ID: 1096308349

View in Genome Browser
Species Human (GRCh38)
Location 12:50498706-50498728
Sequence TGGAACACCCATGGGAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096308349_1096308357 -2 Left 1096308349 12:50498706-50498728 CCCTCATTCCCATGGGTGTTCCA No data
Right 1096308357 12:50498727-50498749 CACCTTCCGGCATGGGCGTTAGG No data
1096308349_1096308358 -1 Left 1096308349 12:50498706-50498728 CCCTCATTCCCATGGGTGTTCCA No data
Right 1096308358 12:50498728-50498750 ACCTTCCGGCATGGGCGTTAGGG No data
1096308349_1096308355 -9 Left 1096308349 12:50498706-50498728 CCCTCATTCCCATGGGTGTTCCA No data
Right 1096308355 12:50498720-50498742 GGTGTTCCACCTTCCGGCATGGG No data
1096308349_1096308354 -10 Left 1096308349 12:50498706-50498728 CCCTCATTCCCATGGGTGTTCCA No data
Right 1096308354 12:50498719-50498741 GGGTGTTCCACCTTCCGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096308349 Original CRISPR TGGAACACCCATGGGAATGA GGG (reversed) Intergenic
No off target data available for this crispr