031291 GAATGAAGGCCAAGGACACCTGG + Intergenic
1202170207 Y:22035417-22035439 GAATGTGGGCAAGGAACACCTGG + Intergenic
1202221159 Y:22550956-22550978 GAATGTGGGCAAGGAACACCTGG - Intergenic
1202221578 Y:22555104-22555126 GAATGAAGGCCAAGGACACCTGG - Intergenic
1202227157 Y:22617018-22617040 GAATGAGGGCAAAAAACACCTGG + Intergenic
1202315965 Y:23578636-23578658 GAATGAGGGCAAAAAACACCTGG - Intergenic
1202321540 Y:23640568-23640590 GAATGAAGGCCAAGGACACCTGG + Intergenic
1202321954 Y:23644706-23644728 GAATGTGGGCAAGGAACACCTGG + Intergenic
1202548813 Y:26025350-26025372 GAATGTGGGCAAGGAACACCTGG - Intergenic
1202549227 Y:26029488-26029510 GAATGAAGGCCAAGGACACCTGG - Intergenic
1202554800 Y:26091431-26091453 GAATGAGGGCAAAAAACACCTGG + Intergenic
1202628700 Y:56886470-56886492 GAATGAGGGCAAGGGATTCCAGG - Intergenic