ID: 1096308346

View in Genome Browser
Species Human (GRCh38)
Location 12:50498698-50498720
Sequence GTTCCTTGCCCTCATTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096308344_1096308346 -7 Left 1096308344 12:50498682-50498704 CCTGCATGGGCCAGGTGTTCCTT No data
Right 1096308346 12:50498698-50498720 GTTCCTTGCCCTCATTCCCATGG No data
1096308339_1096308346 12 Left 1096308339 12:50498663-50498685 CCTTTAAGCGGTTTTCTGCCCTG 0: 76
1: 203
2: 215
3: 197
4: 163
Right 1096308346 12:50498698-50498720 GTTCCTTGCCCTCATTCCCATGG No data
1096308343_1096308346 -6 Left 1096308343 12:50498681-50498703 CCCTGCATGGGCCAGGTGTTCCT No data
Right 1096308346 12:50498698-50498720 GTTCCTTGCCCTCATTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096308346 Original CRISPR GTTCCTTGCCCTCATTCCCA TGG Intergenic
No off target data available for this crispr