ID: 1096308347

View in Genome Browser
Species Human (GRCh38)
Location 12:50498699-50498721
Sequence TTCCTTGCCCTCATTCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096308339_1096308347 13 Left 1096308339 12:50498663-50498685 CCTTTAAGCGGTTTTCTGCCCTG 0: 76
1: 203
2: 215
3: 197
4: 163
Right 1096308347 12:50498699-50498721 TTCCTTGCCCTCATTCCCATGGG No data
1096308343_1096308347 -5 Left 1096308343 12:50498681-50498703 CCCTGCATGGGCCAGGTGTTCCT No data
Right 1096308347 12:50498699-50498721 TTCCTTGCCCTCATTCCCATGGG No data
1096308344_1096308347 -6 Left 1096308344 12:50498682-50498704 CCTGCATGGGCCAGGTGTTCCTT No data
Right 1096308347 12:50498699-50498721 TTCCTTGCCCTCATTCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096308347 Original CRISPR TTCCTTGCCCTCATTCCCAT GGG Intergenic
No off target data available for this crispr